DRA SearchDRASearch

  • Search Home
  • DRA Home

ERX1379631

FASTQ

SRA

Experiment Detail

TitleNextSeq 500 paired end sequencing; A generic, cost-effective and scalable cell lineage analysis platform
Design DescriptionA generic, cost-effective and scalable cell lineage analysis platform
OrganismHomo sapiens

Library Description

NameSample 599
StrategyAMPLICON
SourceGENOMIC
SelectionPCR
LayoutPAIRED
Orientation
Nominal Length167
Nominal Sdev37
Construction ProtocolSampling single cells using Cellcelector WGA was applied to single cells which were picked using the cell celector either immediately after cell deposition in PCR plates or after plate storage at -20oC. WGA was performed using REPLI-g Mini kit (Qiagen) with a modified protocol: 96-well plate containing single cells in PBS buffer was centrifuged at 4500 rpm for 5 minutes. 3.5 μl of buffer D2 was added and cells were lysed on ice for 10 minutes. Following addition of 3.5μl stop buffer and centrifugation at 4500 rpm for 5 minutes, 20μl of mix containing Buffer REPLI-g and Polymerase REPLI-g (at the same proportions as recommended in manual) was added and sample was incubated at 37oC for 16 hours. We used a multiplex diagnostic PCR targeting 4 genomic regions of different lengths as a diagnostics PCR . A single band in a 1.5% agarose gel was sufficient to flag the sample as positive for subsequent Access Array analysis. Following dilution of the purified PCR from the 1st PCR (1:100), sample specific barcoding was performed using standard PCR with Forward and Reverse primer combinations (Sigma). The indexes within the primer sequences and their dual combination annotated the original SC samples and produced a ready to run Truseq HT NGS library using the standard Illumina sequences. Primer formations are: Fw primer: AATGATACGGCGACCACCGAGATCTACAC[Fw_Index_D5XX]ACACTCTTTCCCTACACGACGCTCTTCCG; Rev primer: CAAGCAGAAGACGGCATACGAGAT[Rev_Index_D7XX]GTGACTGGAGTTCAGACGTGTGCTCTTCCG; where square brackets indicate sequencing indexes (Supplementary Table 3, Supplementary Fig. 4). PCR was performed using Q5 High-Fidelity DNA Polymerase (M0491S, NEB) according to recommended protocol. In order to track and prevent over cycling, PCR reaction was added with SYBR green I (Lonza) at a final reaction of X0.5 and was tracked using a real time PCR machine (LC480, Roche). Reaction protocol was: 95oC for 2 minutes, followed by 5 amplification steps of 95oC for 30 seconds, 56oC for 30 seconds and 72oC for 30 seconds and 12 amplification steps of 95oC for 30 seconds and 72oC for 1 minute. Final elongation was performed at 72oC for 10 minutes. PCR reactions were purified using 0.8X volumes of Agencourt AMPure XP beads according to the abovementioned protocol.

Platform

PlatformILLUMINA
Instrument ModelNextSeq 500

Processing

Base Calls
Sequence Space
Base Caller

Spot Information

Number of Reads per Spots0
Spot Length64

Read Spec

Read Index 0
Read Label
Read ClassApplication Read
Read TypeForward
Base Coord1
Read Index 1
Read Label
Read ClassApplication Read
Read TypeReverse
Base Coord33

Navigation

Submission ERA572898 FTP
Study ERP014537
Sample ERS1080468
Run ERR1308008 FASTQ SRA
Website policy | © DNA Data Bank of Japan