Small RNA libraries of THP-1RNA, no treatment

Small RNA libraries of THP-1RNA, no treatment PRJDA50505 none provided SAMD00008952 O85 OTHER TRANSCRIPTOMIC other none provided 36 0 Application Read Forward 1 1 Technical Read Adapter ATCTCGTATGCCGTCTTCTGCTTG Illumina Genome Analyzer II Solexa primary analysis Small RNA libraries of THP-1RNA, after 3 day treatment with PAPD4 (GLD-2) siRNA transfection PRJDA50505 none provided SAMD00008954 O81 OTHER TRANSCRIPTOMIC other none provided 36 0 Application Read Forward 1 1 Technical Read Adapter ATCTCGTATGCCGTCTTCTGCTTG Illumina Genome Analyzer II Solexa primary analysis Small RNA libraries of THP-1RNA, after 3 day treatment with PAPD5 siRNA transfection PRJDA50505 none provided SAMD00008951 O82 OTHER TRANSCRIPTOMIC other none provided 36 0 Application Read Forward 1 1 Technical Read Adapter ATCTCGTATGCCGTCTTCTGCTTG Illumina Genome Analyzer II Solexa primary analysis Small RNA libraries of THP-1RNA, after 3 day treatment with PAPD7 siRNA transfection PRJDA50505 none provided SAMD00008953 O83 OTHER TRANSCRIPTOMIC other none provided 36 0 Application Read Forward 1 1 Technical Read Adapter ATCTCGTATGCCGTCTTCTGCTTG Illumina Genome Analyzer II Solexa primary analysis Small RNA libraries of THP-1RNA, untreated PRJDA50505 none provided SAMD00008948 O99 OTHER TRANSCRIPTOMIC other none provided 36 0 Application Read Forward 1 1 Technical Read Adapter ATCTCGTATGCCGTCTTCTGCTTG Illumina Genome Analyzer II Solexa primary analysis Small RNA libraries of THP-1RNA, immunoprecipitated by anti-AGO1 antibody PRJDA50505 none provided SAMD00008947 O96 OTHER TRANSCRIPTOMIC other none provided 36 0 Application Read Forward 1 1 Technical Read Adapter ATCTCGTATGCCGTCTTCTGCTTG Illumina Genome Analyzer II Solexa primary analysis Small RNA libraries of THP-1RNA, immunoprecipitated by anti-AGO2 antibody PRJDA50505 none provided SAMD00008949 O97 OTHER TRANSCRIPTOMIC other none provided 36 0 Application Read Forward 1 1 Technical Read Adapter ATCTCGTATGCCGTCTTCTGCTTG Illumina Genome Analyzer II Solexa primary analysis Small RNA libraries of THP-1RNA, immunoprecipitated by anti-AGO3 antibody PRJDA50505 none provided SAMD00008950 O98 OTHER TRANSCRIPTOMIC other none provided 36 0 Application Read Forward 1 1 Technical Read Adapter ATCTCGTATGCCGTCTTCTGCTTG Illumina Genome Analyzer II Solexa primary analysis