Sample Detail

TitleSample 1
DescriptionProtocols: RNA was isolated using the RNeasy Mini kit (Qiagen) with on-column DNaseI-treatment and RNA integrity was validated by the RNA 6000 Nano kit on the 2100 BioAnalyzer (Agilent, Santa Clara, USA). Mouse embryonic fibroblast Rb-/- Line 3 (ME3) cells were previously generated (41) and characterized to be a model of beige adipocytes (42–46). Cells were grown in AmnioMAX -C100 (Thermo Fisher Scientific, Waltham, Massachusetts, USA) supplemented with 7.5% FBS (Thermo Fisher Scientific, Waltham, MA, USA ), 7.5% C100 (Thermo Fisher Scientific), 1% penicillin-streptomycin (PEST) (Sigma, St. Louis, MO, USA) and 2 mM L-glutamine (Sigma) at 37oC and 5% CO2. Cells were initiated to differentiate three days post confluency (day 0) by induction medium containing 5 ug/mL Insulin (INS) (Sigma), 1 μM Dexametasone (DEX) (Sigma), 0.5 mM isobutyl methylxanthine (IBMX) (Sigma) and 1 μM Rosiglitazone (ROSI) (Cayman Chemical, ann Arbor, MI, USA). From day 2 to day 4 only insulin was added to the basal medium and from day 4 to 7 cells were grown in the basal medium. Stable knockout (KO) of Irx3 in ME3 cells was performed by CRISPR-Cas9 as described in (17, 75) with guide RNA MM0000204919 (CCGTCCCAAGAACGCCACCCGG) (Sigma). Cells were washed in PBS, lysed by addition of RLT buffer (Qiagen, Hilden, Germany) and homogenized by centrifugation on QIAShredder columns (Qiagen) before snap-freezing in liquid nitrogen. RNA was isolated using the RNeasy Mini kit (Qiagen) with on-column DNaseI-treatment and RNA integrity was validated by the RNA 6000 Nano kit on the 2100 BioAnalyzer (Agilent, Santa Clara, USA). Library preparation and 2x75bp paired-end mRNA sequencing was performed using the TruSeq Stranded mRNA kit (Illumina, Sand Diego, CA, USA) and the HiSeq4000 instrument (Illumina) at the Genomics Core Facility (GCF), Department of Clinical Science, at University of Bergen/Haukeland University Hospital.

Organism Info

Taxon ID10090
Common Namehouse mouse
Scientific NameMus musculus
Anonymized Name
Individual Name