PRJDB12990 SAMD00442269 Case-1_blood RNA-Seq TRANSCRIPTOMIC Inverse rRNA Total RNA was quantified and qualified by Qubit RNA Assay (Thermofisher) and TapeStation RNA ScreenTape (Agilent). 400 ng of total RNA was treated with NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB) to eliminate rRNA molecules and used for cDNA library preparation. cDNA synthesis followed by transcriptome library preparation were conducted by MGIEasy RNA Directional Library Prep Kit V2.0 (MGI tech), where dUTP were incorporated in the process of the 2nd strand cDNA synthesis, instead of dTTP, that block PCR amplification against the 2nd strand templates, enabling strand-specific transcriptome profiling. A 12-cycle PCR amplification was performed to increase library yield. Resulting transcriptome sequencing libraries were quantified by Qubit DNA Assay (Thermofisher) and their fragment size distribution was confirmed by TapeStation D1000 ScreenTape (Agilent). The adapter sequences used in the library preparation are Forward: AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA Reverse: AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTG. The resulting double-stranded library fragments were pooled/multipulexed at an equimolar amount each and further processed into single-stranded circular DNA (sscDNA), which is the final form of MGI library. The sscDNA libraries were quantified by Qubit ssDNA Assay Kit (Thermofisher) and used for generating DNA nanoballs (DNBs) by rolling circle replication reaction. DNBs were then loaded into a flow cell for sequencing on DNBSEQ-G400 platform (MGI tech) with 150 bp pair-end (PE) configuration, according to the manufacturer?s instructions. 300 0 Application Read Forward 1 1 Application Read Reverse 151 DNBSEQ-G400 PRJDB12990 SAMD00442270 Case-2_blood RNA-Seq TRANSCRIPTOMIC Inverse rRNA Total RNA was quantified and qualified by Qubit RNA Assay (Thermofisher) and TapeStation RNA ScreenTape (Agilent). 400 ng of total RNA was treated with NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB) to eliminate rRNA molecules and used for cDNA library preparation. cDNA synthesis followed by transcriptome library preparation were conducted by MGIEasy RNA Directional Library Prep Kit V2.0 (MGI tech), where dUTP were incorporated in the process of the 2nd strand cDNA synthesis, instead of dTTP, that block PCR amplification against the 2nd strand templates, enabling strand-specific transcriptome profiling. A 12-cycle PCR amplification was performed to increase library yield. Resulting transcriptome sequencing libraries were quantified by Qubit DNA Assay (Thermofisher) and their fragment size distribution was confirmed by TapeStation D1000 ScreenTape (Agilent). The adapter sequences used in the library preparation are Forward: AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA Reverse: AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTG. The resulting double-stranded library fragments were pooled/multipulexed at an equimolar amount each and further processed into single-stranded circular DNA (sscDNA), which is the final form of MGI library. The sscDNA libraries were quantified by Qubit ssDNA Assay Kit (Thermofisher) and used for generating DNA nanoballs (DNBs) by rolling circle replication reaction. DNBs were then loaded into a flow cell for sequencing on DNBSEQ-G400 platform (MGI tech) with 150 bp pair-end (PE) configuration, according to the manufacturer?s instructions. 300 0 Application Read Forward 1 1 Application Read Reverse 151 DNBSEQ-G400 PRJDB12990 SAMD00442271 Case-3_blood RNA-Seq TRANSCRIPTOMIC Inverse rRNA Total RNA was quantified and qualified by Qubit RNA Assay (Thermofisher) and TapeStation RNA ScreenTape (Agilent). 400 ng of total RNA was treated with NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB) to eliminate rRNA molecules and used for cDNA library preparation. cDNA synthesis followed by transcriptome library preparation were conducted by MGIEasy RNA Directional Library Prep Kit V2.0 (MGI tech), where dUTP were incorporated in the process of the 2nd strand cDNA synthesis, instead of dTTP, that block PCR amplification against the 2nd strand templates, enabling strand-specific transcriptome profiling. A 12-cycle PCR amplification was performed to increase library yield. Resulting transcriptome sequencing libraries were quantified by Qubit DNA Assay (Thermofisher) and their fragment size distribution was confirmed by TapeStation D1000 ScreenTape (Agilent). The adapter sequences used in the library preparation are Forward: AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA Reverse: AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTG. The resulting double-stranded library fragments were pooled/multipulexed at an equimolar amount each and further processed into single-stranded circular DNA (sscDNA), which is the final form of MGI library. The sscDNA libraries were quantified by Qubit ssDNA Assay Kit (Thermofisher) and used for generating DNA nanoballs (DNBs) by rolling circle replication reaction. DNBs were then loaded into a flow cell for sequencing on DNBSEQ-G400 platform (MGI tech) with 150 bp pair-end (PE) configuration, according to the manufacturer?s instructions. 300 0 Application Read Forward 1 1 Application Read Reverse 151 DNBSEQ-G400 PRJDB12990 SAMD00442272 Case-4_blood RNA-Seq TRANSCRIPTOMIC Inverse rRNA Total RNA was quantified and qualified by Qubit RNA Assay (Thermofisher) and TapeStation RNA ScreenTape (Agilent). 400 ng of total RNA was treated with NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB) to eliminate rRNA molecules and used for cDNA library preparation. cDNA synthesis followed by transcriptome library preparation were conducted by MGIEasy RNA Directional Library Prep Kit V2.0 (MGI tech), where dUTP were incorporated in the process of the 2nd strand cDNA synthesis, instead of dTTP, that block PCR amplification against the 2nd strand templates, enabling strand-specific transcriptome profiling. A 12-cycle PCR amplification was performed to increase library yield. Resulting transcriptome sequencing libraries were quantified by Qubit DNA Assay (Thermofisher) and their fragment size distribution was confirmed by TapeStation D1000 ScreenTape (Agilent). The adapter sequences used in the library preparation are Forward: AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA Reverse: AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTG. The resulting double-stranded library fragments were pooled/multipulexed at an equimolar amount each and further processed into single-stranded circular DNA (sscDNA), which is the final form of MGI library. The sscDNA libraries were quantified by Qubit ssDNA Assay Kit (Thermofisher) and used for generating DNA nanoballs (DNBs) by rolling circle replication reaction. DNBs were then loaded into a flow cell for sequencing on DNBSEQ-G400 platform (MGI tech) with 150 bp pair-end (PE) configuration, according to the manufacturer?s instructions. 300 0 Application Read Forward 1 1 Application Read Reverse 151 DNBSEQ-G400 PRJDB12990 SAMD00442273 Control-1_blood RNA-Seq TRANSCRIPTOMIC Inverse rRNA Total RNA was quantified and qualified by Qubit RNA Assay (Thermofisher) and TapeStation RNA ScreenTape (Agilent). 400 ng of total RNA was treated with NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB) to eliminate rRNA molecules and used for cDNA library preparation. cDNA synthesis followed by transcriptome library preparation were conducted by MGIEasy RNA Directional Library Prep Kit V2.0 (MGI tech), where dUTP were incorporated in the process of the 2nd strand cDNA synthesis, instead of dTTP, that block PCR amplification against the 2nd strand templates, enabling strand-specific transcriptome profiling. A 12-cycle PCR amplification was performed to increase library yield. Resulting transcriptome sequencing libraries were quantified by Qubit DNA Assay (Thermofisher) and their fragment size distribution was confirmed by TapeStation D1000 ScreenTape (Agilent). The adapter sequences used in the library preparation are Forward: AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA Reverse: AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTG. The resulting double-stranded library fragments were pooled/multipulexed at an equimolar amount each and further processed into single-stranded circular DNA (sscDNA), which is the final form of MGI library. The sscDNA libraries were quantified by Qubit ssDNA Assay Kit (Thermofisher) and used for generating DNA nanoballs (DNBs) by rolling circle replication reaction. DNBs were then loaded into a flow cell for sequencing on DNBSEQ-G400 platform (MGI tech) with 150 bp pair-end (PE) configuration, according to the manufacturer?s instructions. 300 0 Application Read Forward 1 1 Application Read Reverse 151 DNBSEQ-G400 PRJDB12990 SAMD00442274 Control-2_blood RNA-Seq TRANSCRIPTOMIC Inverse rRNA Total RNA was quantified and qualified by Qubit RNA Assay (Thermofisher) and TapeStation RNA ScreenTape (Agilent). 400 ng of total RNA was treated with NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB) to eliminate rRNA molecules and used for cDNA library preparation. cDNA synthesis followed by transcriptome library preparation were conducted by MGIEasy RNA Directional Library Prep Kit V2.0 (MGI tech), where dUTP were incorporated in the process of the 2nd strand cDNA synthesis, instead of dTTP, that block PCR amplification against the 2nd strand templates, enabling strand-specific transcriptome profiling. A 12-cycle PCR amplification was performed to increase library yield. Resulting transcriptome sequencing libraries were quantified by Qubit DNA Assay (Thermofisher) and their fragment size distribution was confirmed by TapeStation D1000 ScreenTape (Agilent). The adapter sequences used in the library preparation are Forward: AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA Reverse: AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTG. The resulting double-stranded library fragments were pooled/multipulexed at an equimolar amount each and further processed into single-stranded circular DNA (sscDNA), which is the final form of MGI library. The sscDNA libraries were quantified by Qubit ssDNA Assay Kit (Thermofisher) and used for generating DNA nanoballs (DNBs) by rolling circle replication reaction. DNBs were then loaded into a flow cell for sequencing on DNBSEQ-G400 platform (MGI tech) with 150 bp pair-end (PE) configuration, according to the manufacturer?s instructions. 300 0 Application Read Forward 1 1 Application Read Reverse 151 DNBSEQ-G400