PRJDB2628 none provided SAMD00013310 Pinctada fucata 454 shotgun WGS GENOMIC size fractionation none provided 200 0 Technical Read Adapter 1 1 Application Read Forward 5 454 GS FLX Titanium 454 Basecaller PRJDB2628 none provided SAMD00013310 Pinctada fucata 454 paired-end 10kb WGS GENOMIC size fractionation none provided 200 0 Technical Read Adapter 1 1 Application Read Forward 5 2 Technical Read Linker ATCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACGT 3 Application Read Forward 454 GS FLX Titanium 454 Basecaller PRJDB2628 none provided SAMD00013310 Pinctada fucata 454 paired-end 10kb WGS GENOMIC size fractionation none provided 200 0 Technical Read Adapter 1 1 Application Read Forward 5 2 Technical Read Linker ATCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACGT 3 Application Read Forward 454 GS FLX Titanium 454 Basecaller PRJDB2628 none provided SAMD00013310 Pincatada fucata illumina 3Kbp MatePair Library WGS GENOMIC size fractionation none provided 100 0 Application Read Forward 1 1 Application Read Reverse 51 Illumina Genome Analyzer IIx Basecall PRJDB2628 none provided SAMD00013310 Pincatada fucata illumina 10Kbp MatePair Library WGS GENOMIC size fractionation none provided 100 0 Application Read Forward 1 1 Application Read Reverse 51 Illumina Genome Analyzer IIx Basecall PRJDB2628 none provided SAMD00013310 Pincatada fucata illumina 10Kbp MatePair Library WGS GENOMIC size fractionation none provided 50 0 Application Read Forward 1 Illumina Genome Analyzer IIx Basecall PRJDB2628 none provided BioProject of this experiment was changed from PRJDB2629 to PRJDB2628. SAMD00013311 Pinctada fucata 454 shotgun RNA-Seq TRANSCRIPTOMIC size fractionation RNA was extracted from 3 hour after fertilization embryo. 200 0 Technical Read Adapter 1 1 Application Read Forward 5 454 GS FLX Titanium 454 Basecaller PRJDB2628 none provided BioProject of this experiment was changed from PRJDB2629 to PRJDB2628. SAMD00013311 Pinctada fucata 454 shotgun RNA-Seq TRANSCRIPTOMIC size fractionation RNA was extracted from 11 hour after fertilization trochophore larva. 200 0 Technical Read Adapter 1 1 Application Read Forward 5 454 GS FLX Titanium 454 Basecaller PRJDB2628 none provided BioProject of this experiment was changed from PRJDB2629 to PRJDB2628. SAMD00013311 Pinctada fucata 454 shotgun RNA-Seq TRANSCRIPTOMIC size fractionation RNA was extracted from 21 hour after fertilization D-shaped larva. 200 0 Technical Read Adapter 1 1 Application Read Forward 5 454 GS FLX Titanium 454 Basecaller PRJDB2628 none provided BioProject of this experiment was changed from PRJDB2629 to PRJDB2628. SAMD00013311 Pinctada fucata 454 shotgun RNA-Seq TRANSCRIPTOMIC size fractionation RNA samples were obtained from several stages of the embryo (0 to 24 hour after fertilization) and the RNA mixture was used for the library constraction. 200 0 Technical Read Adapter 1 1 Application Read Forward 5 454 GS FLX Titanium 454 Basecaller