PRJDB683 SSR-enrichment genomic library of Nilaparvata lugens was created and sequenced. SAMD00000638 KU OTHER GENOMIC PCR The SSR-enrichment genomic libraries was prepared from Hadano-66 genomic DNA, which was extracted from approximately 50 insects, including nymphs, adults, males, and females. The fast isolation by amplified fragment length polymorphism (AFLP) of sequences containing repeats (FIASCO) procedure described by Zane et al.(2004) was used to isolate the library at the Plant Breeding Laboratory (Kyushu University). Briefly, genomic DNA was digested with MseI and ligated to MseI adaptors (5′–TACTCAGGACTCAT–3 /5–GACGATGAGTCCTGAG–3′). The mixture was amplified with an MseI adaptor primer (5′–GATGAGTCCTGAGTAAN–3′). The PCR product was then hybridized with 6 biotinylated probes: (CT)10, (CA)10, (CAC)7, (AAG)7, (TCC)7, and (GACA)5. The DNA molecules that were hybridized to biotinylated probes were captured using streptavidin magnetic paticles (Roche Applied Science, Mannheim, Germany) using a magnetic field. PCR was performed to recover enriched DNA fragments using the MseI adaptor primer. 0 Application Read Forward 1 454 GS FLX Titanium 1 NIL PRJDB683 SSR-enrichment genomic library of Nilaparvata lugens was created and sequenced. SAMD00000638 SREL OTHER GENOMIC PCR The SSR-enrichment genomic libraries was prepared from Hadano-66 genomic DNA, which was extracted from approximately 50 insects, including nymphs, adults, males, and females. The SREL library was produced by the Savannah River Ecology Laboratory (University of Georgia) following the method of Glenn and Schable.26 Briefly, 2ug of BPH genomic DNA was digested with RsaI. The digested DNA was ligated with double-stranded SuperSNX linkers (5′–GTTTAAGGCCTAGCTAGCAGAATC–3′/5′–GATTCTGCTAGCTAGGC CTTAAACAAAA–3′). The linker-ligated DNA was hybridized with seven biotinylated oligo probes: (AG)12, (TG)12, (AAC)6, (AAG)8, (AAT)12, (ACT)12, and (ATC)8. The DNA fragments with a microsatellite repeat were captured using Dynabeads (Dynal, Oslo, Norway) under a magnetic field. The amount of eluted DNA was increased by using the polymerase chain reaction (PCR) to recover enriched DNA fragments using the SuperSNX primer pairs. 0 Application Read Forward 1 454 GS FLX Titanium 1 NIL PRJDB683 SAMD00000637 ISB-C89N WGS GENOMIC RANDOM 101 0 Application Read Forward 1 Illumina HiSeq 2000 1 NIL Read length 101 bp