PRJDB2651 none provided SAMD00013521 Q21-CA AMPLICON TRANSCRIPTOMIC RT-PCR RNA was extracted using Isogen protocol and cDNA synthesized using the SuperScript II kit (Invitrogen) with oligo-dT primers (Invitrogen) according to manufacturer?s protocol. cDNAs were then amplified using ExTaq polymerase kit (TAKARA). TRAV14 (CCAATCTCTGACAGTCTGGGAA) and TRAC (AACTGGTACACAGCAGGTTCTG) primers were used for TRAV14 repertoire; TRBV2 (CGAACAGTATCTAGGCCACAATGC) and TRBC (GCACACGAGGGTAGCCTTTTGTTT) primers for TRBV2 repertoire. PCR program was as follow: 4 min at 94 ?C; x cycles of 30 s at 94 ?C, 30 s at 62 ?C, 30 s at 72 ?C; 5 min at 72 ?C 5; hold at 4 ?C. The number of cycles was adapted to the initial number of cells (24 or 25 cycles for conventional T cells, 27 to 29 for regulatory T cells) as we observed the formation of heteroduplexes in saturated reactions. PCR products were sequenced on a Roche Genome Sequencer FLX Titanium system after adapter ligation following standard procedures. 400 0 Technical Read Adapter 1 1 Technical Read Primer CCAATCTCTGACAGTCTGGGAA AACTGGTACACAGCAGGTTCTG 2 Application Read Other 454 GS FLX Titanium 2.3 (090928_1418) PRJDB2651 none provided SAMD00013525 Q22-GA AMPLICON TRANSCRIPTOMIC RT-PCR RNA was extracted using Isogen protocol and cDNA synthesized using the SuperScript II kit (Invitrogen) with oligo-dT primers (Invitrogen) according to manufacturer?s protocol. cDNAs were then amplified using ExTaq polymerase kit (TAKARA). TRAV14 (CCAATCTCTGACAGTCTGGGAA) and TRAC (AACTGGTACACAGCAGGTTCTG) primers were used for TRAV14 repertoire; TRBV2 (CGAACAGTATCTAGGCCACAATGC) and TRBC (GCACACGAGGGTAGCCTTTTGTTT) primers for TRBV2 repertoire. PCR program was as follow: 4 min at 94 ?C; x cycles of 30 s at 94 ?C, 30 s at 62 ?C, 30 s at 72 ?C; 5 min at 72 ?C 5; hold at 4 ?C. The number of cycles was adapted to the initial number of cells (24 or 25 cycles for conventional T cells, 27 to 29 for regulatory T cells) as we observed the formation of heteroduplexes in saturated reactions. PCR products were sequenced on a Roche Genome Sequencer FLX Titanium system after adapter ligation following standard procedures. 400 0 Technical Read Adapter 1 1 Technical Read Primer CCAATCTCTGACAGTCTGGGAA AACTGGTACACAGCAGGTTCTG 2 Application Read Other 454 GS FLX Titanium 2.3 (090928_1418) PRJDB2651 none provided SAMD00013539 Q23-GA AMPLICON TRANSCRIPTOMIC RT-PCR RNA was extracted using Isogen protocol and cDNA synthesized using the SuperScript II kit (Invitrogen) with oligo-dT primers (Invitrogen) according to manufacturer?s protocol. cDNAs were then amplified using ExTaq polymerase kit (TAKARA). TRAV14 (CCAATCTCTGACAGTCTGGGAA) and TRAC (AACTGGTACACAGCAGGTTCTG) primers were used for TRAV14 repertoire; TRBV2 (CGAACAGTATCTAGGCCACAATGC) and TRBC (GCACACGAGGGTAGCCTTTTGTTT) primers for TRBV2 repertoire. PCR program was as follow: 4 min at 94 ?C; x cycles of 30 s at 94 ?C, 30 s at 62 ?C, 30 s at 72 ?C; 5 min at 72 ?C 5; hold at 4 ?C. The number of cycles was adapted to the initial number of cells (24 or 25 cycles for conventional T cells, 27 to 29 for regulatory T cells) as we observed the formation of heteroduplexes in saturated reactions. PCR products were sequenced on a Roche Genome Sequencer FLX Titanium system after adapter ligation following standard procedures. 400 0 Technical Read Adapter 1 1 Technical Read Primer CGAACAGTATCTAGGCCACAATGC GCACACGAGGGTAGCCTTTTGTTT 2 Application Read Other 454 GS FLX Titanium 2.3 (090928_1418) PRJDB2651 none provided SAMD00013538 Q24-GA AMPLICON TRANSCRIPTOMIC RT-PCR RNA was extracted using Isogen protocol and cDNA synthesized using the SuperScript II kit (Invitrogen) with oligo-dT primers (Invitrogen) according to manufacturer?s protocol. cDNAs were then amplified using ExTaq polymerase kit (TAKARA). TRAV14 (CCAATCTCTGACAGTCTGGGAA) and TRAC (AACTGGTACACAGCAGGTTCTG) primers were used for TRAV14 repertoire; TRBV2 (CGAACAGTATCTAGGCCACAATGC) and TRBC (GCACACGAGGGTAGCCTTTTGTTT) primers for TRBV2 repertoire. PCR program was as follow: 4 min at 94 ?C; x cycles of 30 s at 94 ?C, 30 s at 62 ?C, 30 s at 72 ?C; 5 min at 72 ?C 5; hold at 4 ?C. The number of cycles was adapted to the initial number of cells (24 or 25 cycles for conventional T cells, 27 to 29 for regulatory T cells) as we observed the formation of heteroduplexes in saturated reactions. PCR products were sequenced on a Roche Genome Sequencer FLX Titanium system after adapter ligation following standard procedures. 400 0 Technical Read Adapter 1 1 Technical Read Primer CGAACAGTATCTAGGCCACAATGC GCACACGAGGGTAGCCTTTTGTTT 2 Application Read Other 454 GS FLX Titanium 2.3 (090928_1418) PRJDB2651 none provided SAMD00013536 Q25-GA AMPLICON TRANSCRIPTOMIC RT-PCR RNA was extracted using Isogen protocol and cDNA synthesized using the SuperScript II kit (Invitrogen) with oligo-dT primers (Invitrogen) according to manufacturer?s protocol. cDNAs were then amplified using ExTaq polymerase kit (TAKARA). TRAV14 (CCAATCTCTGACAGTCTGGGAA) and TRAC (AACTGGTACACAGCAGGTTCTG) primers were used for TRAV14 repertoire; TRBV2 (CGAACAGTATCTAGGCCACAATGC) and TRBC (GCACACGAGGGTAGCCTTTTGTTT) primers for TRBV2 repertoire. PCR program was as follow: 4 min at 94 ?C; x cycles of 30 s at 94 ?C, 30 s at 62 ?C, 30 s at 72 ?C; 5 min at 72 ?C 5; hold at 4 ?C. The number of cycles was adapted to the initial number of cells (24 or 25 cycles for conventional T cells, 27 to 29 for regulatory T cells) as we observed the formation of heteroduplexes in saturated reactions. PCR products were sequenced on a Roche Genome Sequencer FLX Titanium system after adapter ligation following standard procedures. 400 0 Technical Read Adapter 1 1 Technical Read Primer CCAATCTCTGACAGTCTGGGAA AACTGGTACACAGCAGGTTCTG 2 Application Read Other 454 GS FLX Titanium 2.3 (090928_1418) PRJDB2651 none provided SAMD00013529 G62-CA AMPLICON TRANSCRIPTOMIC RT-PCR RNA was extracted using Isogen protocol and cDNA synthesized using the SuperScript II kit (Invitrogen) with oligo-dT primers (Invitrogen) according to manufacturer?s protocol. cDNAs were then amplified using ExTaq polymerase kit (TAKARA). TRAV14 (CCAATCTCTGACAGTCTGGGAA) and TRAC (AACTGGTACACAGCAGGTTCTG) primers were used for TRAV14 repertoire; TRBV2 (CGAACAGTATCTAGGCCACAATGC) and TRBC (GCACACGAGGGTAGCCTTTTGTTT) primers for TRBV2 repertoire. PCR program was as follow: 4 min at 94 ?C; x cycles of 30 s at 94 ?C, 30 s at 62 ?C, 30 s at 72 ?C; 5 min at 72 ?C 5; hold at 4 ?C. The number of cycles was adapted to the initial number of cells (24 or 25 cycles for conventional T cells, 27 to 29 for regulatory T cells) as we observed the formation of heteroduplexes in saturated reactions. PCR products were sequenced on a Roche Genome Sequencer FLX Titanium system after adapter ligation following standard procedures. 400 0 Technical Read Adapter 1 1 Technical Read Primer CCAATCTCTGACAGTCTGGGAA AACTGGTACACAGCAGGTTCTG 2 Application Read Other 454 GS FLX Titanium 2.3 (090928_1418) PRJDB2651 none provided SAMD00013538 GSgt10002 AMPLICON TRANSCRIPTOMIC RT-PCR RNA was extracted using Isogen protocol and cDNA synthesized using the SuperScript II kit (Invitrogen) with oligo-dT primers (Invitrogen) according to manufacturer?s protocol. cDNAs were then amplified using ExTaq polymerase kit (TAKARA). TRAV14 (CCAATCTCTGACAGTCTGGGAA) and TRAC (AACTGGTACACAGCAGGTTCTG) primers were used for TRAV14 repertoire; TRBV2 (CGAACAGTATCTAGGCCACAATGC) and TRBC (GCACACGAGGGTAGCCTTTTGTTT) primers for TRBV2 repertoire. PCR program was as follow: 4 min at 94 ?C; x cycles of 30 s at 94 ?C, 30 s at 62 ?C, 30 s at 72 ?C; 5 min at 72 ?C 5; hold at 4 ?C. The number of cycles was adapted to the initial number of cells (24 or 25 cycles for conventional T cells, 27 to 29 for regulatory T cells) as we observed the formation of heteroduplexes in saturated reactions. PCR products were sequenced on a Roche Genome Sequencer FLX Titanium system after adapter ligation following standard procedures. 400 0 Technical Read Adapter 1 1 Technical Read Primer CGAACAGTATCTAGGCCACAATGC GCACACGAGGGTAGCCTTTTGTTT 2 Application Read Other 454 GS FLX Titanium 2.3 (090928_1418) PRJDB2651 none provided SAMD00013530 GSgt10007 AMPLICON TRANSCRIPTOMIC RT-PCR RNA was extracted using Isogen protocol and cDNA synthesized using the SuperScript II kit (Invitrogen) with oligo-dT primers (Invitrogen) according to manufacturer?s protocol. cDNAs were then amplified using ExTaq polymerase kit (TAKARA). TRAV14 (CCAATCTCTGACAGTCTGGGAA) and TRAC (AACTGGTACACAGCAGGTTCTG) primers were used for TRAV14 repertoire; TRBV2 (CGAACAGTATCTAGGCCACAATGC) and TRBC (GCACACGAGGGTAGCCTTTTGTTT) primers for TRBV2 repertoire. PCR program was as follow: 4 min at 94 ?C; x cycles of 30 s at 94 ?C, 30 s at 62 ?C, 30 s at 72 ?C; 5 min at 72 ?C 5; hold at 4 ?C. The number of cycles was adapted to the initial number of cells (24 or 25 cycles for conventional T cells, 27 to 29 for regulatory T cells) as we observed the formation of heteroduplexes in saturated reactions. PCR products were sequenced on a Roche Genome Sequencer FLX Titanium system after adapter ligation following standard procedures. 400 0 Technical Read Adapter 1 1 Technical Read Primer CCAATCTCTGACAGTCTGGGAA AACTGGTACACAGCAGGTTCTG 2 Application Read Other 454 GS FLX Titanium 2.3 (090928_1418) PRJDB2651 none provided SAMD00013519 GSgt10008 AMPLICON TRANSCRIPTOMIC RT-PCR RNA was extracted using Isogen protocol and cDNA synthesized using the SuperScript II kit (Invitrogen) with oligo-dT primers (Invitrogen) according to manufacturer?s protocol. cDNAs were then amplified using ExTaq polymerase kit (TAKARA). TRAV14 (CCAATCTCTGACAGTCTGGGAA) and TRAC (AACTGGTACACAGCAGGTTCTG) primers were used for TRAV14 repertoire; TRBV2 (CGAACAGTATCTAGGCCACAATGC) and TRBC (GCACACGAGGGTAGCCTTTTGTTT) primers for TRBV2 repertoire. PCR program was as follow: 4 min at 94 ?C; x cycles of 30 s at 94 ?C, 30 s at 62 ?C, 30 s at 72 ?C; 5 min at 72 ?C 5; hold at 4 ?C. The number of cycles was adapted to the initial number of cells (24 or 25 cycles for conventional T cells, 27 to 29 for regulatory T cells) as we observed the formation of heteroduplexes in saturated reactions. PCR products were sequenced on a Roche Genome Sequencer FLX Titanium system after adapter ligation following standard procedures. 400 0 Technical Read Adapter 1 1 Technical Read Primer CCAATCTCTGACAGTCTGGGAA AACTGGTACACAGCAGGTTCTG 2 Application Read Other 454 GS FLX Titanium 2.3 (090928_1418) PRJDB2651 none provided SAMD00013523 GSgt10009 AMPLICON TRANSCRIPTOMIC RT-PCR RNA was extracted using Isogen protocol and cDNA synthesized using the SuperScript II kit (Invitrogen) with oligo-dT primers (Invitrogen) according to manufacturer?s protocol. cDNAs were then amplified using ExTaq polymerase kit (TAKARA). TRAV14 (CCAATCTCTGACAGTCTGGGAA) and TRAC (AACTGGTACACAGCAGGTTCTG) primers were used for TRAV14 repertoire; TRBV2 (CGAACAGTATCTAGGCCACAATGC) and TRBC (GCACACGAGGGTAGCCTTTTGTTT) primers for TRBV2 repertoire. PCR program was as follow: 4 min at 94 ?C; x cycles of 30 s at 94 ?C, 30 s at 62 ?C, 30 s at 72 ?C; 5 min at 72 ?C 5; hold at 4 ?C. The number of cycles was adapted to the initial number of cells (24 or 25 cycles for conventional T cells, 27 to 29 for regulatory T cells) as we observed the formation of heteroduplexes in saturated reactions. PCR products were sequenced on a Roche Genome Sequencer FLX Titanium system after adapter ligation following standard procedures. 400 0 Technical Read Adapter 1 1 Technical Read Primer CCAATCTCTGACAGTCTGGGAA AACTGGTACACAGCAGGTTCTG 2 Application Read Other 454 GS FLX Titanium 2.3 (090928_1418) PRJDB2651 none provided SAMD00013524 GSgt10010 AMPLICON TRANSCRIPTOMIC RT-PCR RNA was extracted using Isogen protocol and cDNA synthesized using the SuperScript II kit (Invitrogen) with oligo-dT primers (Invitrogen) according to manufacturer?s protocol. cDNAs were then amplified using ExTaq polymerase kit (TAKARA). TRAV14 (CCAATCTCTGACAGTCTGGGAA) and TRAC (AACTGGTACACAGCAGGTTCTG) primers were used for TRAV14 repertoire; TRBV2 (CGAACAGTATCTAGGCCACAATGC) and TRBC (GCACACGAGGGTAGCCTTTTGTTT) primers for TRBV2 repertoire. PCR program was as follow: 4 min at 94 ?C; x cycles of 30 s at 94 ?C, 30 s at 62 ?C, 30 s at 72 ?C; 5 min at 72 ?C 5; hold at 4 ?C. The number of cycles was adapted to the initial number of cells (24 or 25 cycles for conventional T cells, 27 to 29 for regulatory T cells) as we observed the formation of heteroduplexes in saturated reactions. PCR products were sequenced on a Roche Genome Sequencer FLX Titanium system after adapter ligation following standard procedures. 400 0 Technical Read Adapter 1 1 Technical Read Primer CCAATCTCTGACAGTCTGGGAA AACTGGTACACAGCAGGTTCTG 2 Application Read Other 454 GS FLX Titanium 2.3 (090928_1418) PRJDB2651 none provided SAMD00013534 GSgt10011 AMPLICON TRANSCRIPTOMIC RT-PCR RNA was extracted using Isogen protocol and cDNA synthesized using the SuperScript II kit (Invitrogen) with oligo-dT primers (Invitrogen) according to manufacturer?s protocol. cDNAs were then amplified using ExTaq polymerase kit (TAKARA). TRAV14 (CCAATCTCTGACAGTCTGGGAA) and TRAC (AACTGGTACACAGCAGGTTCTG) primers were used for TRAV14 repertoire; TRBV2 (CGAACAGTATCTAGGCCACAATGC) and TRBC (GCACACGAGGGTAGCCTTTTGTTT) primers for TRBV2 repertoire. PCR program was as follow: 4 min at 94 ?C; x cycles of 30 s at 94 ?C, 30 s at 62 ?C, 30 s at 72 ?C; 5 min at 72 ?C 5; hold at 4 ?C. The number of cycles was adapted to the initial number of cells (24 or 25 cycles for conventional T cells, 27 to 29 for regulatory T cells) as we observed the formation of heteroduplexes in saturated reactions. PCR products were sequenced on a Roche Genome Sequencer FLX Titanium system after adapter ligation following standard procedures. 400 0 Technical Read Adapter 1 1 Technical Read Primer CCAATCTCTGACAGTCTGGGAA AACTGGTACACAGCAGGTTCTG 2 Application Read Other 454 GS FLX Titanium 2.3 (090928_1418) PRJDB2651 none provided SAMD00013533 GSgt10012 AMPLICON TRANSCRIPTOMIC RT-PCR RNA was extracted using Isogen protocol and cDNA synthesized using the SuperScript II kit (Invitrogen) with oligo-dT primers (Invitrogen) according to manufacturer?s protocol. cDNAs were then amplified using ExTaq polymerase kit (TAKARA). TRAV14 (CCAATCTCTGACAGTCTGGGAA) and TRAC (AACTGGTACACAGCAGGTTCTG) primers were used for TRAV14 repertoire; TRBV2 (CGAACAGTATCTAGGCCACAATGC) and TRBC (GCACACGAGGGTAGCCTTTTGTTT) primers for TRBV2 repertoire. PCR program was as follow: 4 min at 94 ?C; x cycles of 30 s at 94 ?C, 30 s at 62 ?C, 30 s at 72 ?C; 5 min at 72 ?C 5; hold at 4 ?C. The number of cycles was adapted to the initial number of cells (24 or 25 cycles for conventional T cells, 27 to 29 for regulatory T cells) as we observed the formation of heteroduplexes in saturated reactions. PCR products were sequenced on a Roche Genome Sequencer FLX Titanium system after adapter ligation following standard procedures. 400 0 Technical Read Primer 1 1 Technical Read Primer CCAATCTCTGACAGTCTGGGAA AACTGGTACACAGCAGGTTCTG 2 Application Read Other 454 GS FLX Titanium 2.3 (090928_1418) PRJDB2651 none provided SAMD00013522 GSgt10013 AMPLICON TRANSCRIPTOMIC RT-PCR RNA was extracted using Isogen protocol and cDNA synthesized using the SuperScript II kit (Invitrogen) with oligo-dT primers (Invitrogen) according to manufacturer?s protocol. cDNAs were then amplified using ExTaq polymerase kit (TAKARA). TRAV14 (CCAATCTCTGACAGTCTGGGAA) and TRAC (AACTGGTACACAGCAGGTTCTG) primers were used for TRAV14 repertoire; TRBV2 (CGAACAGTATCTAGGCCACAATGC) and TRBC (GCACACGAGGGTAGCCTTTTGTTT) primers for TRBV2 repertoire. PCR program was as follow: 4 min at 94 ?C; x cycles of 30 s at 94 ?C, 30 s at 62 ?C, 30 s at 72 ?C; 5 min at 72 ?C 5; hold at 4 ?C. The number of cycles was adapted to the initial number of cells (24 or 25 cycles for conventional T cells, 27 to 29 for regulatory T cells) as we observed the formation of heteroduplexes in saturated reactions. PCR products were sequenced on a Roche Genome Sequencer FLX Titanium system after adapter ligation following standard procedures. 400 0 Technical Read Adapter 1 1 Technical Read Primer CCAATCTCTGACAGTCTGGGAA AACTGGTACACAGCAGGTTCTG 2 Application Read Other 454 GS FLX Titanium 2.3 (090928_1418) PRJDB2651 none provided SAMD00013537 GSgt10014 AMPLICON TRANSCRIPTOMIC RT-PCR RNA was extracted using Isogen protocol and cDNA synthesized using the SuperScript II kit (Invitrogen) with oligo-dT primers (Invitrogen) according to manufacturer?s protocol. cDNAs were then amplified using ExTaq polymerase kit (TAKARA). TRAV14 (CCAATCTCTGACAGTCTGGGAA) and TRAC (AACTGGTACACAGCAGGTTCTG) primers were used for TRAV14 repertoire; TRBV2 (CGAACAGTATCTAGGCCACAATGC) and TRBC (GCACACGAGGGTAGCCTTTTGTTT) primers for TRBV2 repertoire. PCR program was as follow: 4 min at 94 ?C; x cycles of 30 s at 94 ?C, 30 s at 62 ?C, 30 s at 72 ?C; 5 min at 72 ?C 5; hold at 4 ?C. The number of cycles was adapted to the initial number of cells (24 or 25 cycles for conventional T cells, 27 to 29 for regulatory T cells) as we observed the formation of heteroduplexes in saturated reactions. PCR products were sequenced on a Roche Genome Sequencer FLX Titanium system after adapter ligation following standard procedures. 400 0 Technical Read Adapter 1 1 Technical Read Primer CCAATCTCTGACAGTCTGGGAA AACTGGTACACAGCAGGTTCTG 2 Application Read Other 454 GS FLX Titanium 2.3 (090928_1418) PRJDB2651 none provided SAMD00013535 GSgt10015 AMPLICON TRANSCRIPTOMIC RT-PCR RNA was extracted using Isogen protocol and cDNA synthesized using the SuperScript II kit (Invitrogen) with oligo-dT primers (Invitrogen) according to manufacturer?s protocol. cDNAs were then amplified using ExTaq polymerase kit (TAKARA). TRAV14 (CCAATCTCTGACAGTCTGGGAA) and TRAC (AACTGGTACACAGCAGGTTCTG) primers were used for TRAV14 repertoire; TRBV2 (CGAACAGTATCTAGGCCACAATGC) and TRBC (GCACACGAGGGTAGCCTTTTGTTT) primers for TRBV2 repertoire. PCR program was as follow: 4 min at 94 ?C; x cycles of 30 s at 94 ?C, 30 s at 62 ?C, 30 s at 72 ?C; 5 min at 72 ?C 5; hold at 4 ?C. The number of cycles was adapted to the initial number of cells (24 or 25 cycles for conventional T cells, 27 to 29 for regulatory T cells) as we observed the formation of heteroduplexes in saturated reactions. PCR products were sequenced on a Roche Genome Sequencer FLX Titanium system after adapter ligation following standard procedures. 400 0 Technical Read Adapter 1 1 Technical Read Primer CCAATCTCTGACAGTCTGGGAA AACTGGTACACAGCAGGTTCTG 2 Application Read Other 454 GS FLX Titanium 2.3 (090928_1418) PRJDB2651 none provided SAMD00013520 GSgt10016 AMPLICON TRANSCRIPTOMIC RT-PCR RNA was extracted using Isogen protocol and cDNA synthesized using the SuperScript II kit (Invitrogen) with oligo-dT primers (Invitrogen) according to manufacturer?s protocol. cDNAs were then amplified using ExTaq polymerase kit (TAKARA). TRAV14 (CCAATCTCTGACAGTCTGGGAA) and TRAC (AACTGGTACACAGCAGGTTCTG) primers were used for TRAV14 repertoire; TRBV2 (CGAACAGTATCTAGGCCACAATGC) and TRBC (GCACACGAGGGTAGCCTTTTGTTT) primers for TRBV2 repertoire. PCR program was as follow: 4 min at 94 ?C; x cycles of 30 s at 94 ?C, 30 s at 62 ?C, 30 s at 72 ?C; 5 min at 72 ?C 5; hold at 4 ?C. The number of cycles was adapted to the initial number of cells (24 or 25 cycles for conventional T cells, 27 to 29 for regulatory T cells) as we observed the formation of heteroduplexes in saturated reactions. PCR products were sequenced on a Roche Genome Sequencer FLX Titanium system after adapter ligation following standard procedures. 400 0 Technical Read Adapter 1 1 Technical Read Primer CCAATCTCTGACAGTCTGGGAA AACTGGTACACAGCAGGTTCTG 2 Application Read Other 454 GS FLX Titanium 2.3 (090928_1418) PRJDB2651 none provided SAMD00013531 GSgt10017 AMPLICON TRANSCRIPTOMIC RT-PCR RNA was extracted using Isogen protocol and cDNA synthesized using the SuperScript II kit (Invitrogen) with oligo-dT primers (Invitrogen) according to manufacturer?s protocol. cDNAs were then amplified using ExTaq polymerase kit (TAKARA). TRAV14 (CCAATCTCTGACAGTCTGGGAA) and TRAC (AACTGGTACACAGCAGGTTCTG) primers were used for TRAV14 repertoire; TRBV2 (CGAACAGTATCTAGGCCACAATGC) and TRBC (GCACACGAGGGTAGCCTTTTGTTT) primers for TRBV2 repertoire. PCR program was as follow: 4 min at 94 ?C; x cycles of 30 s at 94 ?C, 30 s at 62 ?C, 30 s at 72 ?C; 5 min at 72 ?C 5; hold at 4 ?C. The number of cycles was adapted to the initial number of cells (24 or 25 cycles for conventional T cells, 27 to 29 for regulatory T cells) as we observed the formation of heteroduplexes in saturated reactions. PCR products were sequenced on a Roche Genome Sequencer FLX Titanium system after adapter ligation following standard procedures. 400 0 Technical Read Adapter 1 1 Technical Read Primer CCAATCTCTGACAGTCTGGGAA AACTGGTACACAGCAGGTTCTG 2 Application Read Other 454 GS FLX Titanium 2.3 (090928_1418) PRJDB2651 none provided SAMD00013527 GSgt10018 AMPLICON TRANSCRIPTOMIC RT-PCR RNA was extracted using Isogen protocol and cDNA synthesized using the SuperScript II kit (Invitrogen) with oligo-dT primers (Invitrogen) according to manufacturer?s protocol. cDNAs were then amplified using ExTaq polymerase kit (TAKARA). TRAV14 (CCAATCTCTGACAGTCTGGGAA) and TRAC (AACTGGTACACAGCAGGTTCTG) primers were used for TRAV14 repertoire; TRBV2 (CGAACAGTATCTAGGCCACAATGC) and TRBC (GCACACGAGGGTAGCCTTTTGTTT) primers for TRBV2 repertoire. PCR program was as follow: 4 min at 94 ?C; x cycles of 30 s at 94 ?C, 30 s at 62 ?C, 30 s at 72 ?C; 5 min at 72 ?C 5; hold at 4 ?C. The number of cycles was adapted to the initial number of cells (24 or 25 cycles for conventional T cells, 27 to 29 for regulatory T cells) as we observed the formation of heteroduplexes in saturated reactions. PCR products were sequenced on a Roche Genome Sequencer FLX Titanium system after adapter ligation following standard procedures. 400 0 Technical Read Adapter 1 1 Technical Read Primer CCAATCTCTGACAGTCTGGGAA AACTGGTACACAGCAGGTTCTG 2 Application Read Other 454 GS FLX Titanium 2.3 (090928_1418) PRJDB2651 none provided SAMD00013540 GSgt10019 AMPLICON TRANSCRIPTOMIC RT-PCR RNA was extracted using Isogen protocol and cDNA synthesized using the SuperScript II kit (Invitrogen) with oligo-dT primers (Invitrogen) according to manufacturer?s protocol. cDNAs were then amplified using ExTaq polymerase kit (TAKARA). TRAV14 (CCAATCTCTGACAGTCTGGGAA) and TRAC (AACTGGTACACAGCAGGTTCTG) primers were used for TRAV14 repertoire; TRBV2 (CGAACAGTATCTAGGCCACAATGC) and TRBC (GCACACGAGGGTAGCCTTTTGTTT) primers for TRBV2 repertoire. PCR program was as follow: 4 min at 94 ?C; x cycles of 30 s at 94 ?C, 30 s at 62 ?C, 30 s at 72 ?C; 5 min at 72 ?C 5; hold at 4 ?C. The number of cycles was adapted to the initial number of cells (24 or 25 cycles for conventional T cells, 27 to 29 for regulatory T cells) as we observed the formation of heteroduplexes in saturated reactions. PCR products were sequenced on a Roche Genome Sequencer FLX Titanium system after adapter ligation following standard procedures. 400 0 Technical Read Adapter 1 1 Technical Read Primer CGAACAGTATCTAGGCCACAATGC GCACACGAGGGTAGCCTTTTGTTT 2 Application Read Other 454 GS FLX Titanium 2.3 (090928_1418) PRJDB2651 none provided SAMD00013526 GSgt10020 AMPLICON TRANSCRIPTOMIC RT-PCR RNA was extracted using Isogen protocol and cDNA synthesized using the SuperScript II kit (Invitrogen) with oligo-dT primers (Invitrogen) according to manufacturer?s protocol. cDNAs were then amplified using ExTaq polymerase kit (TAKARA). TRAV14 (CCAATCTCTGACAGTCTGGGAA) and TRAC (AACTGGTACACAGCAGGTTCTG) primers were used for TRAV14 repertoire; TRBV2 (CGAACAGTATCTAGGCCACAATGC) and TRBC (GCACACGAGGGTAGCCTTTTGTTT) primers for TRBV2 repertoire. PCR program was as follow: 4 min at 94 ?C; x cycles of 30 s at 94 ?C, 30 s at 62 ?C, 30 s at 72 ?C; 5 min at 72 ?C 5; hold at 4 ?C. The number of cycles was adapted to the initial number of cells (24 or 25 cycles for conventional T cells, 27 to 29 for regulatory T cells) as we observed the formation of heteroduplexes in saturated reactions. PCR products were sequenced on a Roche Genome Sequencer FLX Titanium system after adapter ligation following standard procedures. 400 0 Technical Read Adapter 1 1 Technical Read Primer CGAACAGTATCTAGGCCACAATGC GCACACGAGGGTAGCCTTTTGTTT 2 Application Read Other 454 GS FLX Titanium 2.3 (090928_1418) PRJDB2651 none provided SAMD00013528 GSgt10021 AMPLICON TRANSCRIPTOMIC RT-PCR RNA was extracted using Isogen protocol and cDNA synthesized using the SuperScript II kit (Invitrogen) with oligo-dT primers (Invitrogen) according to manufacturer?s protocol. cDNAs were then amplified using ExTaq polymerase kit (TAKARA). TRAV14 (CCAATCTCTGACAGTCTGGGAA) and TRAC (AACTGGTACACAGCAGGTTCTG) primers were used for TRAV14 repertoire; TRBV2 (CGAACAGTATCTAGGCCACAATGC) and TRBC (GCACACGAGGGTAGCCTTTTGTTT) primers for TRBV2 repertoire. PCR program was as follow: 4 min at 94 ?C; x cycles of 30 s at 94 ?C, 30 s at 62 ?C, 30 s at 72 ?C; 5 min at 72 ?C 5; hold at 4 ?C. The number of cycles was adapted to the initial number of cells (24 or 25 cycles for conventional T cells, 27 to 29 for regulatory T cells) as we observed the formation of heteroduplexes in saturated reactions. PCR products were sequenced on a Roche Genome Sequencer FLX Titanium system after adapter ligation following standard procedures. 400 0 Technical Read Adapter 1 1 Technical Read Primer CGAACAGTATCTAGGCCACAATGC GCACACGAGGGTAGCCTTTTGTTT 2 Application Read Adapter 454 GS FLX Titanium 2.3 (090928_1418) PRJDB2651 none provided SAMD00013532 GSgt10022 AMPLICON TRANSCRIPTOMIC RT-PCR RNA was extracted using Isogen protocol and cDNA synthesized using the SuperScript II kit (Invitrogen) with oligo-dT primers (Invitrogen) according to manufacturer?s protocol. cDNAs were then amplified using ExTaq polymerase kit (TAKARA). TRAV14 (CCAATCTCTGACAGTCTGGGAA) and TRAC (AACTGGTACACAGCAGGTTCTG) primers were used for TRAV14 repertoire; TRBV2 (CGAACAGTATCTAGGCCACAATGC) and TRBC (GCACACGAGGGTAGCCTTTTGTTT) primers for TRBV2 repertoire. PCR program was as follow: 4 min at 94 ?C; x cycles of 30 s at 94 ?C, 30 s at 62 ?C, 30 s at 72 ?C; 5 min at 72 ?C 5; hold at 4 ?C. The number of cycles was adapted to the initial number of cells (24 or 25 cycles for conventional T cells, 27 to 29 for regulatory T cells) as we observed the formation of heteroduplexes in saturated reactions. PCR products were sequenced on a Roche Genome Sequencer FLX Titanium system after adapter ligation following standard procedures. 400 0 Technical Read Adapter 1 1 Technical Read Primer CGAACAGTATCTAGGCCACAATGC GCACACGAGGGTAGCCTTTTGTTT 2 Application Read Other 454 GS FLX Titanium 2.3 (090928_1418)