PRJDB2243 The seawater was filtered on a 0.22-?m pore size membrane (express plus, Millipore) to collect the bacteria in the seawater. DNA was extracted from the microorganisms on the membrane by ISOIL for Beads Beating (Nippon Gene, Tokyo). PCR amplification of the 16S rRNA bacterial gene was performed using forward primer 27F (AGRGTTTGATCMTGGCTCAG; Vergin et al., 1998) and reverse primer 519R (GWATTACCGCGGCKGCTG; Amann et al., 1995). The forward primer included the fusion primer A (CGTATCGCCTCCCTCGCGCCA) in its 5? end, followed by a key sequence (TCAG) and sample specific 10 bp barcodes according to GS Junior Titanium emPCR Lib-A kit (Roche). Similarly, the reverse primer included the fusion primer B (CTATGCGCCTTGCCAGCCCGC) in its 5? end, followed by the key sequence and sample specific 10 bp barcodes. SAMD00009499 OTHER METAGENOMIC PCR 0 Technical Read Adapter 1 1 Application Read Forward 5 454 GS Junior 1 NIL