ERS2055063 SAMEA104437121 100272 uncultured eukaryote Flowing Water ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437121 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:02Z INSDC status public Submitter Id FW01 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) river environment (material) water environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8453 geographic location (longitude) 2.3643 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name FW01 target gene 18S target subfragment V4 ERS2055064 SAMEA104437122 100272 uncultured eukaryote Flowing Water ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437122 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:02Z INSDC status public Submitter Id FW02 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) river environment (material) water environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8456 geographic location (longitude) 2.3639 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name FW02 target gene 18S target subfragment V4 ERS2055065 SAMEA104437123 100272 uncultured eukaryote Flowing Water ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437123 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:02Z INSDC status public Submitter Id FW03 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) river environment (material) water environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8403 geographic location (longitude) 2.269 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name FW03 target gene 18S target subfragment V4 ERS2055066 SAMEA104437124 100272 uncultured eukaryote Flowing Water ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437124 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:02Z INSDC status public Submitter Id FW04 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) river environment (material) water environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8398 geographic location (longitude) 2.2682 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name FW04 target gene 18S target subfragment V4 ERS2055067 SAMEA104437125 100272 uncultured eukaryote Flowing Water ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437125 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:02Z INSDC status public Submitter Id FW05 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) river environment (material) water environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8845 geographic location (longitude) 2.3716 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name FW05 target gene 18S target subfragment V4 ERS2055068 SAMEA104437126 100272 uncultured eukaryote Flowing Water ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437126 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:02Z INSDC status public Submitter Id FW06 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) river environment (material) water environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8842 geographic location (longitude) 2.371 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name FW06 target gene 18S target subfragment V4 ERS2055069 SAMEA104437127 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437127 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:02Z INSDC status public Submitter Id GM01 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8595 geographic location (longitude) 2.3459 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM01 target gene 18S target subfragment V4 ERS2055070 SAMEA104437128 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437128 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:02Z INSDC status public Submitter Id GM02 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.863 geographic location (longitude) 2.3388 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM02 target gene 18S target subfragment V4 ERS2055071 SAMEA104437129 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437129 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:02Z INSDC status public Submitter Id GM03 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8679 geographic location (longitude) 2.33 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM03 target gene 18S target subfragment V4 ERS2055072 SAMEA104437130 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437130 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:02Z INSDC status public Submitter Id GM04 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8681 geographic location (longitude) 2.3353 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM04 target gene 18S target subfragment V4 ERS2055073 SAMEA104437131 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437131 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:02Z INSDC status public Submitter Id GM05 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.868 geographic location (longitude) 2.3524 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM05 target gene 18S target subfragment V4 ERS2055074 SAMEA104437132 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437132 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:02Z INSDC status public Submitter Id GM06 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8649 geographic location (longitude) 2.345 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM06 target gene 18S target subfragment V4 ERS2055075 SAMEA104437133 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437133 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:02Z INSDC status public Submitter Id GM07 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8611 geographic location (longitude) 2.358 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM07 target gene 18S target subfragment V4 ERS2055076 SAMEA104437134 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437134 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:02Z INSDC status public Submitter Id GM08 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8605 geographic location (longitude) 2.3645 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM08 target gene 18S target subfragment V4 ERS2055077 SAMEA104437135 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437135 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:02Z INSDC status public Submitter Id GM09 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.866 geographic location (longitude) 2.3623 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM09 target gene 18S target subfragment V4 ERS2055078 SAMEA104437136 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437136 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:02Z INSDC status public Submitter Id GM10 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8652 geographic location (longitude) 2.354 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM10 target gene 18S target subfragment V4 ERS2055079 SAMEA104437137 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437137 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:02Z INSDC status public Submitter Id GM11 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8555 geographic location (longitude) 2.3664 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM11 target gene 18S target subfragment V4 ERS2055080 SAMEA104437138 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437138 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:02Z INSDC status public Submitter Id GM12 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8547 geographic location (longitude) 2.3549 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM12 target gene 18S target subfragment V4 ERS2055081 SAMEA104437139 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437139 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:02Z INSDC status public Submitter Id GM13 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8412 geographic location (longitude) 2.3412 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM13 target gene 18S target subfragment V4 ERS2055082 SAMEA104437140 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437140 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:02Z INSDC status public Submitter Id GM14 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.843 geographic location (longitude) 2.3468 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM14 target gene 18S target subfragment V4 ERS2055083 SAMEA104437141 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437141 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:02Z INSDC status public Submitter Id GM15 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8491 geographic location (longitude) 2.3543 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM15 target gene 18S target subfragment V4 ERS2055084 SAMEA104437142 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437142 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:02Z INSDC status public Submitter Id GM16 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8564 geographic location (longitude) 2.3348 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM16 target gene 18S target subfragment V4 ERS2055085 SAMEA104437143 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437143 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:02Z INSDC status public Submitter Id GM17 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8522 geographic location (longitude) 2.3405 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM17 target gene 18S target subfragment V4 ERS2055086 SAMEA104437144 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437144 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:02Z INSDC status public Submitter Id GM18 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8422 geographic location (longitude) 2.334 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM18 target gene 18S target subfragment V4 ERS2055087 SAMEA104437145 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437145 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:02Z INSDC status public Submitter Id GM19 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8479 geographic location (longitude) 2.325 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM19 target gene 18S target subfragment V4 ERS2055088 SAMEA104437146 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437146 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:02Z INSDC status public Submitter Id GM20 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.857 geographic location (longitude) 2.319 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM20 target gene 18S target subfragment V4 ERS2055089 SAMEA104437147 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437147 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:02Z INSDC status public Submitter Id GM21 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8497 geographic location (longitude) 2.3162 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM21 target gene 18S target subfragment V4 ERS2055090 SAMEA104437148 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437148 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:02Z INSDC status public Submitter Id GM22 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8612 geographic location (longitude) 2.3094 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM22 target gene 18S target subfragment V4 ERS2055091 SAMEA104437149 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437149 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:02Z INSDC status public Submitter Id GM23 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8591 geographic location (longitude) 2.2979 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM23 target gene 18S target subfragment V4 ERS2055092 SAMEA104437150 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437150 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:02Z INSDC status public Submitter Id GM24 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8794 geographic location (longitude) 2.3182 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM24 target gene 18S target subfragment V4 ERS2055093 SAMEA104437151 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437151 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:02Z INSDC status public Submitter Id GM25 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8747 geographic location (longitude) 2.3095 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM25 target gene 18S target subfragment V4 ERS2055094 SAMEA104437152 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437152 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:02Z INSDC status public Submitter Id GM26 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8735 geographic location (longitude) 2.3035 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM26 target gene 18S target subfragment V4 ERS2055095 SAMEA104437153 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437153 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:02Z INSDC status public Submitter Id GM27 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8708 geographic location (longitude) 2.3191 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM27 target gene 18S target subfragment V4 ERS2055096 SAMEA104437154 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437154 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:02Z INSDC status public Submitter Id GM28 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8821 geographic location (longitude) 2.332 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM28 target gene 18S target subfragment V4 ERS2055097 SAMEA104437155 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437155 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM29 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8828 geographic location (longitude) 2.3298 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM29 target gene 18S target subfragment V4 ERS2055098 SAMEA104437156 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437156 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM30 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8749 geographic location (longitude) 2.3312 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM30 target gene 18S target subfragment V4 ERS2055099 SAMEA104437157 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437157 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM31 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8741 geographic location (longitude) 2.3412 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM31 target gene 18S target subfragment V4 ERS2055100 SAMEA104437158 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437158 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM32 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.871 geographic location (longitude) 2.3316 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM32 target gene 18S target subfragment V4 ERS2055101 SAMEA104437159 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437159 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM33 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8801 geographic location (longitude) 2.3648 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM33 target gene 18S target subfragment V4 ERS2055102 SAMEA104437160 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437160 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM34 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8761 geographic location (longitude) 2.3509 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM34 target gene 18S target subfragment V4 ERS2055103 SAMEA104437161 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437161 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM35 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8811 geographic location (longitude) 2.3584 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM35 target gene 18S target subfragment V4 ERS2055104 SAMEA104437162 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437162 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM36 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8725 geographic location (longitude) 2.361 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM36 target gene 18S target subfragment V4 ERS2055105 SAMEA104437163 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437163 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM37 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8708 geographic location (longitude) 2.3706 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM37 target gene 18S target subfragment V4 ERS2055106 SAMEA104437164 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437164 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM38 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8659 geographic location (longitude) 2.3771 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM38 target gene 18S target subfragment V4 ERS2055107 SAMEA104437165 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437165 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM39 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8583 geographic location (longitude) 2.3864 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM39 target gene 18S target subfragment V4 ERS2055108 SAMEA104437166 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437166 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM40 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.855 geographic location (longitude) 2.3777 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM40 target gene 18S target subfragment V4 ERS2055109 SAMEA104437167 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437167 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM41 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8601 geographic location (longitude) 2.373 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM41 target gene 18S target subfragment V4 ERS2055110 SAMEA104437168 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437168 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM42 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8385 geographic location (longitude) 2.4049 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM42 target gene 18S target subfragment V4 ERS2055111 SAMEA104437169 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437169 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM43 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8351 geographic location (longitude) 2.3928 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM43 target gene 18S target subfragment V4 ERS2055112 SAMEA104437170 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437170 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM44 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8459 geographic location (longitude) 2.3761 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM44 target gene 18S target subfragment V4 ERS2055113 SAMEA104437171 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437171 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM45 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8465 geographic location (longitude) 2.3923 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM45 target gene 18S target subfragment V4 ERS2055114 SAMEA104437172 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437172 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM46 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8451 geographic location (longitude) 2.4066 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM46 target gene 18S target subfragment V4 ERS2055115 SAMEA104437173 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437173 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM47 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.838 geographic location (longitude) 2.3724 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM47 target gene 18S target subfragment V4 ERS2055116 SAMEA104437174 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437174 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM48 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8262 geographic location (longitude) 2.3781 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM48 target gene 18S target subfragment V4 ERS2055117 SAMEA104437175 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437175 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM49 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8241 geographic location (longitude) 2.3702 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM49 target gene 18S target subfragment V4 ERS2055118 SAMEA104437176 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437176 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM50 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8245 geographic location (longitude) 2.3581 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM50 target gene 18S target subfragment V4 ERS2055119 SAMEA104437177 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437177 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM51 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8247 geographic location (longitude) 2.3465 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM51 target gene 18S target subfragment V4 ERS2055120 SAMEA104437178 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437178 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM52 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8348 geographic location (longitude) 2.3569 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM52 target gene 18S target subfragment V4 ERS2055121 SAMEA104437179 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437179 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM53 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8327 geographic location (longitude) 2.3193 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM53 target gene 18S target subfragment V4 ERS2055122 SAMEA104437180 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437180 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM54 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.837 geographic location (longitude) 2.3236 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM54 target gene 18S target subfragment V4 ERS2055123 SAMEA104437181 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437181 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM55 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8257 geographic location (longitude) 2.3344 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM55 target gene 18S target subfragment V4 ERS2055124 SAMEA104437182 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437182 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM56 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8339 geographic location (longitude) 2.3381 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM56 target gene 18S target subfragment V4 ERS2055125 SAMEA104437183 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437183 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM58 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8498 geographic location (longitude) 2.2883 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM58 target gene 18S target subfragment V4 ERS2055126 SAMEA104437184 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437184 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM59 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8381 geographic location (longitude) 2.2784 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM59 target gene 18S target subfragment V4 ERS2055127 SAMEA104437185 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437185 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM60 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8377 geographic location (longitude) 2.2927 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM60 target gene 18S target subfragment V4 ERS2055128 SAMEA104437186 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437186 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM61 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8362 geographic location (longitude) 2.3103 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM61 target gene 18S target subfragment V4 ERS2055129 SAMEA104437187 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437187 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM62 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.83 geographic location (longitude) 2.303 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM62 target gene 18S target subfragment V4 ERS2055130 SAMEA104437188 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437188 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM63 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8693 geographic location (longitude) 2.2851 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM63 target gene 18S target subfragment V4 ERS2055131 SAMEA104437189 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437189 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM64 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8613 geographic location (longitude) 2.2753 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM64 target gene 18S target subfragment V4 ERS2055132 SAMEA104437190 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437190 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM65 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8588 geographic location (longitude) 2.2749 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM65 target gene 18S target subfragment V4 ERS2055133 SAMEA104437191 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437191 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM66 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.855 geographic location (longitude) 2.2801 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM66 target gene 18S target subfragment V4 ERS2055134 SAMEA104437192 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437192 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM67 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8446 geographic location (longitude) 2.2613 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM67 target gene 18S target subfragment V4 ERS2055135 SAMEA104437193 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437193 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM68 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8437 geographic location (longitude) 2.2608 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM68 target gene 18S target subfragment V4 ERS2055136 SAMEA104437194 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437194 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM69 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8875 geographic location (longitude) 2.3204 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM69 target gene 18S target subfragment V4 ERS2055137 SAMEA104437195 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437195 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:03Z INSDC status public Submitter Id GM70 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8842 geographic location (longitude) 2.3234 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM70 target gene 18S target subfragment V4 ERS2055138 SAMEA104437196 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437196 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:04Z INSDC status public Submitter Id GM71 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8811 geographic location (longitude) 2.2898 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM71 target gene 18S target subfragment V4 ERS2055139 SAMEA104437197 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437197 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:04Z INSDC status public Submitter Id GM72 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8829 geographic location (longitude) 2.2962 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM72 target gene 18S target subfragment V4 ERS2055140 SAMEA104437198 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437198 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:04Z INSDC status public Submitter Id GM73 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8781 geographic location (longitude) 2.2882 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM73 target gene 18S target subfragment V4 ERS2055141 SAMEA104437199 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437199 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:04Z INSDC status public Submitter Id GM74 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8853 geographic location (longitude) 2.3404 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM74 target gene 18S target subfragment V4 ERS2055142 SAMEA104437200 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437200 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:04Z INSDC status public Submitter Id GM75 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8912 geographic location (longitude) 2.3309 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM75 target gene 18S target subfragment V4 ERS2055143 SAMEA104437201 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437201 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:04Z INSDC status public Submitter Id GM76 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8971 geographic location (longitude) 2.3422 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM76 target gene 18S target subfragment V4 ERS2055144 SAMEA104437202 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437202 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:04Z INSDC status public Submitter Id GM77 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8953 geographic location (longitude) 2.3609 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM77 target gene 18S target subfragment V4 ERS2055145 SAMEA104437203 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437203 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:04Z INSDC status public Submitter Id GM78 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8889 geographic location (longitude) 2.3581 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM78 target gene 18S target subfragment V4 ERS2055146 SAMEA104437204 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437204 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:04Z INSDC status public Submitter Id GM79 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8768 geographic location (longitude) 2.3742 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM79 target gene 18S target subfragment V4 ERS2055147 SAMEA104437205 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437205 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:04Z INSDC status public Submitter Id GM80 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8785 geographic location (longitude) 2.3958 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM80 target gene 18S target subfragment V4 ERS2055148 SAMEA104437206 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437206 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:04Z INSDC status public Submitter Id GM81 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.894 geographic location (longitude) 2.3736 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM81 target gene 18S target subfragment V4 ERS2055149 SAMEA104437207 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437207 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:04Z INSDC status public Submitter Id GM82 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8959 geographic location (longitude) 2.381 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM82 target gene 18S target subfragment V4 ERS2055150 SAMEA104437208 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437208 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:04Z INSDC status public Submitter Id GM83 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8848 geographic location (longitude) 2.3923 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM83 target gene 18S target subfragment V4 ERS2055151 SAMEA104437209 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437209 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:04Z INSDC status public Submitter Id GM84 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8812 geographic location (longitude) 2.3804 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM84 target gene 18S target subfragment V4 ERS2055152 SAMEA104437210 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437210 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:04Z INSDC status public Submitter Id GM85 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8727 geographic location (longitude) 2.3896 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM85 target gene 18S target subfragment V4 ERS2055153 SAMEA104437211 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437211 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:04Z INSDC status public Submitter Id GM86 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.868 geographic location (longitude) 2.4072 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM86 target gene 18S target subfragment V4 ERS2055154 SAMEA104437212 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437212 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:04Z INSDC status public Submitter Id GM87 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8643 geographic location (longitude) 2.3914 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM87 target gene 18S target subfragment V4 ERS2055155 SAMEA104437213 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437213 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:04Z INSDC status public Submitter Id GM88 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8504 geographic location (longitude) 2.4062 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM88 target gene 18S target subfragment V4 ERS2055156 SAMEA104437214 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437214 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:04Z INSDC status public Submitter Id GM89 collection date 2015-07 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8815 geographic location (longitude) 2.3397 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM89 target gene 18S target subfragment V4 ERS2055157 SAMEA104437215 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437215 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:04Z INSDC status public Submitter Id GM90 collection date 2015-07 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8821 geographic location (longitude) 2.342 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM90 target gene 18S target subfragment V4 ERS2055158 SAMEA104437216 100272 uncultured eukaryote Gutter Mats ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437216 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:04Z INSDC status public Submitter Id GM91 collection date 2015-07 common name uncultured eukaryote environment (biome) urban environment (feature) microbial mat environment (material) biofilm environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.883 geographic location (longitude) 2.3468 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name GM91 target gene 18S target subfragment V4 ERS2055159 SAMEA104437217 100272 uncultured eukaryote Raw Water ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437217 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:04Z INSDC status public Submitter Id RW01 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) river environment (material) water environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8571 geographic location (longitude) 2.3041 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name RW01 target gene 18S target subfragment V4 ERS2055160 SAMEA104437218 100272 uncultured eukaryote Raw Water ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437218 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:04Z INSDC status public Submitter Id RW02 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) river environment (material) water environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8815 geographic location (longitude) 2.3422 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name RW02 target gene 18S target subfragment V4 ERS2055161 SAMEA104437219 100272 uncultured eukaryote Raw Water ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437219 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:04Z INSDC status public Submitter Id RW03 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) river environment (material) water environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8447 geographic location (longitude) 2.406 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name RW03 target gene 18S target subfragment V4 ERS2055162 SAMEA104437220 100272 uncultured eukaryote Raw Water ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437220 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:04Z INSDC status public Submitter Id RW04 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) river environment (material) water environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8312 geographic location (longitude) 2.3691 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name RW04 target gene 18S target subfragment V4 ERS2055163 SAMEA104437221 100272 uncultured eukaryote Raw Water ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437221 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:04Z INSDC status public Submitter Id RW05 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) river environment (material) water environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8573 geographic location (longitude) 2.2859 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name RW05 target gene 18S target subfragment V4 ERS2055164 SAMEA104437222 100272 uncultured eukaryote Raw Water ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437222 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:04Z INSDC status public Submitter Id RW06 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) river environment (material) water environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8769 geographic location (longitude) 2.3954 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name RW06 target gene 18S target subfragment V4 ERS2055165 SAMEA104437223 100272 uncultured eukaryote Raw Water ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437223 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:04Z INSDC status public Submitter Id RW07 collection date 2015-06 common name uncultured eukaryote environment (biome) urban environment (feature) river environment (material) water environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8658 geographic location (longitude) 2.3919 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name RW07 target gene 18S target subfragment V4 ERS2055166 SAMEA104437224 100272 uncultured eukaryote Raw Water ENA first public 2018-01-08 ENA last update 2017-12-18 External Id SAMEA104437224 INSDC center alias Max Planck Institute for Terrestrial Microbiology INSDC center name Max Planck Institute for Terrestrial Microbiology INSDC first public 2018-01-08T17:04:38Z INSDC last update 2017-12-18T13:44:04Z INSDC status public Submitter Id RW08 collection date 2015-07 common name uncultured eukaryote environment (biome) urban environment (feature) river environment (material) water environmental sample Yes geographic location (country and/or sea) France geographic location (latitude) 48.8845 geographic location (longitude) 2.3471 pcr primers D512for (ATTCCAGCTCCAATAGCG) and D978rev (GACTACGATGGTATCTAATC) sample name RW08 target gene 18S target subfragment V4