ERS12232366 SAMEA110133546 1561972 seawater metagenome ENA-FIRST-PUBLIC 2022-06-16 ENA-LAST-UPDATE 2022-06-16 External Id SAMEA110133546 INSDC center alias IFREMER_ODE_DYNECO_PELAGOS INSDC center name IFREMER_ODE_DYNECO_PELAGOS INSDC first public 2022-06-16T08:39:20Z INSDC last update 2022-06-16T08:39:20Z INSDC status public LIBRARY_CONSTRUCTION_PROTOCOL Illumina mRNA TruSeq Stranded Kit Submitter Id sam_mascoet_1_2019 adapters GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i]ATCTCGTATGCCGTCTTCTGCTTG/AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT broker name Bioinformatics Core Facility of Ifremer (French Research Institute for Exploitation of the Sea) collection_date 2019-03-01 common name seawater metagenome environment (biome) coastal environment environment (feature) littoral zone environment (material) water environmental package none environmental_sample Yes geographic location (country and/or sea) France geographic location (elevation) not applicable geographic location (latitude) 48.25706037 geographic location (longitude) -4.56067095 geographic location (region and locality) Dinan Bay investigation type metatranscriptome isolation_source sea water (5liter) multiplex identifiers ATCACG pcr primers Illumina PCR Primer Cocktail project name Phytoplankton_communities_metaT_2021 sample name sam_mascoet_1_2019 sample_description water sample filtered on 10micrometers polycarbonate filter sample_name mascoet_1_2019 sequencing method Sequencing by synthesis (Illumina) target gene not applicable target subfragment not applicable ERS12232367 SAMEA110133547 1561972 seawater metagenome ENA-FIRST-PUBLIC 2022-06-16 ENA-LAST-UPDATE 2022-06-16 External Id SAMEA110133547 INSDC center alias IFREMER_ODE_DYNECO_PELAGOS INSDC center name IFREMER_ODE_DYNECO_PELAGOS INSDC first public 2022-06-16T08:39:20Z INSDC last update 2022-06-16T08:39:20Z INSDC status public LIBRARY_CONSTRUCTION_PROTOCOL Illumina mRNA TruSeq Stranded Kit Submitter Id sam_mascoet 4_2019 adapters GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i]ATCTCGTATGCCGTCTTCTGCTTG/AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT broker name Bioinformatics Core Facility of Ifremer (French Research Institute for Exploitation of the Sea) collection_date 2019-03-01 common name seawater metagenome environment (biome) coastal environment environment (feature) littoral zone environment (material) water environmental package none environmental_sample Yes geographic location (country and/or sea) France geographic location (elevation) not applicable geographic location (latitude) 48.3600557 geographic location (longitude) -4.5529852 geographic location (region and locality) Saint_Anne Bay investigation type metatranscriptome isolation_source sea water (5liter) multiplex identifiers TGACCA pcr primers Illumina PCR Primer Cocktail project name Phytoplankton_communities_metaT_2021 sample name sam_mascoet 4_2019 sample_description water sample filtered on 10micrometers polycarbonate filter sample_name mascoet 4_2019 sequencing method Sequencing by synthesis (Illumina) target gene not applicable target subfragment not applicable ERS12232368 SAMEA110133548 1561972 seawater metagenome ENA-FIRST-PUBLIC 2022-06-16 ENA-LAST-UPDATE 2022-06-16 External Id SAMEA110133548 INSDC center alias IFREMER_ODE_DYNECO_PELAGOS INSDC center name IFREMER_ODE_DYNECO_PELAGOS INSDC first public 2022-06-16T08:39:20Z INSDC last update 2022-06-16T08:39:20Z INSDC status public LIBRARY_CONSTRUCTION_PROTOCOL Illumina mRNA TruSeq Stranded Kit Submitter Id sam_mascoet 13 bis_2019 adapters GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i]ATCTCGTATGCCGTCTTCTGCTTG/AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT broker name Bioinformatics Core Facility of Ifremer (French Research Institute for Exploitation of the Sea) collection_date 2019-03-11 common name seawater metagenome environment (biome) coastal environment environment (feature) littoral zone environment (material) water environmental package none environmental_sample Yes geographic location (country and/or sea) France geographic location (elevation) not applicable geographic location (latitude) 48.3600557 geographic location (longitude) -4.5529852 geographic location (region and locality) Saint_Anne Bay investigation type metatranscriptome isolation_source sea water (5liter) multiplex identifiers ACAGTG pcr primers Illumina PCR Primer Cocktail project name Phytoplankton_communities_metaT_2021 sample name sam_mascoet 13 bis_2019 sample_description water sample filtered on 10micrometers polycarbonate filter sample_name mascoet 13 bis_2019 sequencing method Sequencing by synthesis (Illumina) target gene not applicable target subfragment not applicable ERS12232369 SAMEA110133549 1561972 seawater metagenome ENA-FIRST-PUBLIC 2022-06-16 ENA-LAST-UPDATE 2022-06-16 External Id SAMEA110133549 INSDC center alias IFREMER_ODE_DYNECO_PELAGOS INSDC center name IFREMER_ODE_DYNECO_PELAGOS INSDC first public 2022-06-16T08:39:20Z INSDC last update 2022-06-16T08:39:20Z INSDC status public LIBRARY_CONSTRUCTION_PROTOCOL Illumina mRNA TruSeq Stranded Kit Submitter Id sam_mascoet 14_2019 adapters GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i]ATCTCGTATGCCGTCTTCTGCTTG/AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT broker name Bioinformatics Core Facility of Ifremer (French Research Institute for Exploitation of the Sea) collection_date 2019-03-15 common name seawater metagenome environment (biome) coastal environment environment (feature) littoral zone environment (material) water environmental package none environmental_sample Yes geographic location (country and/or sea) France geographic location (elevation) not applicable geographic location (latitude) 48.3600557 geographic location (longitude) -4.5529852 geographic location (region and locality) Saint_Anne Bay investigation type metatranscriptome isolation_source sea water (5liter) multiplex identifiers GCCAAT pcr primers Illumina PCR Primer Cocktail project name Phytoplankton_communities_metaT_2021 sample name sam_mascoet 14_2019 sample_description water sample filtered on 10micrometers polycarbonate filter sample_name mascoet 14_2019 sequencing method Sequencing by synthesis (Illumina) target gene not applicable target subfragment not applicable ERS12232370 SAMEA110133550 1561972 seawater metagenome ENA-FIRST-PUBLIC 2022-06-16 ENA-LAST-UPDATE 2022-06-16 External Id SAMEA110133550 INSDC center alias IFREMER_ODE_DYNECO_PELAGOS INSDC center name IFREMER_ODE_DYNECO_PELAGOS INSDC first public 2022-06-16T08:39:20Z INSDC last update 2022-06-16T08:39:20Z INSDC status public LIBRARY_CONSTRUCTION_PROTOCOL Illumina mRNA TruSeq Stranded Kit Submitter Id sam_mascoet 15_2019 adapters GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i]ATCTCGTATGCCGTCTTCTGCTTG/AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT broker name Bioinformatics Core Facility of Ifremer (French Research Institute for Exploitation of the Sea) collection_date 2019-03-19 common name seawater metagenome environment (biome) coastal environment environment (feature) littoral zone environment (material) water environmental package none environmental_sample Yes geographic location (country and/or sea) France geographic location (elevation) not applicable geographic location (latitude) 48.3600557 geographic location (longitude) -4.5529852 geographic location (region and locality) Saint_Anne Bay investigation type metatranscriptome isolation_source sea water (5liter) multiplex identifiers CAGATC pcr primers Illumina PCR Primer Cocktail project name Phytoplankton_communities_metaT_2021 sample name sam_mascoet 15_2019 sample_description water sample filtered on 10micrometers polycarbonate filter sample_name mascoet 15_2019 sequencing method Sequencing by synthesis (Illumina) target gene not applicable target subfragment not applicable ERS12232371 SAMEA110133551 1561972 seawater metagenome ENA-FIRST-PUBLIC 2022-06-16 ENA-LAST-UPDATE 2022-06-16 External Id SAMEA110133551 INSDC center alias IFREMER_ODE_DYNECO_PELAGOS INSDC center name IFREMER_ODE_DYNECO_PELAGOS INSDC first public 2022-06-16T08:39:20Z INSDC last update 2022-06-16T08:39:20Z INSDC status public LIBRARY_CONSTRUCTION_PROTOCOL Illumina mRNA TruSeq Stranded Kit Submitter Id sam_mascoet 16_2019 adapters GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i]ATCTCGTATGCCGTCTTCTGCTTG/AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT broker name Bioinformatics Core Facility of Ifremer (French Research Institute for Exploitation of the Sea) collection_date 2019-03-22 common name seawater metagenome environment (biome) coastal environment environment (feature) littoral zone environment (material) water environmental package none environmental_sample Yes geographic location (country and/or sea) France geographic location (elevation) not applicable geographic location (latitude) 48.3600557 geographic location (longitude) -4.5529852 geographic location (region and locality) Saint_Anne Bay investigation type metatranscriptome isolation_source sea water (5liter) multiplex identifiers ACTTGA pcr primers Illumina PCR Primer Cocktail project name Phytoplankton_communities_metaT_2021 sample name sam_mascoet 16_2019 sample_description water sample filtered on 10micrometers polycarbonate filter sample_name mascoet 16_2019 sequencing method Sequencing by synthesis (Illumina) target gene not applicable target subfragment not applicable ERS12232372 SAMEA110133552 1561972 seawater metagenome ENA-FIRST-PUBLIC 2022-06-16 ENA-LAST-UPDATE 2022-06-16 External Id SAMEA110133552 INSDC center alias IFREMER_ODE_DYNECO_PELAGOS INSDC center name IFREMER_ODE_DYNECO_PELAGOS INSDC first public 2022-06-16T08:39:20Z INSDC last update 2022-06-16T08:39:20Z INSDC status public LIBRARY_CONSTRUCTION_PROTOCOL Illumina mRNA TruSeq Stranded Kit Submitter Id sam_mascoet 18_2019 adapters GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i]ATCTCGTATGCCGTCTTCTGCTTG/AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT broker name Bioinformatics Core Facility of Ifremer (French Research Institute for Exploitation of the Sea) collection_date 2019-03-11 common name seawater metagenome environment (biome) coastal environment environment (feature) littoral zone environment (material) water environmental package none environmental_sample Yes geographic location (country and/or sea) France geographic location (elevation) not applicable geographic location (latitude) 48.21019336 geographic location (longitude) -4.37214161 geographic location (region and locality) Telgruc Beach investigation type metatranscriptome isolation_source sea water (5liter) multiplex identifiers GATCAG pcr primers Illumina PCR Primer Cocktail project name Phytoplankton_communities_metaT_2021 sample name sam_mascoet 18_2019 sample_description water sample filtered on 10micrometers polycarbonate filter sample_name mascoet 18_2019 sequencing method Sequencing by synthesis (Illumina) target gene not applicable target subfragment not applicable ERS12232373 SAMEA110133553 1561972 seawater metagenome ENA-FIRST-PUBLIC 2022-06-16 ENA-LAST-UPDATE 2022-06-16 External Id SAMEA110133553 INSDC center alias IFREMER_ODE_DYNECO_PELAGOS INSDC center name IFREMER_ODE_DYNECO_PELAGOS INSDC first public 2022-06-16T08:39:20Z INSDC last update 2022-06-16T08:39:20Z INSDC status public LIBRARY_CONSTRUCTION_PROTOCOL Illumina mRNA TruSeq Stranded Kit Submitter Id sam_mascoet 19_2019 adapters GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i]ATCTCGTATGCCGTCTTCTGCTTG/AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT broker name Bioinformatics Core Facility of Ifremer (French Research Institute for Exploitation of the Sea) collection_date 2019-03-11 common name seawater metagenome environment (biome) coastal environment environment (feature) littoral zone environment (material) water environmental package none environmental_sample Yes geographic location (country and/or sea) France geographic location (elevation) not applicable geographic location (latitude) 48.2930042 geographic location (longitude) -4.4581772 geographic location (region and locality) Lanveoc Pier investigation type metatranscriptome isolation_source sea water (5liter) multiplex identifiers TAGCTT pcr primers Illumina PCR Primer Cocktail project name Phytoplankton_communities_metaT_2021 sample name sam_mascoet 19_2019 sample_description water sample filtered on 10micrometers polycarbonate filter sample_name mascoet 19_2019 sequencing method Sequencing by synthesis (Illumina) target gene not applicable target subfragment not applicable ERS12232374 SAMEA110133554 1561972 seawater metagenome ENA-FIRST-PUBLIC 2022-06-16 ENA-LAST-UPDATE 2022-06-16 External Id SAMEA110133554 INSDC center alias IFREMER_ODE_DYNECO_PELAGOS INSDC center name IFREMER_ODE_DYNECO_PELAGOS INSDC first public 2022-06-16T08:39:20Z INSDC last update 2022-06-16T08:39:20Z INSDC status public LIBRARY_CONSTRUCTION_PROTOCOL Illumina mRNA TruSeq Stranded Kit Submitter Id sam_mascoet 21_2019 adapters GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i]ATCTCGTATGCCGTCTTCTGCTTG/AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT broker name Bioinformatics Core Facility of Ifremer (French Research Institute for Exploitation of the Sea) collection_date 2019-03-15 common name seawater metagenome environment (biome) coastal environment environment (feature) littoral zone environment (material) water environmental package none environmental_sample Yes geographic location (country and/or sea) France geographic location (elevation) not applicable geographic location (latitude) 48.2930042 geographic location (longitude) -4.4581772 geographic location (region and locality) Lanveoc Pier investigation type metatranscriptome isolation_source sea water (5liter) multiplex identifiers CTTGTA pcr primers Illumina PCR Primer Cocktail project name Phytoplankton_communities_metaT_2021 sample name sam_mascoet 21_2019 sample_description water sample filtered on 10micrometers polycarbonate filter sample_name mascoet 21_2019 sequencing method Sequencing by synthesis (Illumina) target gene not applicable target subfragment not applicable ERS12232375 SAMEA110133555 1561972 seawater metagenome ENA-FIRST-PUBLIC 2022-06-16 ENA-LAST-UPDATE 2022-06-16 External Id SAMEA110133555 INSDC center alias IFREMER_ODE_DYNECO_PELAGOS INSDC center name IFREMER_ODE_DYNECO_PELAGOS INSDC first public 2022-06-16T08:39:20Z INSDC last update 2022-06-16T08:39:20Z INSDC status public LIBRARY_CONSTRUCTION_PROTOCOL Illumina mRNA TruSeq Stranded Kit Submitter Id sam_mascoet 22_2019 adapters GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i]ATCTCGTATGCCGTCTTCTGCTTG/AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT broker name Bioinformatics Core Facility of Ifremer (French Research Institute for Exploitation of the Sea) collection_date 2019-03-15 common name seawater metagenome environment (biome) coastal environment environment (feature) littoral zone environment (material) water environmental package none environmental_sample Yes geographic location (country and/or sea) France geographic location (elevation) not applicable geographic location (latitude) 48.21019336 geographic location (longitude) -4.37214161 geographic location (region and locality) Telgruc Beach investigation type metatranscriptome isolation_source sea water (5liter) multiplex identifiers AGTCAA pcr primers Illumina PCR Primer Cocktail project name Phytoplankton_communities_metaT_2021 sample name sam_mascoet 22_2019 sample_description water sample filtered on 10micrometers polycarbonate filter sample_name mascoet 22_2019 sequencing method Sequencing by synthesis (Illumina) target gene not applicable target subfragment not applicable ERS12232376 SAMEA110133556 1561972 seawater metagenome ENA-FIRST-PUBLIC 2022-06-16 ENA-LAST-UPDATE 2022-06-16 External Id SAMEA110133556 INSDC center alias IFREMER_ODE_DYNECO_PELAGOS INSDC center name IFREMER_ODE_DYNECO_PELAGOS INSDC first public 2022-06-16T08:39:20Z INSDC last update 2022-06-16T08:39:20Z INSDC status public LIBRARY_CONSTRUCTION_PROTOCOL Illumina mRNA TruSeq Stranded Kit Submitter Id sam_mascoet 23_2019 adapters GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i]ATCTCGTATGCCGTCTTCTGCTTG/AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT broker name Bioinformatics Core Facility of Ifremer (French Research Institute for Exploitation of the Sea) collection_date 2019-03-19 common name seawater metagenome environment (biome) coastal environment environment (feature) littoral zone environment (material) water environmental package none environmental_sample Yes geographic location (country and/or sea) France geographic location (elevation) not applicable geographic location (latitude) 48.21019336 geographic location (longitude) -4.37214161 geographic location (region and locality) Telgruc Beach investigation type metatranscriptome isolation_source sea water (5liter) multiplex identifiers AGTTCC pcr primers Illumina PCR Primer Cocktail project name Phytoplankton_communities_metaT_2021 sample name sam_mascoet 23_2019 sample_description water sample filtered on 10micrometers polycarbonate filter sample_name mascoet 23_2019 sequencing method Sequencing by synthesis (Illumina) target gene not applicable target subfragment not applicable ERS12232377 SAMEA110133557 1561972 seawater metagenome ENA-FIRST-PUBLIC 2022-06-16 ENA-LAST-UPDATE 2022-06-16 External Id SAMEA110133557 INSDC center alias IFREMER_ODE_DYNECO_PELAGOS INSDC center name IFREMER_ODE_DYNECO_PELAGOS INSDC first public 2022-06-16T08:39:20Z INSDC last update 2022-06-16T08:39:20Z INSDC status public LIBRARY_CONSTRUCTION_PROTOCOL Illumina mRNA TruSeq Stranded Kit Submitter Id sam_mascoet 24_2019 adapters GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i]ATCTCGTATGCCGTCTTCTGCTTG/AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT broker name Bioinformatics Core Facility of Ifremer (French Research Institute for Exploitation of the Sea) collection_date 2019-03-19 common name seawater metagenome environment (biome) coastal environment environment (feature) littoral zone environment (material) water environmental package none environmental_sample Yes geographic location (country and/or sea) France geographic location (elevation) not applicable geographic location (latitude) 48.2930042 geographic location (longitude) -4.4581772 geographic location (region and locality) Lanveoc Pier investigation type metatranscriptome isolation_source sea water (5liter) multiplex identifiers ATGTCA pcr primers Illumina PCR Primer Cocktail project name Phytoplankton_communities_metaT_2021 sample name sam_mascoet 24_2019 sample_description water sample filtered on 10micrometers polycarbonate filter sample_name mascoet 24_2019 sequencing method Sequencing by synthesis (Illumina) target gene not applicable target subfragment not applicable ERS12232378 SAMEA110133558 1561972 seawater metagenome ENA-FIRST-PUBLIC 2022-06-16 ENA-LAST-UPDATE 2022-06-16 External Id SAMEA110133558 INSDC center alias IFREMER_ODE_DYNECO_PELAGOS INSDC center name IFREMER_ODE_DYNECO_PELAGOS INSDC first public 2022-06-16T08:39:20Z INSDC last update 2022-06-16T08:39:20Z INSDC status public LIBRARY_CONSTRUCTION_PROTOCOL Illumina mRNA TruSeq Stranded Kit Submitter Id sam_mascoet 25_2019 adapters GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i]ATCTCGTATGCCGTCTTCTGCTTG/AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT broker name Bioinformatics Core Facility of Ifremer (French Research Institute for Exploitation of the Sea) collection_date 2019-03-19 common name seawater metagenome environment (biome) coastal environment environment (feature) littoral zone environment (material) water environmental package none environmental_sample Yes geographic location (country and/or sea) France geographic location (elevation) not applicable geographic location (latitude) 48.25706037 geographic location (longitude) -4.56067095 geographic location (region and locality) Dinan Bay investigation type metatranscriptome isolation_source sea water (5liter) multiplex identifiers CCGTCC pcr primers Illumina PCR Primer Cocktail project name Phytoplankton_communities_metaT_2021 sample name sam_mascoet 25_2019 sample_description water sample filtered on 10micrometers polycarbonate filter sample_name mascoet 25_2019 sequencing method Sequencing by synthesis (Illumina) target gene not applicable target subfragment not applicable ERS12232379 SAMEA110133559 1561972 seawater metagenome ENA-FIRST-PUBLIC 2022-06-16 ENA-LAST-UPDATE 2022-06-16 External Id SAMEA110133559 INSDC center alias IFREMER_ODE_DYNECO_PELAGOS INSDC center name IFREMER_ODE_DYNECO_PELAGOS INSDC first public 2022-06-16T08:39:20Z INSDC last update 2022-06-16T08:39:20Z INSDC status public LIBRARY_CONSTRUCTION_PROTOCOL Illumina mRNA TruSeq Stranded Kit Submitter Id sam_mascoet 26_2019 adapters GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i]ATCTCGTATGCCGTCTTCTGCTTG/AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT broker name Bioinformatics Core Facility of Ifremer (French Research Institute for Exploitation of the Sea) collection_date 2019-03-22 common name seawater metagenome environment (biome) coastal environment environment (feature) littoral zone environment (material) water environmental package none environmental_sample Yes geographic location (country and/or sea) France geographic location (elevation) not applicable geographic location (latitude) 48.25706037 geographic location (longitude) -4.56067095 geographic location (region and locality) Dinan Bay investigation type metatranscriptome isolation_source sea water (5liter) multiplex identifiers GTCCGC pcr primers Illumina PCR Primer Cocktail project name Phytoplankton_communities_metaT_2021 sample name sam_mascoet 26_2019 sample_description water sample filtered on 10micrometers polycarbonate filter sample_name mascoet 26_2019 sequencing method Sequencing by synthesis (Illumina) target gene not applicable target subfragment not applicable ERS12232380 SAMEA110133560 1561972 seawater metagenome ENA-FIRST-PUBLIC 2022-06-16 ENA-LAST-UPDATE 2022-06-16 External Id SAMEA110133560 INSDC center alias IFREMER_ODE_DYNECO_PELAGOS INSDC center name IFREMER_ODE_DYNECO_PELAGOS INSDC first public 2022-06-16T08:39:20Z INSDC last update 2022-06-16T08:39:20Z INSDC status public LIBRARY_CONSTRUCTION_PROTOCOL Illumina mRNA TruSeq Stranded Kit Submitter Id sam_mascoet 27 bis_2019 adapters GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i]ATCTCGTATGCCGTCTTCTGCTTG/AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT broker name Bioinformatics Core Facility of Ifremer (French Research Institute for Exploitation of the Sea) collection_date 2019-03-22 common name seawater metagenome environment (biome) coastal environment environment (feature) littoral zone environment (material) water environmental package none environmental_sample Yes geographic location (country and/or sea) France geographic location (elevation) not applicable geographic location (latitude) 48.2930042 geographic location (longitude) -4.4581772 geographic location (region and locality) Lanveoc Pier investigation type metatranscriptome isolation_source sea water (5liter) multiplex identifiers GTGAAA pcr primers Illumina PCR Primer Cocktail project name Phytoplankton_communities_metaT_2021 sample name sam_mascoet 27 bis_2019 sample_description water sample filtered on 10micrometers polycarbonate filter sample_name mascoet 27 bis_2019 sequencing method Sequencing by synthesis (Illumina) target gene not applicable target subfragment not applicable ERS12232381 SAMEA110133561 1561972 seawater metagenome ENA-FIRST-PUBLIC 2022-06-16 ENA-LAST-UPDATE 2022-06-16 External Id SAMEA110133561 INSDC center alias IFREMER_ODE_DYNECO_PELAGOS INSDC center name IFREMER_ODE_DYNECO_PELAGOS INSDC first public 2022-06-16T08:39:20Z INSDC last update 2022-06-16T08:39:20Z INSDC status public LIBRARY_CONSTRUCTION_PROTOCOL Illumina mRNA TruSeq Stranded Kit Submitter Id sam_mascoet 28_2019 adapters GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i]ATCTCGTATGCCGTCTTCTGCTTG/AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT broker name Bioinformatics Core Facility of Ifremer (French Research Institute for Exploitation of the Sea) collection_date 2019-03-22 common name seawater metagenome environment (biome) coastal environment environment (feature) littoral zone environment (material) water environmental package none environmental_sample Yes geographic location (country and/or sea) France geographic location (elevation) not applicable geographic location (latitude) 48.21019336 geographic location (longitude) -4.37214161 geographic location (region and locality) Telgruc Beach investigation type metatranscriptome isolation_source sea water (5liter) multiplex identifiers GTGGCC pcr primers Illumina PCR Primer Cocktail project name Phytoplankton_communities_metaT_2021 sample name sam_mascoet 28_2019 sample_description water sample filtered on 10micrometers polycarbonate filter sample_name mascoet 28_2019 sequencing method Sequencing by synthesis (Illumina) target gene not applicable target subfragment not applicable ERS12232382 SAMEA110133562 1561972 seawater metagenome ENA-FIRST-PUBLIC 2022-06-16 ENA-LAST-UPDATE 2022-06-16 External Id SAMEA110133562 INSDC center alias IFREMER_ODE_DYNECO_PELAGOS INSDC center name IFREMER_ODE_DYNECO_PELAGOS INSDC first public 2022-06-16T08:39:20Z INSDC last update 2022-06-16T08:39:20Z INSDC status public LIBRARY_CONSTRUCTION_PROTOCOL Illumina mRNA TruSeq Stranded Kit Submitter Id sam_mascoet 29 bis_2019 adapters GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i]ATCTCGTATGCCGTCTTCTGCTTG/AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT broker name Bioinformatics Core Facility of Ifremer (French Research Institute for Exploitation of the Sea) collection_date 2019-03-26 common name seawater metagenome environment (biome) coastal environment environment (feature) littoral zone environment (material) water environmental package none environmental_sample Yes geographic location (country and/or sea) France geographic location (elevation) not applicable geographic location (latitude) 48.25706037 geographic location (longitude) -4.56067095 geographic location (region and locality) Dinan Bay investigation type metatranscriptome isolation_source sea water (5liter) multiplex identifiers GTTTCG pcr primers Illumina PCR Primer Cocktail project name Phytoplankton_communities_metaT_2021 sample name sam_mascoet 29 bis_2019 sample_description water sample filtered on 10micrometers polycarbonate filter sample_name mascoet 29 bis_2019 sequencing method Sequencing by synthesis (Illumina) target gene not applicable target subfragment not applicable ERS12232383 SAMEA110133563 1561972 seawater metagenome ENA-FIRST-PUBLIC 2022-06-16 ENA-LAST-UPDATE 2022-06-16 External Id SAMEA110133563 INSDC center alias IFREMER_ODE_DYNECO_PELAGOS INSDC center name IFREMER_ODE_DYNECO_PELAGOS INSDC first public 2022-06-16T08:39:20Z INSDC last update 2022-06-16T08:39:20Z INSDC status public LIBRARY_CONSTRUCTION_PROTOCOL Illumina mRNA TruSeq Stranded Kit Submitter Id sam_mascoet 30 bis_2019 adapters GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i]ATCTCGTATGCCGTCTTCTGCTTG/AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT broker name Bioinformatics Core Facility of Ifremer (French Research Institute for Exploitation of the Sea) collection_date 2019-03-26 common name seawater metagenome environment (biome) coastal environment environment (feature) littoral zone environment (material) water environmental package none environmental_sample Yes geographic location (country and/or sea) France geographic location (elevation) not applicable geographic location (latitude) 48.21019336 geographic location (longitude) -4.37214161 geographic location (region and locality) Telgruc Beach investigation type metatranscriptome isolation_source sea water (5liter) multiplex identifiers CGTACG pcr primers Illumina PCR Primer Cocktail project name Phytoplankton_communities_metaT_2021 sample name sam_mascoet 30 bis_2019 sample_description water sample filtered on 10micrometers polycarbonate filter sample_name mascoet 30 bis_2019 sequencing method Sequencing by synthesis (Illumina) target gene not applicable target subfragment not applicable ERS12232384 SAMEA110133564 1561972 seawater metagenome ENA-FIRST-PUBLIC 2022-06-16 ENA-LAST-UPDATE 2022-06-16 External Id SAMEA110133564 INSDC center alias IFREMER_ODE_DYNECO_PELAGOS INSDC center name IFREMER_ODE_DYNECO_PELAGOS INSDC first public 2022-06-16T08:39:20Z INSDC last update 2022-06-16T08:39:20Z INSDC status public LIBRARY_CONSTRUCTION_PROTOCOL Illumina mRNA TruSeq Stranded Kit Submitter Id sam_mascoet 31_2019 adapters GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i]ATCTCGTATGCCGTCTTCTGCTTG/AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT broker name Bioinformatics Core Facility of Ifremer (French Research Institute for Exploitation of the Sea) collection_date 2019-03-26 common name seawater metagenome environment (biome) coastal environment environment (feature) littoral zone environment (material) water environmental package none environmental_sample Yes geographic location (country and/or sea) France geographic location (elevation) not applicable geographic location (latitude) 48.2930042 geographic location (longitude) -4.4581772 geographic location (region and locality) Lanveoc Pier investigation type metatranscriptome isolation_source sea water (5liter) multiplex identifiers GAGTGG pcr primers Illumina PCR Primer Cocktail project name Phytoplankton_communities_metaT_2021 sample name sam_mascoet 31_2019 sample_description water sample filtered on 10micrometers polycarbonate filter sample_name mascoet 31_2019 sequencing method Sequencing by synthesis (Illumina) target gene not applicable target subfragment not applicable ERS12232385 SAMEA110133565 1561972 seawater metagenome ENA-FIRST-PUBLIC 2022-06-16 ENA-LAST-UPDATE 2022-06-16 External Id SAMEA110133565 INSDC center alias IFREMER_ODE_DYNECO_PELAGOS INSDC center name IFREMER_ODE_DYNECO_PELAGOS INSDC first public 2022-06-16T08:39:20Z INSDC last update 2022-06-16T08:39:20Z INSDC status public LIBRARY_CONSTRUCTION_PROTOCOL Illumina mRNA TruSeq Stranded Kit Submitter Id sam_mascoet 32_2019 adapters GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i]ATCTCGTATGCCGTCTTCTGCTTG/AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT broker name Bioinformatics Core Facility of Ifremer (French Research Institute for Exploitation of the Sea) collection_date 2019-03-26 common name seawater metagenome environment (biome) coastal environment environment (feature) littoral zone environment (material) water environmental package none environmental_sample Yes geographic location (country and/or sea) France geographic location (elevation) not applicable geographic location (latitude) 48.3600557 geographic location (longitude) -4.5529852 geographic location (region and locality) Saint_Anne Bay investigation type metatranscriptome isolation_source sea water (5liter) multiplex identifiers ACTGAT pcr primers Illumina PCR Primer Cocktail project name Phytoplankton_communities_metaT_2021 sample name sam_mascoet 32_2019 sample_description water sample filtered on 10micrometers polycarbonate filter sample_name mascoet 32_2019 sequencing method Sequencing by synthesis (Illumina) target gene not applicable target subfragment not applicable ERS12232386 SAMEA110133566 1561972 seawater metagenome ENA-FIRST-PUBLIC 2022-06-16 ENA-LAST-UPDATE 2022-06-16 External Id SAMEA110133566 INSDC center alias IFREMER_ODE_DYNECO_PELAGOS INSDC center name IFREMER_ODE_DYNECO_PELAGOS INSDC first public 2022-06-16T08:39:20Z INSDC last update 2022-06-16T08:39:20Z INSDC status public LIBRARY_CONSTRUCTION_PROTOCOL Illumina mRNA TruSeq Stranded Kit Submitter Id sam_mascoet 34_2019 adapters GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i]ATCTCGTATGCCGTCTTCTGCTTG/AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT broker name Bioinformatics Core Facility of Ifremer (French Research Institute for Exploitation of the Sea) collection_date 2019-03-29 common name seawater metagenome environment (biome) coastal environment environment (feature) littoral zone environment (material) water environmental package none environmental_sample Yes geographic location (country and/or sea) France geographic location (elevation) not applicable geographic location (latitude) 48.21019336 geographic location (longitude) -4.37214161 geographic location (region and locality) Telgruc Beach investigation type metatranscriptome isolation_source sea water (5liter) multiplex identifiers ATCACG pcr primers Illumina PCR Primer Cocktail project name Phytoplankton_communities_metaT_2021 sample name sam_mascoet 34_2019 sample_description water sample filtered on 10micrometers polycarbonate filter sample_name mascoet 34_2019 sequencing method Sequencing by synthesis (Illumina) target gene not applicable target subfragment not applicable ERS12232387 SAMEA110133567 1561972 seawater metagenome ENA-FIRST-PUBLIC 2022-06-16 ENA-LAST-UPDATE 2022-06-16 External Id SAMEA110133567 INSDC center alias IFREMER_ODE_DYNECO_PELAGOS INSDC center name IFREMER_ODE_DYNECO_PELAGOS INSDC first public 2022-06-16T08:39:21Z INSDC last update 2022-06-16T08:39:21Z INSDC status public LIBRARY_CONSTRUCTION_PROTOCOL Illumina mRNA TruSeq Stranded Kit Submitter Id sam_mascoet 35_2019 adapters GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i]ATCTCGTATGCCGTCTTCTGCTTG/AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT broker name Bioinformatics Core Facility of Ifremer (French Research Institute for Exploitation of the Sea) collection_date 2019-03-29 common name seawater metagenome environment (biome) coastal environment environment (feature) littoral zone environment (material) water environmental package none environmental_sample Yes geographic location (country and/or sea) France geographic location (elevation) not applicable geographic location (latitude) 48.2930042 geographic location (longitude) -4.4581772 geographic location (region and locality) Lanveoc Pier investigation type metatranscriptome isolation_source sea water (5liter) multiplex identifiers CGATGT pcr primers Illumina PCR Primer Cocktail project name Phytoplankton_communities_metaT_2021 sample name sam_mascoet 35_2019 sample_description water sample filtered on 10micrometers polycarbonate filter sample_name mascoet 35_2019 sequencing method Sequencing by synthesis (Illumina) target gene not applicable target subfragment not applicable ERS12232388 SAMEA110133568 1561972 seawater metagenome ENA-FIRST-PUBLIC 2022-06-16 ENA-LAST-UPDATE 2022-06-16 External Id SAMEA110133568 INSDC center alias IFREMER_ODE_DYNECO_PELAGOS INSDC center name IFREMER_ODE_DYNECO_PELAGOS INSDC first public 2022-06-16T08:39:21Z INSDC last update 2022-06-16T08:39:21Z INSDC status public LIBRARY_CONSTRUCTION_PROTOCOL Illumina mRNA TruSeq Stranded Kit Submitter Id sam_mascoet 36_2019 adapters GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i]ATCTCGTATGCCGTCTTCTGCTTG/AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT broker name Bioinformatics Core Facility of Ifremer (French Research Institute for Exploitation of the Sea) collection_date 2019-03-29 common name seawater metagenome environment (biome) coastal environment environment (feature) littoral zone environment (material) water environmental package none environmental_sample Yes geographic location (country and/or sea) France geographic location (elevation) not applicable geographic location (latitude) 48.3600557 geographic location (longitude) -4.5529852 geographic location (region and locality) Saint_Anne Bay investigation type metatranscriptome isolation_source sea water (5liter) multiplex identifiers TTAGGC pcr primers Illumina PCR Primer Cocktail project name Phytoplankton_communities_metaT_2021 sample name sam_mascoet 36_2019 sample_description water sample filtered on 10micrometers polycarbonate filter sample_name mascoet 36_2019 sequencing method Sequencing by synthesis (Illumina) target gene not applicable target subfragment not applicable