PRJDB2304 none provided SAMD00009954 O60-JA AMPLICON TRANSCRIPTOMIC RACE The PCR products were amplified with the forward primer AATGATACGGCGACCACCGAACACTGCGTTTGCTGGCTTTGATG and the reverse primer CAAGCAGAAGACGGCATACGA. The 454 adapters were ligated to PCR products, therefore the sequencing is not directional and the 454 reads can start with either PCR primer sequence. When the reads are long enough, they may end with the reverse complement of either PCR primer sequence. 454 sequencers generate mismatches and indels, and therefore not all reads will match perfectly. 400 0 Technical Read Adapter 1 1 Application Read Other 5 454 GS FLX Titanium 1 NIL 2.0.00.20