Sample Detail

TitleE-MTAB-7750:Sample 47
DescriptionProtocols: Faecal pellets for collected from each mouse at the start and end of each experiment as described below. They were transferred into Eppendorf tubes and immediately stored at -80C for DNA extraction and 16S rDNA sequencing. Co-housing experiments:Two to three adult (3 months old) females were consolidated with 2-3 aged females (22 months old) per cage for 30-40 days. Faecal pellets were collected from all mice before co-housing and at the end of the experiment. Faecal samples were stored at -80C for 16S rDNA sequencing. Faecal microbiota transplantation (FMT) experiments: FMT was achieved by oral gavage of a faecal slurry. Recipient mice had the food removed from the cage for 2 hours prior to FMT. The faecal slurry was obtained by pooling faecal pellets from 8-14 donor mice. The pellets were weighed and resuspended by vortexing for 1min in 1mL PBS per 300mg of faeces. After pelleting larger particles by centrifugation at 500g for 5min, the supernatant was collected for FMT. Each recipient mouse received 150ul of faecal slurry by oral gavage. The remaining slurry was stored at -80C for 16S rRNA sequencing. Following FMT, the cages of recipient mice were replenished with dirty bedding and fresh faecal pellets from donor mice once and twice a week, respectively. Faecal pellets for 16S rRNA sequencing were collected the day before FMT and at the end of the experiment, and were stored at -80C for DNA extraction. Bacterial DNA was isolated from faecal pellets using the QIAamp PowerFecal DNA Kit (Qiagen #12830-50) following the manufacturer's instructions. First, samples were homogenised by bead beating using a FastPrep24 machine at 5m/s for 50sec. Total genomic DNA was captured on a silica membrane and the QIAmp Inhibitor Removal Technology was used to remove common substances that can interfere with downstream applications. In the final step, purified DNA was eluted in 70ul of Solution C6. DNA concentrations were determined using the Qubit dsDNA High Sensitivity Assay Kit (Invitrogen #Q32854) on a Qubit 4 Fluorometer (Invitrogen). High-throughput sequencing of the V3-V4 hypervariable region of the bacterial 16S rRNA gene was performed by the Beijing Genomics Institute (BGI) where, first, DNA integrity was assessed by agarose gel electrophoresis. After DNA quantification by Qubit Fluorometer, 30ng DNA per sample were utilised to PCR-amplify the V3-V4 region using 341F forward (ACTCCTACGGGAGGCAGCAG) and 806R reverse fusion primers (GGACTACHVGGGTWTCTAAT). The PCR products were purified using Agencourt AMPure XP beads (Beckman Coulter) for library validation using the Agilent 2100 bioanalyzer instrument (Agilent DNA 1000 Reagents).

Organism Info

Taxon ID10090
Common Name
Scientific NameMus musculus
Anonymized Name
Individual Name