ERS2654991 SAMEA4835121 496922 coral metagenome Coral Mucus from Goniastrea edwardsi sampled from Bills Bay, Ningaloo, Western Australia, Australia as sample E7.Gon.edwa.1.20150623.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:40Z External Id SAMEA4835121 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:40Z INSDC status public Submitter Id E7.17.Gon.edwa.1.20150623.M abundance gbr common abundance world common barcodesequence GATGAGGTAT binary_algal_contact n binary_cca_contact n binary_disease n binary_macroalgal_contact y binary_tissue_loss n binary_turf_contact n biological_sample_notes WA_265 biologicalmatter Coral Mucus cca_contact_percent 0 cca_overgrown n collected by Joe Pollock collection date 2015 collection id Bills Bay_20150623 collection time 12:52 collection_timestamp 6/23/15 12:52 coloniality colonial colony maximum diameter 100 colony maximum diameter unit cm colony_height_m 28 colony_maximum_diameter 100 colony_maximum_diameter_universal 100 colony_maximum_gcmp_recorded 30 colony_name E7.17.Gon.edwa.1.20150623 colony_width1 30 colony_width2 14 compartment_replicates 1 complex_robust robust concatenated_date 20150623 coral_color D4 corallite width maximum 5 corallite width maximum unit mm corallite width minimum 2.5 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_overgrown n cyanobacteria_percent 0 daily_replicate 1 date 6/23/15 depth 2.9 depth lower 30 depth lower unit m depth upper 0 depth upper unit m depth_method measured disease_percent 0 dna_extracted n dominant_cover_2m sargassum eastern-most range edge -169.625752 env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E7 family Merulinidae field_host_genus_id Goniastrea field_host_name Goniastrea edwardsi field_host_species_id edwardsi full_location Indo-Pacific;Indian;Eastern Indian;Australia;W;Ningaloo;Bills Bay full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XVII_Goniastrea_edwardsi functional_group_sensu_darling Stress-tolerant genus fossil age 65.5 genus fossil age unit mya geographic area W geographic location (country and/or sea) Australia geographic location (latitude) -23.140369 geographic location (longitude) 113.769166 growth form typical massive hemisphere Southern host species edwardsi host_clade_sensu_fukami XVII host_clade_sensu_fukami_numeric 17 host_genus Goniastrea host_genus_id Goniastrea host_name Goniastrea edwardsi host_species_id edwardsi huang_roy_tree_name FAV_Goniastrea_edwardsi iucn red list category LC latitude -23.140369 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name E7.Gon.edwa.1 local_sample_id WA_265_M longitude 113.769166 macroalgal_contact_types Sargassum mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 1 ncbi_inherited_blast_name stony corals northern-most range edge 37.2245759 ocean Indian ocean_area Eastern Indian ocean_superregion Indo-Pacific oocyte size at maturity 308 oocyte size at maturity unit um outgroup n oz_disease_mean 0.051245745 oz_disease_sd 0.025222318 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.3 prop_colony_maximum_diameter_universal 0.3 prop_colony_maximum_gcmp_recorded 1 range size 76613215.33 range size unit km^2 reef_name Bills Bay reef_type Fringing Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E7.17.Gon.edwa.1.20150623.M sample type Coral Mucus sampling_expedition E7_Ningaloo_2015 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock598_WA_265_M sexual system hermaphrodite shelf_location inshore site name Ningaloo southern-most range edge -34.56210164 species age phylogeny 1.165984194 species age phylogeny unit mya substrate live coral substrate attachment attached symbio_its2_sequenced n symbiodinium sp. in propagules no target gene 16S target subfragment V4 taxon id 498488 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XVII taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Merulinidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 21 tissue compartment M tissue_loss_percent 0 turf_contact_percent 0 turf_overgrown n visibility 10 visibility_method Diver Estimate water clarity preference clear wave exposure preference broad western-most range edge 26.9215053 zooxanthellate zooxanthellate ERS2654992 SAMEA4835122 496922 coral metagenome Coral Mucus from Goniastrea edwardsi sampled from Bills Bay, Ningaloo, Western Australia, Australia as sample E7.Gon.edwa.2.20150623.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:40Z External Id SAMEA4835122 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:40Z INSDC status public Submitter Id E7.17.Gon.edwa.2.20150623.M abundance gbr common abundance world common barcodesequence GTCTCAATGT binary_algal_contact n binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact n biological_sample_notes WA_266 biologicalmatter Coral Mucus cca_contact_percent 0 cca_overgrown n collected by Joe Pollock collection date 2015 collection id Bills Bay_20150623 collection time 12:58 collection_timestamp 6/23/15 12:58 coloniality colonial colony maximum diameter 100 colony maximum diameter unit cm colony_height_m 12 colony_maximum_diameter 100 colony_maximum_diameter_universal 100 colony_maximum_gcmp_recorded 30 colony_name E7.17.Gon.edwa.2.20150623 colony_width1 30 colony_width2 25 compartment_replicates 1 complex_robust robust concatenated_date 20150623 coral_color D3 corallite width maximum 5 corallite width maximum unit mm corallite width minimum 2.5 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_overgrown n cyanobacteria_percent 0 daily_replicate 2 date 6/23/15 depth 2.7 depth lower 30 depth lower unit m depth upper 0 depth upper unit m depth_method measured disease_percent 0 dna_extracted n dominant_cover_2m sand eastern-most range edge -169.625752 env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E7 family Merulinidae field_host_genus_id Goniastrea field_host_name Goniastrea edwardsi field_host_species_id edwardsi full_location Indo-Pacific;Indian;Eastern Indian;Australia;W;Ningaloo;Bills Bay full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XVII_Goniastrea_edwardsi functional_group_sensu_darling Stress-tolerant genus fossil age 65.5 genus fossil age unit mya geographic area W geographic location (country and/or sea) Australia geographic location (latitude) -23.140369 geographic location (longitude) 113.769166 growth form typical massive hemisphere Southern host species edwardsi host_clade_sensu_fukami XVII host_clade_sensu_fukami_numeric 17 host_genus Goniastrea host_genus_id Goniastrea host_name Goniastrea edwardsi host_species_id edwardsi huang_roy_tree_name FAV_Goniastrea_edwardsi iucn red list category LC latitude -23.140369 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name E7.Gon.edwa.2 local_sample_id WA_266_M longitude 113.769166 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 37.2245759 ocean Indian ocean_area Eastern Indian ocean_superregion Indo-Pacific oocyte size at maturity 308 oocyte size at maturity unit um outgroup n oz_disease_mean 0.051245745 oz_disease_sd 0.025222318 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.3 prop_colony_maximum_diameter_universal 0.3 prop_colony_maximum_gcmp_recorded 1 range size 76613215.33 range size unit km^2 reef_name Bills Bay reef_type Fringing Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E7.17.Gon.edwa.2.20150623.M sample type Coral Mucus sampling_expedition E7_Ningaloo_2015 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock599_WA_266_M sexual system hermaphrodite shelf_location inshore site name Ningaloo southern-most range edge -34.56210164 species age phylogeny 1.165984194 species age phylogeny unit mya substrate sand substrate attachment attached symbio_its2_sequenced n symbiodinium sp. in propagules no target gene 16S target subfragment V4 taxon id 498488 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XVII taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Merulinidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 21 tissue compartment M tissue_loss_percent 0 turf_contact_percent 0 turf_overgrown n visibility 10 visibility_method Diver Estimate water clarity preference clear wave exposure preference broad western-most range edge 26.9215053 zooxanthellate zooxanthellate ERS2654993 SAMEA4835123 496922 coral metagenome Coral Skeleton from Acropora palifera sampled from North Bay, Lord Howe Island, New South Wales, Australia as sample E10.Acr.pali.3.20150627.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:41Z External Id SAMEA4835123 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:41Z INSDC status public Submitter Id E10.Acr.pali.3.20150627.S abundance gbr common abundance world common barcodesequence TGCTCGTAGT binary_algal_contact n binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact n biological_sample_notes LH_278 biologicalmatter Coral Skeleton cca_contact_percent 0 cca_overgrown n collected by Joe Pollock collection date 2015 collection id North Bay_20150627 collection time 9:04 collection_timestamp 6/27/15 9:04 coloniality colonial colony_height_m 35 colony_name E10.6.Acr.pali.3.20150627 colony_width1 25 colony_width2 13 compartment_replicates 1 complex_robust complex concatenated_date 20150627 coral_color D5 corallite width maximum 1.4 corallite width maximum unit mm corallite width minimum 0.7 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_overgrown n cyanobacteria_percent 0 daily_replicate 3 date 6/27/15 depth 1.2 depth lower 20 depth lower unit m depth upper 2 depth upper unit m depth_method measured disease_percent 0 dna_extracted n dominant_cover_2m sand eastern-most range edge -176.1832106 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E10 family Acroporidae field_host_genus_id Isopora field_host_name Isopora palifera field_host_species_id palifera full_location Indo-Pacific;Pacific;Tasman Sea;Australia;SE;Lord Howe Island;North Bay full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_VI_Isopora_palifera geographic area SE geographic location (country and/or sea) Australia geographic location (latitude) -31.52135 geographic location (longitude) 159.0467333 growth form typical branching_open growth outline type indeterminate hemisphere Southern host species palifera host_clade_sensu_fukami VI host_clade_sensu_fukami_numeric 6 host_genus Isopora host_genus_id Isopora host_name Isopora palifera host_species_id palifera huang_roy_tree_name ACR_Isopora_palifera iucn red list category NT latitude -31.52135 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name E10.Acr.pali.3 local_sample_id LH_278_S longitude 159.0467333 mode of larval development brooder n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 30.04437901 ocean Pacific ocean_area Tasman Sea ocean_superregion Indo-Pacific oocyte size at maturity 249 oocyte size at maturity unit um outgroup n oz_disease_mean 0.472734632 oz_disease_sd 0.174204206 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia propagule size on release mean 1459 propagule size on release mean unit um range size 78706897.7 range size unit km^2 reef_name North Bay reef_type Fringing Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E10.Acr.pali.3.20150627.S sample type Coral Skeleton sampling_expedition E10_Lord_Howe_2015 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock6 sexual system hermaphrodite shelf_location inshore site name Lord Howe Island skeletal density 1.52 skeletal density unit g cm-3 southern-most range edge -34.54927646 species age phylogeny 5.265550916 species age phylogeny unit mya substrate dead_coral substrate attachment attached symbio_its2_sequenced n synonyms Acropora palifera target gene 16S target subfragment V4 taxon id 105615 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_VI taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Acroporidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 21 tissue compartment S tissue_loss_percent 0 turf_contact_percent 0 turf_overgrown n visibility 20 visibility_method Diver Estimate water clarity preference clear wave exposure preference broad western-most range edge 26.4797142 zooxanthellate zooxanthellate ERS2654994 SAMEA4835124 496922 coral metagenome Coral Mucus from Psammacora digitata sampled from Lizard Island, Australia as sample E1.11.Psa.digi.1.20140807.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:41Z External Id SAMEA4835124 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:41Z INSDC status public Submitter Id E1.11.Psa.digi.1.20140807.M abundance gbr uncommon abundance world common algal_contact_types turf__cyanobacteria__valonia barcodesequence TCACGCTATG binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact y binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Mucus cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Trawler_20140807 collection time 10:00 collection_timestamp 8/7/14 10:00 coloniality colonial colony maximum diameter 6.5 colony maximum diameter unit cm colony_height_m 22 colony_maximum_diameter 6.5 colony_maximum_diameter_universal 25 colony_maximum_gcmp_recorded 25 colony_name E1.11.Psa.digi.1.20140807 colony_width1 25 colony_width2 20 compartment_replicates 1 complex_robust robust concatenated_date 20140807 corallite width maximum 2.3 corallite width maximum unit mm corallite width minimum 1.8 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 5 daily_replicate 1 date 8/7/14 depth 1.2192 depth lower 20 depth lower unit m depth upper 1 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -138.0568612 env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E1 family Psammocoridae field_host_genus_id Psammocora field_host_name Psammocora digitata field_host_species_id digitata full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XI_Psammocora_digitata genus fossil age 37.2 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68344 geographic location (longitude) 145.46554 growth form typical columnar hemisphere Southern host species digitata host_clade_sensu_fukami XI host_clade_sensu_fukami_numeric 11 host_genus Psammocora host_genus_id Psammocora host_name Psammocora digitata host_species_id digitata huang_roy_tree_name SID_Psammocora_digitata iucn red list category NT latitude -14.68344 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Psammacora digitata_20140807 local_sample_id Pav Muc 140807 longitude 145.46554 macroalgal_contact_types Valonia n_algal_contacts 3 n_macroalgal_contacts 1 ncbi_inherited_blast_name stony corals northern-most range edge 31.13407822 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0 oz_disease_sd 0 par_method buoy parrotfish_bites n pcr primers 515F/806R photosynthetically_active_radiation 724.045 physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter 3.846153846 prop_colony_maximum_diameter_universal 1 prop_colony_maximum_gcmp_recorded 1 range size 73944384.08 range size unit km^2 reef_name Trawler reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.11.Psa.digi.1.20140807.M sample type Coral Mucus sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact y sequence_center_id Pollock60 sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -33.7834359 species age phylogeny 0.932787995 species age phylogeny unit mya substrate sediment substrate attachment attached symbio_its2_sequenced y target gene 16S target subfragment V4 taxon id 371655 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XI taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Psammocoridae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.9 tissue compartment M tissue_loss_percent 0 turf_contact_percent 5 visibility 15 visibility_method Horizontal Secchi Disk water clarity preference both wave exposure preference broad western-most range edge 37.1240953 zooxanthellate zooxanthellate ERS2654995 SAMEA4835125 496922 coral metagenome Coral Mucus from Favia sp_C sampled from Bills Bay, Ningaloo, Western Australia, Australia as sample E7.Fav.spC.1.20150623.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:41Z External Id SAMEA4835125 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:41Z INSDC status public Submitter Id E7.17.Fav.spC.1.20150623.M barcodesequence TACTAGGATC binary_algal_contact n binary_cca_contact n binary_disease n binary_macroalgal_contact y binary_tissue_loss n binary_turf_contact n biological_sample_notes WA_267 - Pale biologicalmatter Coral Mucus cca_contact_percent 0 cca_overgrown n collected by Joe Pollock collection date 2015 collection id Bills Bay_20150623 collection time 13:07 collection_timestamp 6/23/15 13:07 colony_height_m 10 colony_maximum_diameter_universal 35 colony_maximum_gcmp_recorded 35 colony_name E7.17.Fav.spC.1.20150623 colony_width1 30 colony_width2 30 compartment_replicates 1 complex_robust robust concatenated_date 20150623 coral_color D2 country Australia cyanobacteria_contact n cyanobacteria_overgrown n cyanobacteria_percent 0 daily_replicate 1 date 6/23/15 depth 2.8 depth_method measured disease_percent 0 dna_extracted n dominant_cover_2m sand env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E7 family Merulinidae field_host_genus_id Favia field_host_name Favia sp_C field_host_species_id sp_C full_location Indo-Pacific;Indian;Eastern Indian;Australia;W;Ningaloo;Bills Bay full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XVII_Dipsastraea_sp_C geographic area W geographic location (country and/or sea) Australia geographic location (latitude) -23.140369 geographic location (longitude) 113.769166 hemisphere Southern host species sp_C host_clade_sensu_fukami XVII host_clade_sensu_fukami_numeric 17 host_genus Dipsastraea host_genus_id Dipsastraea host_name Dipsastraea sp_C host_species_id sp_C huang_roy_tree_name FAV latitude -23.140369 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name E7.Fav.spC.1 local_sample_id WA_267_M longitude 113.769166 macroalgal_contact_types Sargassum n_algal_contacts 0 n_macroalgal_contacts 1 ncbi_inherited_blast_name stony corals ocean Indian ocean_area Eastern Indian ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.159326209 oz_disease_sd 0.110665773 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter_universal 0.857142857 prop_colony_maximum_gcmp_recorded 0.857142857 reef_name Bills Bay reef_type Fringing Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E7.17.Fav.spC.1.20150623.M sample type Coral Mucus sampling_expedition E7_Ningaloo_2015 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock600_WA_267_M shelf_location inshore site name Ningaloo substrate sand symbio_its2_sequenced n synonyms Favia sp_C target gene 16S target subfragment V4 taxon id 44303 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XVII taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Merulinidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 21 tissue compartment M tissue_loss_percent 0 turf_contact_percent 0 turf_overgrown n visibility 10 visibility_method Diver Estimate ERS2654996 SAMEA4835126 496922 coral metagenome Coral Tissue from Favia sp_C sampled from Bills Bay, Ningaloo, Western Australia, Australia as sample E7.Fav.spC.1.20150623.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:41Z External Id SAMEA4835126 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:41Z INSDC status public Submitter Id E7.17.Fav.spC.1.20150623.T barcodesequence GCGTCTGAAT binary_algal_contact n binary_cca_contact n binary_disease n binary_macroalgal_contact y binary_tissue_loss n binary_turf_contact n biological_sample_notes WA_267 - Pale biologicalmatter Coral Tissue cca_contact_percent 0 cca_overgrown n collected by Joe Pollock collection date 2015 collection id Bills Bay_20150623 collection time 13:07 collection_timestamp 6/23/15 13:07 colony_height_m 10 colony_maximum_diameter_universal 35 colony_maximum_gcmp_recorded 35 colony_name E7.17.Fav.spC.1.20150623 colony_width1 30 colony_width2 30 compartment_replicates 1 complex_robust robust concatenated_date 20150623 coral_color D2 country Australia cyanobacteria_contact n cyanobacteria_overgrown n cyanobacteria_percent 0 daily_replicate 1 date 6/23/15 depth 2.8 depth_method measured disease_percent 0 dna_extracted n dominant_cover_2m sand env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E7 family Merulinidae field_host_genus_id Favia field_host_name Favia sp_C field_host_species_id sp_C full_location Indo-Pacific;Indian;Eastern Indian;Australia;W;Ningaloo;Bills Bay full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XVII_Dipsastraea_sp_C geographic area W geographic location (country and/or sea) Australia geographic location (latitude) -23.140369 geographic location (longitude) 113.769166 hemisphere Southern host species sp_C host_clade_sensu_fukami XVII host_clade_sensu_fukami_numeric 17 host_genus Dipsastraea host_genus_id Dipsastraea host_name Dipsastraea sp_C host_species_id sp_C huang_roy_tree_name FAV latitude -23.140369 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name E7.Fav.spC.1 local_sample_id WA_267_T longitude 113.769166 macroalgal_contact_types Sargassum n_algal_contacts 0 n_macroalgal_contacts 1 ncbi_inherited_blast_name stony corals ocean Indian ocean_area Eastern Indian ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.159326209 oz_disease_sd 0.110665773 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter_universal 0.857142857 prop_colony_maximum_gcmp_recorded 0.857142857 reef_name Bills Bay reef_type Fringing Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E7.17.Fav.spC.1.20150623.T sample type Coral Tissue sampling_expedition E7_Ningaloo_2015 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock601_WA_267_T shelf_location inshore site name Ningaloo substrate sand symbio_its2_sequenced n synonyms Favia sp_C target gene 16S target subfragment V4 taxon id 44303 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XVII taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Merulinidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 21 tissue compartment T tissue_loss_percent 0 turf_contact_percent 0 turf_overgrown n visibility 10 visibility_method Diver Estimate ERS2654997 SAMEA4835127 496922 coral metagenome Coral Skeleton from Acropora hyacinthus sampled from Great Barrier Reef - Central Sector, Australia as sample E3.6.Acr.hyac.1F.20150105.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:41Z External Id SAMEA4835127 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:41Z INSDC status public Submitter Id E3.6.Acr.hyac.1.20150105.S abundance gbr common abundance world common barcodesequence CGCTAATGTA binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Skeleton collected by Kathy Morrow collection date 2015 collection id Fork _20150105 collection time 10:00 collection_timestamp 1/5/15 10:00 coloniality colonial colony maximum diameter 300 colony maximum diameter unit cm colony_maximum_diameter 300 colony_maximum_diameter_universal 300 colony_maximum_gcmp_recorded 108 colony_name E3.6.Acr.hyac.1.20150105 compartment_replicates 1 complex_robust complex concatenated_date 20150105 contact_description Rubble on reef flat corallite width maximum 1.1 corallite width maximum unit mm corallite width minimum 0.4 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 1/5/15 depth 2.5 depth lower 20 depth lower unit m depth upper 5 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -104.3007769 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E3 family Acroporidae field_host_genus_id Acropora field_host_name Acropora hyacinthus field_host_species_id hyacinthus full_location Indo-Pacific;Pacific;Coral Sea;Australia;E;Great Barrier Reef - Central Sector;Fork full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_VI_Acropora_hyacinthus functional_group_sensu_darling Competitive genus fossil age 55.8 genus fossil age unit mya geographic area E geographic location (country and/or sea) Australia geographic location (latitude) -18.611 geographic location (longitude) 147.57515 growth form typical tables_or_plates growth outline type determinate hemisphere Southern host species hyacinthus host_clade_sensu_fukami VI host_clade_sensu_fukami_numeric 6 host_genus Acropora host_genus_id Acropora host_name Acropora hyacinthus host_species_id hyacinthus huang_roy_tree_name ACR_Acropora_hyacinthus iucn red list category NT latitude -18.611 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 1_S local_sample_id GC_6_Acr_hyac_1F_20150105_S longitude 147.57515 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 38.84118034 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 484 oocyte size at maturity unit um outgroup n oz_disease_mean 1.578324463 oz_disease_sd 0.456565414 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.166666667 prop_colony_maximum_diameter_universal 0.166666667 prop_colony_maximum_gcmp_recorded 0.462962963 range size 110136269.9 range size unit km^2 reef_name Fork reef_type Outer Shelf reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.6.Acr.hyac.1.20150105.S sample type Coral Skeleton sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock602_001_S sexual system hermaphrodite shelf_location offshore site name Great Barrier Reef - Central Sector skeletal density 1.28 skeletal density unit g cm-3 southern-most range edge -35.55462518 species age phylogeny 0.588742379 species age phylogeny unit mya substrate Rubble on reef flat. substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 55974 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_VI taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Acroporidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 28 tissue compartment S water clarity preference clear wave exposure preference exposed western-most range edge 25.4743655 zooxanthellate zooxanthellate ERS2654998 SAMEA4835128 496922 coral metagenome Coral Tissue from Acropora hyacinthus sampled from Great Barrier Reef - Central Sector, Australia as sample E3.6.Acr.hyac.1F.20150105.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:41Z External Id SAMEA4835128 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:41Z INSDC status public Submitter Id E3.6.Acr.hyac.1.20150105.T abundance gbr common abundance world common barcodesequence CTCAATCGTA binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Tissue collected by Kathy Morrow collection date 2015 collection id Fork _20150105 collection time 10:00 collection_timestamp 1/5/15 10:00 coloniality colonial colony maximum diameter 300 colony maximum diameter unit cm colony_maximum_diameter 300 colony_maximum_diameter_universal 300 colony_maximum_gcmp_recorded 108 colony_name E3.6.Acr.hyac.1.20150105 compartment_replicates 1 complex_robust complex concatenated_date 20150105 contact_description Rubble on reef flat corallite width maximum 1.1 corallite width maximum unit mm corallite width minimum 0.4 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 1/5/15 depth 2.5 depth lower 20 depth lower unit m depth upper 5 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -104.3007769 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E3 family Acroporidae field_host_genus_id Acropora field_host_name Acropora hyacinthus field_host_species_id hyacinthus full_location Indo-Pacific;Pacific;Coral Sea;Australia;E;Great Barrier Reef - Central Sector;Fork full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_VI_Acropora_hyacinthus functional_group_sensu_darling Competitive genus fossil age 55.8 genus fossil age unit mya geographic area E geographic location (country and/or sea) Australia geographic location (latitude) -18.611 geographic location (longitude) 147.57515 growth form typical tables_or_plates growth outline type determinate hemisphere Southern host species hyacinthus host_clade_sensu_fukami VI host_clade_sensu_fukami_numeric 6 host_genus Acropora host_genus_id Acropora host_name Acropora hyacinthus host_species_id hyacinthus huang_roy_tree_name ACR_Acropora_hyacinthus iucn red list category NT latitude -18.611 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 1_T local_sample_id GC_6_Acr_hyac_1F_20150105_T longitude 147.57515 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 38.84118034 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 484 oocyte size at maturity unit um outgroup n oz_disease_mean 1.578324463 oz_disease_sd 0.456565414 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.166666667 prop_colony_maximum_diameter_universal 0.166666667 prop_colony_maximum_gcmp_recorded 0.462962963 range size 110136269.9 range size unit km^2 reef_name Fork reef_type Outer Shelf reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.6.Acr.hyac.1.20150105.T sample type Coral Tissue sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock603_001_T sexual system hermaphrodite shelf_location offshore site name Great Barrier Reef - Central Sector skeletal density 1.28 skeletal density unit g cm-3 southern-most range edge -35.55462518 species age phylogeny 0.588742379 species age phylogeny unit mya substrate Rubble on reef flat. substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 55974 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_VI taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Acroporidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 28 tissue compartment T water clarity preference clear wave exposure preference exposed western-most range edge 25.4743655 zooxanthellate zooxanthellate ERS2654999 SAMEA4835129 496922 coral metagenome Coral Mucus from Acropora hyacinthus sampled from Great Barrier Reef - Central Sector, Australia as sample E3.6.Acr.hyac.1F.20150105.m of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:41Z External Id SAMEA4835129 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:41Z INSDC status public Submitter Id E3.6.Acr.hyac.1.20150105.M abundance gbr common abundance world common barcodesequence TTCTCATCGT binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Mucus collected by Kathy Morrow collection date 2015 collection id Fork _20150105 collection time 10:00 collection_timestamp 1/5/15 10:00 coloniality colonial colony maximum diameter 300 colony maximum diameter unit cm colony_maximum_diameter 300 colony_maximum_diameter_universal 300 colony_maximum_gcmp_recorded 108 colony_name E3.6.Acr.hyac.1.20150105 compartment_replicates 1 complex_robust complex concatenated_date 20150105 contact_description Rubble on reef flat corallite width maximum 1.1 corallite width maximum unit mm corallite width minimum 0.4 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 1/5/15 depth 2.5 depth lower 20 depth lower unit m depth upper 5 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -104.3007769 env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E3 family Acroporidae field_host_genus_id Acropora field_host_name Acropora hyacinthus field_host_species_id hyacinthus full_location Indo-Pacific;Pacific;Coral Sea;Australia;E;Great Barrier Reef - Central Sector;Fork full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_VI_Acropora_hyacinthus functional_group_sensu_darling Competitive genus fossil age 55.8 genus fossil age unit mya geographic area E geographic location (country and/or sea) Australia geographic location (latitude) -18.611 geographic location (longitude) 147.57515 growth form typical tables_or_plates growth outline type determinate hemisphere Southern host species hyacinthus host_clade_sensu_fukami VI host_clade_sensu_fukami_numeric 6 host_genus Acropora host_genus_id Acropora host_name Acropora hyacinthus host_species_id hyacinthus huang_roy_tree_name ACR_Acropora_hyacinthus iucn red list category NT latitude -18.611 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 1_M local_sample_id GC_6_Acr_hyac_1F_20150105_m longitude 147.57515 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 38.84118034 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 484 oocyte size at maturity unit um outgroup n oz_disease_mean 1.578324463 oz_disease_sd 0.456565414 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.166666667 prop_colony_maximum_diameter_universal 0.166666667 prop_colony_maximum_gcmp_recorded 0.462962963 range size 110136269.9 range size unit km^2 reef_name Fork reef_type Outer Shelf reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.6.Acr.hyac.1.20150105.M sample type Coral Mucus sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock604_001_M sexual system hermaphrodite shelf_location offshore site name Great Barrier Reef - Central Sector skeletal density 1.28 skeletal density unit g cm-3 southern-most range edge -35.55462518 species age phylogeny 0.588742379 species age phylogeny unit mya substrate Rubble on reef flat. substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 55974 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_VI taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Acroporidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 28 tissue compartment M water clarity preference clear wave exposure preference exposed western-most range edge 25.4743655 zooxanthellate zooxanthellate ERS2655000 SAMEA4835130 496922 coral metagenome Coral Skeleton from Acropora hyacinthus sampled from Great Barrier Reef - Central Sector, Australia as sample E3.6.Acr.hyac.2F.20150105.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:41Z External Id SAMEA4835130 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:41Z INSDC status public Submitter Id E3.6.Acr.hyac.2.20150105.S abundance gbr common abundance world common barcodesequence GGTAGAATGA binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Skeleton collected by Kathy Morrow collection date 2015 collection id Fork _20150105 collection time 10:00 collection_timestamp 1/5/15 10:00 coloniality colonial colony maximum diameter 300 colony maximum diameter unit cm colony_maximum_diameter 300 colony_maximum_diameter_universal 300 colony_maximum_gcmp_recorded 108 colony_name E3.6.Acr.hyac.2.20150105 compartment_replicates 1 complex_robust complex concatenated_date 20150105 contact_description Rubble on reef flat corallite width maximum 1.1 corallite width maximum unit mm corallite width minimum 0.4 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 2 date 1/5/15 depth 2.5 depth lower 20 depth lower unit m depth upper 5 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -104.3007769 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E3 family Acroporidae field_host_genus_id Acropora field_host_name Acropora hyacinthus field_host_species_id hyacinthus full_location Indo-Pacific;Pacific;Coral Sea;Australia;E;Great Barrier Reef - Central Sector;Fork full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_VI_Acropora_hyacinthus functional_group_sensu_darling Competitive genus fossil age 55.8 genus fossil age unit mya geographic area E geographic location (country and/or sea) Australia geographic location (latitude) -18.611 geographic location (longitude) 147.57515 growth form typical tables_or_plates growth outline type determinate hemisphere Southern host species hyacinthus host_clade_sensu_fukami VI host_clade_sensu_fukami_numeric 6 host_genus Acropora host_genus_id Acropora host_name Acropora hyacinthus host_species_id hyacinthus huang_roy_tree_name ACR_Acropora_hyacinthus iucn red list category NT latitude -18.611 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 2_S local_sample_id GC_6_Acr_hyac_2F_20150105_S longitude 147.57515 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 38.84118034 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 484 oocyte size at maturity unit um outgroup n oz_disease_mean 1.578324463 oz_disease_sd 0.456565414 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.18 prop_colony_maximum_diameter_universal 0.18 prop_colony_maximum_gcmp_recorded 0.5 range size 110136269.9 range size unit km^2 reef_name Fork reef_type Outer Shelf reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.6.Acr.hyac.2.20150105.S sample type Coral Skeleton sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock605_002_S sexual system hermaphrodite shelf_location offshore site name Great Barrier Reef - Central Sector skeletal density 1.28 skeletal density unit g cm-3 southern-most range edge -35.55462518 species age phylogeny 0.588742379 species age phylogeny unit mya substrate Rubble on reef flat. substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 55974 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_VI taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Acroporidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 28 tissue compartment S water clarity preference clear wave exposure preference exposed western-most range edge 25.4743655 zooxanthellate zooxanthellate ERS2655001 SAMEA4835131 496922 coral metagenome Coral Tissue from Acropora hyacinthus sampled from Great Barrier Reef - Central Sector, Australia as sample E3.6.Acr.hyac.2F.20150105.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:41Z External Id SAMEA4835131 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:41Z INSDC status public Submitter Id E3.6.Acr.hyac.2.20150105.T abundance gbr common abundance world common barcodesequence GTTCGATTGT binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Tissue collected by Kathy Morrow collection date 2015 collection id Fork _20150105 collection time 10:00 collection_timestamp 1/5/15 10:00 coloniality colonial colony maximum diameter 300 colony maximum diameter unit cm colony_maximum_diameter 300 colony_maximum_diameter_universal 300 colony_maximum_gcmp_recorded 108 colony_name E3.6.Acr.hyac.2.20150105 compartment_replicates 1 complex_robust complex concatenated_date 20150105 contact_description Rubble on reef flat corallite width maximum 1.1 corallite width maximum unit mm corallite width minimum 0.4 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 2 date 1/5/15 depth 2.5 depth lower 20 depth lower unit m depth upper 5 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -104.3007769 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E3 family Acroporidae field_host_genus_id Acropora field_host_name Acropora hyacinthus field_host_species_id hyacinthus full_location Indo-Pacific;Pacific;Coral Sea;Australia;E;Great Barrier Reef - Central Sector;Fork full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_VI_Acropora_hyacinthus functional_group_sensu_darling Competitive genus fossil age 55.8 genus fossil age unit mya geographic area E geographic location (country and/or sea) Australia geographic location (latitude) -18.611 geographic location (longitude) 147.57515 growth form typical tables_or_plates growth outline type determinate hemisphere Southern host species hyacinthus host_clade_sensu_fukami VI host_clade_sensu_fukami_numeric 6 host_genus Acropora host_genus_id Acropora host_name Acropora hyacinthus host_species_id hyacinthus huang_roy_tree_name ACR_Acropora_hyacinthus iucn red list category NT latitude -18.611 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 2_T local_sample_id GC_6_Acr_hyac_2F_20150105_T longitude 147.57515 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 38.84118034 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 484 oocyte size at maturity unit um outgroup n oz_disease_mean 1.578324463 oz_disease_sd 0.456565414 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.18 prop_colony_maximum_diameter_universal 0.18 prop_colony_maximum_gcmp_recorded 0.5 range size 110136269.9 range size unit km^2 reef_name Fork reef_type Outer Shelf reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.6.Acr.hyac.2.20150105.T sample type Coral Tissue sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock606_002_T sexual system hermaphrodite shelf_location offshore site name Great Barrier Reef - Central Sector skeletal density 1.28 skeletal density unit g cm-3 southern-most range edge -35.55462518 species age phylogeny 0.588742379 species age phylogeny unit mya substrate Rubble on reef flat. substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 55974 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_VI taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Acroporidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 28 tissue compartment T water clarity preference clear wave exposure preference exposed western-most range edge 25.4743655 zooxanthellate zooxanthellate ERS2655002 SAMEA4835132 496922 coral metagenome Coral Mucus from Acropora hyacinthus sampled from Great Barrier Reef - Central Sector, Australia as sample E3.6.Acr.hyac.2F.20150105.m of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:41Z External Id SAMEA4835132 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:41Z INSDC status public Submitter Id E3.6.Acr.hyac.2.20150105.M abundance gbr common abundance world common barcodesequence TATGGTAAGG binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Mucus collected by Kathy Morrow collection date 2015 collection id Fork _20150105 collection time 10:00 collection_timestamp 1/5/15 10:00 coloniality colonial colony maximum diameter 300 colony maximum diameter unit cm colony_maximum_diameter 300 colony_maximum_diameter_universal 300 colony_maximum_gcmp_recorded 108 colony_name E3.6.Acr.hyac.2.20150105 compartment_replicates 1 complex_robust complex concatenated_date 20150105 contact_description Rubble on reef flat corallite width maximum 1.1 corallite width maximum unit mm corallite width minimum 0.4 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 2 date 1/5/15 depth 2.5 depth lower 20 depth lower unit m depth upper 5 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -104.3007769 env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E3 family Acroporidae field_host_genus_id Acropora field_host_name Acropora hyacinthus field_host_species_id hyacinthus full_location Indo-Pacific;Pacific;Coral Sea;Australia;E;Great Barrier Reef - Central Sector;Fork full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_VI_Acropora_hyacinthus functional_group_sensu_darling Competitive genus fossil age 55.8 genus fossil age unit mya geographic area E geographic location (country and/or sea) Australia geographic location (latitude) -18.611 geographic location (longitude) 147.57515 growth form typical tables_or_plates growth outline type determinate hemisphere Southern host species hyacinthus host_clade_sensu_fukami VI host_clade_sensu_fukami_numeric 6 host_genus Acropora host_genus_id Acropora host_name Acropora hyacinthus host_species_id hyacinthus huang_roy_tree_name ACR_Acropora_hyacinthus iucn red list category NT latitude -18.611 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 2_M local_sample_id GC_6_Acr_hyac_2F_20150105_m longitude 147.57515 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 38.84118034 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 484 oocyte size at maturity unit um outgroup n oz_disease_mean 1.578324463 oz_disease_sd 0.456565414 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.18 prop_colony_maximum_diameter_universal 0.18 prop_colony_maximum_gcmp_recorded 0.5 range size 110136269.9 range size unit km^2 reef_name Fork reef_type Outer Shelf reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.6.Acr.hyac.2.20150105.M sample type Coral Mucus sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock607_002_M sexual system hermaphrodite shelf_location offshore site name Great Barrier Reef - Central Sector skeletal density 1.28 skeletal density unit g cm-3 southern-most range edge -35.55462518 species age phylogeny 0.588742379 species age phylogeny unit mya substrate Rubble on reef flat. substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 55974 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_VI taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Acroporidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 28 tissue compartment M water clarity preference clear wave exposure preference exposed western-most range edge 25.4743655 zooxanthellate zooxanthellate ERS2655003 SAMEA4835133 496922 coral metagenome Coral Skeleton from Acropora hyacinthus sampled from Great Barrier Reef - Central Sector, Australia as sample E3.6.Acr.hyac.3F.20150105.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:41Z External Id SAMEA4835133 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:41Z INSDC status public Submitter Id E3.6.Acr.hyac.3.20150105.S abundance gbr common abundance world common barcodesequence TGGTGCTGGA binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Skeleton collected by Kathy Morrow collection date 2015 collection id Fork _20150105 collection time 10:00 collection_timestamp 1/5/15 10:00 coloniality colonial colony maximum diameter 300 colony maximum diameter unit cm colony_maximum_diameter 300 colony_maximum_diameter_universal 300 colony_maximum_gcmp_recorded 108 colony_name E3.6.Acr.hyac.3.20150105 compartment_replicates 1 complex_robust complex concatenated_date 20150105 contact_description Rubble on reef flat corallite width maximum 1.1 corallite width maximum unit mm corallite width minimum 0.4 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 1 daily_replicate 3 date 1/5/15 depth 2.5 depth lower 20 depth lower unit m depth upper 5 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -104.3007769 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E3 family Acroporidae field_host_genus_id Acropora field_host_name Acropora hyacinthus field_host_species_id hyacinthus full_location Indo-Pacific;Pacific;Coral Sea;Australia;E;Great Barrier Reef - Central Sector;Fork full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_VI_Acropora_hyacinthus functional_group_sensu_darling Competitive genus fossil age 55.8 genus fossil age unit mya geographic area E geographic location (country and/or sea) Australia geographic location (latitude) -18.611 geographic location (longitude) 147.57515 growth form typical tables_or_plates growth outline type determinate hemisphere Southern host species hyacinthus host_clade_sensu_fukami VI host_clade_sensu_fukami_numeric 6 host_genus Acropora host_genus_id Acropora host_name Acropora hyacinthus host_species_id hyacinthus huang_roy_tree_name ACR_Acropora_hyacinthus iucn red list category NT latitude -18.611 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 3_S local_sample_id GC_6_Acr_hyac_3F_20150105_S longitude 147.57515 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 38.84118034 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 484 oocyte size at maturity unit um outgroup n oz_disease_mean 1.578324463 oz_disease_sd 0.456565414 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.266666667 prop_colony_maximum_diameter_universal 0.266666667 prop_colony_maximum_gcmp_recorded 0.740740741 range size 110136269.9 range size unit km^2 reef_name Fork reef_type Outer Shelf reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.6.Acr.hyac.3.20150105.S sample type Coral Skeleton sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock608_003_S sexual system hermaphrodite shelf_location offshore site name Great Barrier Reef - Central Sector skeletal density 1.28 skeletal density unit g cm-3 southern-most range edge -35.55462518 species age phylogeny 0.588742379 species age phylogeny unit mya substrate Rubble on reef flat. substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 55974 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_VI taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Acroporidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 28 tissue compartment S water clarity preference clear wave exposure preference exposed western-most range edge 25.4743655 zooxanthellate zooxanthellate ERS2655004 SAMEA4835134 496922 coral metagenome Coral Tissue from Acropora hyacinthus sampled from Great Barrier Reef - Central Sector, Australia as sample E3.6.Acr.hyac.3F.20150105.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:41Z External Id SAMEA4835134 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:41Z INSDC status public Submitter Id E3.6.Acr.hyac.3.20150105.T abundance gbr common abundance world common barcodesequence CTTAGTTCGC binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Tissue collected by Kathy Morrow collection date 2015 collection id Fork _20150105 collection time 10:00 collection_timestamp 1/5/15 10:00 coloniality colonial colony maximum diameter 300 colony maximum diameter unit cm colony_maximum_diameter 300 colony_maximum_diameter_universal 300 colony_maximum_gcmp_recorded 108 colony_name E3.6.Acr.hyac.3.20150105 compartment_replicates 1 complex_robust complex concatenated_date 20150105 contact_description Rubble on reef flat corallite width maximum 1.1 corallite width maximum unit mm corallite width minimum 0.4 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 1 daily_replicate 3 date 1/5/15 depth 2.5 depth lower 20 depth lower unit m depth upper 5 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -104.3007769 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E3 family Acroporidae field_host_genus_id Acropora field_host_name Acropora hyacinthus field_host_species_id hyacinthus full_location Indo-Pacific;Pacific;Coral Sea;Australia;E;Great Barrier Reef - Central Sector;Fork full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_VI_Acropora_hyacinthus functional_group_sensu_darling Competitive genus fossil age 55.8 genus fossil age unit mya geographic area E geographic location (country and/or sea) Australia geographic location (latitude) -18.611 geographic location (longitude) 147.57515 growth form typical tables_or_plates growth outline type determinate hemisphere Southern host species hyacinthus host_clade_sensu_fukami VI host_clade_sensu_fukami_numeric 6 host_genus Acropora host_genus_id Acropora host_name Acropora hyacinthus host_species_id hyacinthus huang_roy_tree_name ACR_Acropora_hyacinthus iucn red list category NT latitude -18.611 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 3_T local_sample_id GC_6_Acr_hyac_3F_20150105_T longitude 147.57515 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 38.84118034 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 484 oocyte size at maturity unit um outgroup n oz_disease_mean 1.578324463 oz_disease_sd 0.456565414 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.266666667 prop_colony_maximum_diameter_universal 0.266666667 prop_colony_maximum_gcmp_recorded 0.740740741 range size 110136269.9 range size unit km^2 reef_name Fork reef_type Outer Shelf reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.6.Acr.hyac.3.20150105.T sample type Coral Tissue sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock609_003_T sexual system hermaphrodite shelf_location offshore site name Great Barrier Reef - Central Sector skeletal density 1.28 skeletal density unit g cm-3 southern-most range edge -35.55462518 species age phylogeny 0.588742379 species age phylogeny unit mya substrate Rubble on reef flat. substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 55974 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_VI taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Acroporidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 28 tissue compartment T water clarity preference clear wave exposure preference exposed western-most range edge 25.4743655 zooxanthellate zooxanthellate ERS2655005 SAMEA4835135 496922 coral metagenome Coral Tissue from Psammacora digitata sampled from Lizard Island, Australia as sample E1.11.Psa.digi.1.20140807.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:41Z External Id SAMEA4835135 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:41Z INSDC status public Submitter Id E1.11.Psa.digi.1.20140807.T abundance gbr uncommon abundance world common algal_contact_types turf__cyanobacteria__valonia barcodesequence GCACGTAGCT binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact y binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Tissue cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Trawler_20140807 collection time 10:00 collection_timestamp 8/7/14 10:00 coloniality colonial colony maximum diameter 6.5 colony maximum diameter unit cm colony_height_m 22 colony_maximum_diameter 6.5 colony_maximum_diameter_universal 25 colony_maximum_gcmp_recorded 25 colony_name E1.11.Psa.digi.1.20140807 colony_width1 25 colony_width2 20 compartment_replicates 1 complex_robust robust concatenated_date 20140807 corallite width maximum 2.3 corallite width maximum unit mm corallite width minimum 1.8 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 5 daily_replicate 1 date 8/7/14 depth 1.2192 depth lower 20 depth lower unit m depth upper 1 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -138.0568612 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E1 family Psammocoridae field_host_genus_id Psammocora field_host_name Psammocora digitata field_host_species_id digitata full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XI_Psammocora_digitata genus fossil age 37.2 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68344 geographic location (longitude) 145.46554 growth form typical columnar hemisphere Southern host species digitata host_clade_sensu_fukami XI host_clade_sensu_fukami_numeric 11 host_genus Psammocora host_genus_id Psammocora host_name Psammocora digitata host_species_id digitata huang_roy_tree_name SID_Psammocora_digitata iucn red list category NT latitude -14.68344 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Psammacora digitata_20140807 local_sample_id Pav Tis 140807 longitude 145.46554 macroalgal_contact_types Valonia n_algal_contacts 3 n_macroalgal_contacts 1 ncbi_inherited_blast_name stony corals northern-most range edge 31.13407822 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0 oz_disease_sd 0 par_method buoy parrotfish_bites n pcr primers 515F/806R photosynthetically_active_radiation 724.045 physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter 3.846153846 prop_colony_maximum_diameter_universal 1 prop_colony_maximum_gcmp_recorded 1 range size 73944384.08 range size unit km^2 reef_name Trawler reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.11.Psa.digi.1.20140807.T sample type Coral Tissue sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact y sequence_center_id Pollock61 sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -33.7834359 species age phylogeny 0.932787995 species age phylogeny unit mya substrate sediment substrate attachment attached symbio_its2_sequenced y target gene 16S target subfragment V4 taxon id 371655 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XI taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Psammocoridae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.9 tissue compartment T tissue_loss_percent 0 turf_contact_percent 5 visibility 15 visibility_method Horizontal Secchi Disk water clarity preference both wave exposure preference broad western-most range edge 37.1240953 zooxanthellate zooxanthellate ERS2655006 SAMEA4835136 496922 coral metagenome Coral Mucus from Acropora hyacinthus sampled from Great Barrier Reef - Central Sector, Australia as sample E3.6.Acr.hyac.3F.20150105.m of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:41Z External Id SAMEA4835136 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:41Z INSDC status public Submitter Id E3.6.Acr.hyac.3.20150105.M abundance gbr common abundance world common barcodesequence TCTGCCTATA binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Mucus collected by Kathy Morrow collection date 2015 collection id Fork _20150105 collection time 10:00 collection_timestamp 1/5/15 10:00 coloniality colonial colony maximum diameter 300 colony maximum diameter unit cm colony_maximum_diameter 300 colony_maximum_diameter_universal 300 colony_maximum_gcmp_recorded 108 colony_name E3.6.Acr.hyac.3.20150105 compartment_replicates 1 complex_robust complex concatenated_date 20150105 contact_description Rubble on reef flat corallite width maximum 1.1 corallite width maximum unit mm corallite width minimum 0.4 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 1 daily_replicate 3 date 1/5/15 depth 2.5 depth lower 20 depth lower unit m depth upper 5 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -104.3007769 env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E3 family Acroporidae field_host_genus_id Acropora field_host_name Acropora hyacinthus field_host_species_id hyacinthus full_location Indo-Pacific;Pacific;Coral Sea;Australia;E;Great Barrier Reef - Central Sector;Fork full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_VI_Acropora_hyacinthus functional_group_sensu_darling Competitive genus fossil age 55.8 genus fossil age unit mya geographic area E geographic location (country and/or sea) Australia geographic location (latitude) -18.611 geographic location (longitude) 147.57515 growth form typical tables_or_plates growth outline type determinate hemisphere Southern host species hyacinthus host_clade_sensu_fukami VI host_clade_sensu_fukami_numeric 6 host_genus Acropora host_genus_id Acropora host_name Acropora hyacinthus host_species_id hyacinthus huang_roy_tree_name ACR_Acropora_hyacinthus iucn red list category NT latitude -18.611 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 3_M local_sample_id GC_6_Acr_hyac_3F_20150105_m longitude 147.57515 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 38.84118034 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 484 oocyte size at maturity unit um outgroup n oz_disease_mean 1.578324463 oz_disease_sd 0.456565414 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.266666667 prop_colony_maximum_diameter_universal 0.266666667 prop_colony_maximum_gcmp_recorded 0.740740741 range size 110136269.9 range size unit km^2 reef_name Fork reef_type Outer Shelf reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.6.Acr.hyac.3.20150105.M sample type Coral Mucus sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock610_003_M sexual system hermaphrodite shelf_location offshore site name Great Barrier Reef - Central Sector skeletal density 1.28 skeletal density unit g cm-3 southern-most range edge -35.55462518 species age phylogeny 0.588742379 species age phylogeny unit mya substrate Rubble on reef flat. substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 55974 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_VI taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Acroporidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 28 tissue compartment M water clarity preference clear wave exposure preference exposed western-most range edge 25.4743655 zooxanthellate zooxanthellate ERS2655007 SAMEA4835137 496922 coral metagenome Coral Skeleton from Acropora hyacinthus sampled from Great Barrier Reef - Central Sector, Australia as sample E3.6.Acr.hyac.4F.20150105.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:41Z External Id SAMEA4835137 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:41Z INSDC status public Submitter Id E3.6.Acr.hyac.4.20150105.S abundance gbr common abundance world common barcodesequence GCCATGTCAT binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Skeleton collected by Kathy Morrow collection date 2015 collection id Fork _20150105 collection time 10:00 collection_timestamp 1/5/15 10:00 coloniality colonial colony maximum diameter 300 colony maximum diameter unit cm colony_maximum_diameter 300 colony_maximum_diameter_universal 300 colony_maximum_gcmp_recorded 108 colony_name E3.6.Acr.hyac.4.20150105 compartment_replicates 1 complex_robust complex concatenated_date 20150105 contact_description Rubble on reef flat corallite width maximum 1.1 corallite width maximum unit mm corallite width minimum 0.4 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 4 date 1/5/15 depth 2.5 depth lower 20 depth lower unit m depth upper 5 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -104.3007769 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E3 family Acroporidae field_host_genus_id Acropora field_host_name Acropora hyacinthus field_host_species_id hyacinthus full_location Indo-Pacific;Pacific;Coral Sea;Australia;E;Great Barrier Reef - Central Sector;Fork full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_VI_Acropora_hyacinthus functional_group_sensu_darling Competitive genus fossil age 55.8 genus fossil age unit mya geographic area E geographic location (country and/or sea) Australia geographic location (latitude) -18.611 geographic location (longitude) 147.57515 growth form typical tables_or_plates growth outline type determinate hemisphere Southern host species hyacinthus host_clade_sensu_fukami VI host_clade_sensu_fukami_numeric 6 host_genus Acropora host_genus_id Acropora host_name Acropora hyacinthus host_species_id hyacinthus huang_roy_tree_name ACR_Acropora_hyacinthus iucn red list category NT latitude -18.611 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 4_S local_sample_id GC_6_Acr_hyac_4F_20150105_S longitude 147.57515 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 38.84118034 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 484 oocyte size at maturity unit um outgroup n oz_disease_mean 1.578324463 oz_disease_sd 0.456565414 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.09 prop_colony_maximum_diameter_universal 0.09 prop_colony_maximum_gcmp_recorded 0.25 range size 110136269.9 range size unit km^2 reef_name Fork reef_type Outer Shelf reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.6.Acr.hyac.4.20150105.S sample type Coral Skeleton sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock611_004_S sexual system hermaphrodite shelf_location offshore site name Great Barrier Reef - Central Sector skeletal density 1.28 skeletal density unit g cm-3 southern-most range edge -35.55462518 species age phylogeny 0.588742379 species age phylogeny unit mya substrate Rubble on reef flat. substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 55974 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_VI taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Acroporidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 28 tissue compartment S water clarity preference clear wave exposure preference exposed western-most range edge 25.4743655 zooxanthellate zooxanthellate ERS2655008 SAMEA4835138 496922 coral metagenome Coral Tissue from Acropora hyacinthus sampled from Great Barrier Reef - Central Sector, Australia as sample E3.6.Acr.hyac.4F.20150105.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:41Z External Id SAMEA4835138 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:41Z INSDC status public Submitter Id E3.6.Acr.hyac.4.20150105.T abundance gbr common abundance world common barcodesequence CAGGTCACAT binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Tissue collected by Kathy Morrow collection date 2015 collection id Fork _20150105 collection time 10:00 collection_timestamp 1/5/15 10:00 coloniality colonial colony maximum diameter 300 colony maximum diameter unit cm colony_maximum_diameter 300 colony_maximum_diameter_universal 300 colony_maximum_gcmp_recorded 108 colony_name E3.6.Acr.hyac.4.20150105 compartment_replicates 1 complex_robust complex concatenated_date 20150105 contact_description Rubble on reef flat corallite width maximum 1.1 corallite width maximum unit mm corallite width minimum 0.4 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 4 date 1/5/15 depth 2.5 depth lower 20 depth lower unit m depth upper 5 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -104.3007769 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E3 family Acroporidae field_host_genus_id Acropora field_host_name Acropora hyacinthus field_host_species_id hyacinthus full_location Indo-Pacific;Pacific;Coral Sea;Australia;E;Great Barrier Reef - Central Sector;Fork full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_VI_Acropora_hyacinthus functional_group_sensu_darling Competitive genus fossil age 55.8 genus fossil age unit mya geographic area E geographic location (country and/or sea) Australia geographic location (latitude) -18.611 geographic location (longitude) 147.57515 growth form typical tables_or_plates growth outline type determinate hemisphere Southern host species hyacinthus host_clade_sensu_fukami VI host_clade_sensu_fukami_numeric 6 host_genus Acropora host_genus_id Acropora host_name Acropora hyacinthus host_species_id hyacinthus huang_roy_tree_name ACR_Acropora_hyacinthus iucn red list category NT latitude -18.611 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 4_T local_sample_id GC_6_Acr_hyac_4F_20150105_T longitude 147.57515 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 38.84118034 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 484 oocyte size at maturity unit um outgroup n oz_disease_mean 1.578324463 oz_disease_sd 0.456565414 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.09 prop_colony_maximum_diameter_universal 0.09 prop_colony_maximum_gcmp_recorded 0.25 range size 110136269.9 range size unit km^2 reef_name Fork reef_type Outer Shelf reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.6.Acr.hyac.4.20150105.T sample type Coral Tissue sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock612_004_T sexual system hermaphrodite shelf_location offshore site name Great Barrier Reef - Central Sector skeletal density 1.28 skeletal density unit g cm-3 southern-most range edge -35.55462518 species age phylogeny 0.588742379 species age phylogeny unit mya substrate Rubble on reef flat. substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 55974 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_VI taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Acroporidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 28 tissue compartment T water clarity preference clear wave exposure preference exposed western-most range edge 25.4743655 zooxanthellate zooxanthellate ERS2655009 SAMEA4835139 496922 coral metagenome Coral Tissue from Diploastrea heliopora sampled from Great Barrier Reef - Central Sector, Australia as sample E3.15.Dip.heli.3F.20150105.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:41Z External Id SAMEA4835139 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:41Z INSDC status public Submitter Id E3.15.Dip.heli.3.20150105.T abundance gbr common abundance world uncommon barcodesequence GATAAGAAGG binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Tissue collected by Kathy Morrow collection date 2015 collection id Fork _20150105 collection time 10:00 collection_timestamp 1/5/15 10:00 coloniality colonial colony maximum diameter 500 colony maximum diameter unit cm colony_maximum_diameter 500 colony_maximum_diameter_universal 1034 colony_maximum_gcmp_recorded 1034 colony_name E3.15.Dip.heli.3.20150105 compartment_replicates 1 complex_robust robust concatenated_date 20150105 contact_description Rubble corallite width maximum 9 corallite width maximum unit mm corallite width minimum 7 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 3 date 1/5/15 depth 6.5 depth lower 30 depth lower unit m depth upper 0 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -167.1916889 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E3 family Diploastreidae field_host_genus_id Diploastrea field_host_name Diploastrea heliopora field_host_species_id heliopora full_location Indo-Pacific;Pacific;Coral Sea;Australia;E;Great Barrier Reef - Central Sector;Fork full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XV_Diploastrea_heliopora functional_group_sensu_darling Stress-tolerant genus fossil age 99.6 genus fossil age unit mya geographic area E geographic location (country and/or sea) Australia geographic location (latitude) -18.611 geographic location (longitude) 147.57515 growth form typical massive hemisphere Southern host species heliopora host_clade_sensu_fukami XV host_clade_sensu_fukami_numeric 15 host_genus Diploastrea host_genus_id Diploastrea host_name Diploastrea heliopora host_species_id heliopora huang_roy_tree_name FAV_Diploastrea_heliopora iucn red list category NT latitude -18.611 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 7_T local_sample_id GC_15_Dip_heli_3F_20150105_T longitude 147.57515 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 30.8119151 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 290 oocyte size at maturity unit um outgroup n oz_disease_mean 0 oz_disease_sd 0 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.12 prop_colony_maximum_diameter_universal 0.058027079 prop_colony_maximum_gcmp_recorded 0.058027079 range size 70449346.41 range size unit km^2 reef_name Fork reef_type Outer Shelf reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.15.Dip.heli.3.20150105.T sample type Coral Tissue sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock613_007_T sexual system gonochore shelf_location offshore site name Great Barrier Reef - Central Sector southern-most range edge -30.63689894 species age phylogeny 64.52281751 species age phylogeny unit mya substrate Rubble. substrate attachment attached symbio_its2_sequenced n symbiodinium sp. in propagules no target gene 16S target subfragment V4 taxon id 214969 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XV taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Diploastreidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 28 tissue compartment T water clarity preference clear wave exposure preference broad western-most range edge 31.7583974 zooxanthellate zooxanthellate ERS2655010 SAMEA4835140 496922 coral metagenome Coral Mucus from Diploastrea heliopora sampled from Great Barrier Reef - Central Sector, Australia as sample E3.15.Dip.heli.1F.20150105.m of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:41Z External Id SAMEA4835140 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:41Z INSDC status public Submitter Id E3.15.Dip.heli.1.20150105.M abundance gbr common abundance world uncommon barcodesequence CCTGTGTAGA binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Mucus collected by Kathy Morrow collection date 2015 collection id Fork _20150105 collection time 10:00 collection_timestamp 1/5/15 10:00 coloniality colonial colony maximum diameter 500 colony maximum diameter unit cm colony_maximum_diameter 500 colony_maximum_diameter_universal 1034 colony_maximum_gcmp_recorded 1034 colony_name E3.15.Dip.heli.1.20150105 compartment_replicates 1 complex_robust robust concatenated_date 20150105 contact_description Rubble corallite width maximum 9 corallite width maximum unit mm corallite width minimum 7 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 1/5/15 depth 6.5 depth lower 30 depth lower unit m depth upper 0 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -167.1916889 env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E3 family Diploastreidae field_host_genus_id Diploastrea field_host_name Diploastrea heliopora field_host_species_id heliopora full_location Indo-Pacific;Pacific;Coral Sea;Australia;E;Great Barrier Reef - Central Sector;Fork full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XV_Diploastrea_heliopora functional_group_sensu_darling Stress-tolerant genus fossil age 99.6 genus fossil age unit mya geographic area E geographic location (country and/or sea) Australia geographic location (latitude) -18.611 geographic location (longitude) 147.57515 growth form typical massive hemisphere Southern host species heliopora host_clade_sensu_fukami XV host_clade_sensu_fukami_numeric 15 host_genus Diploastrea host_genus_id Diploastrea host_name Diploastrea heliopora host_species_id heliopora huang_roy_tree_name FAV_Diploastrea_heliopora iucn red list category NT latitude -18.611 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 5_M local_sample_id GC_15_Dip_heli_1F_20150105_m longitude 147.57515 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 30.8119151 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 290 oocyte size at maturity unit um outgroup n oz_disease_mean 0 oz_disease_sd 0 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.016 prop_colony_maximum_diameter_universal 0.007736944 prop_colony_maximum_gcmp_recorded 0.007736944 range size 70449346.41 range size unit km^2 reef_name Fork reef_type Outer Shelf reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.15.Dip.heli.1.20150105.M sample type Coral Mucus sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock614_005_M sexual system gonochore shelf_location offshore site name Great Barrier Reef - Central Sector southern-most range edge -30.63689894 species age phylogeny 64.52281751 species age phylogeny unit mya substrate Rubble. substrate attachment attached symbio_its2_sequenced n symbiodinium sp. in propagules no target gene 16S target subfragment V4 taxon id 214969 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XV taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Diploastreidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 28 tissue compartment M water clarity preference clear wave exposure preference broad western-most range edge 31.7583974 zooxanthellate zooxanthellate ERS2655011 SAMEA4835141 496922 coral metagenome Coral Skeleton from Diploastrea heliopora sampled from Great Barrier Reef - Central Sector, Australia as sample E3.15.Dip.heli.2F.20150105.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:41Z External Id SAMEA4835141 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:41Z INSDC status public Submitter Id E3.15.Dip.heli.2.20150105.S abundance gbr common abundance world uncommon barcodesequence TTGTCCTTGC binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Skeleton collected by Kathy Morrow collection date 2015 collection id Fork _20150105 collection time 10:00 collection_timestamp 1/5/15 10:00 coloniality colonial colony maximum diameter 500 colony maximum diameter unit cm colony_maximum_diameter 500 colony_maximum_diameter_universal 1034 colony_maximum_gcmp_recorded 1034 colony_name E3.15.Dip.heli.2.20150105 compartment_replicates 1 complex_robust robust concatenated_date 20150105 contact_description Rubble corallite width maximum 9 corallite width maximum unit mm corallite width minimum 7 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 2 date 1/5/15 depth 6.5 depth lower 30 depth lower unit m depth upper 0 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -167.1916889 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E3 family Diploastreidae field_host_genus_id Diploastrea field_host_name Diploastrea heliopora field_host_species_id heliopora full_location Indo-Pacific;Pacific;Coral Sea;Australia;E;Great Barrier Reef - Central Sector;Fork full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XV_Diploastrea_heliopora functional_group_sensu_darling Stress-tolerant genus fossil age 99.6 genus fossil age unit mya geographic area E geographic location (country and/or sea) Australia geographic location (latitude) -18.611 geographic location (longitude) 147.57515 growth form typical massive hemisphere Southern host species heliopora host_clade_sensu_fukami XV host_clade_sensu_fukami_numeric 15 host_genus Diploastrea host_genus_id Diploastrea host_name Diploastrea heliopora host_species_id heliopora huang_roy_tree_name FAV_Diploastrea_heliopora iucn red list category NT latitude -18.611 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 6_S local_sample_id GC_15_Dip_heli_2F_20150105_S longitude 147.57515 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 30.8119151 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 290 oocyte size at maturity unit um outgroup n oz_disease_mean 0 oz_disease_sd 0 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.018 prop_colony_maximum_diameter_universal 0.008704062 prop_colony_maximum_gcmp_recorded 0.008704062 range size 70449346.41 range size unit km^2 reef_name Fork reef_type Outer Shelf reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.15.Dip.heli.2.20150105.S sample type Coral Skeleton sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock615_006_S sexual system gonochore shelf_location offshore site name Great Barrier Reef - Central Sector southern-most range edge -30.63689894 species age phylogeny 64.52281751 species age phylogeny unit mya substrate Rubble. substrate attachment attached symbio_its2_sequenced n symbiodinium sp. in propagules no target gene 16S target subfragment V4 taxon id 214969 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XV taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Diploastreidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 28 tissue compartment S water clarity preference clear wave exposure preference broad western-most range edge 31.7583974 zooxanthellate zooxanthellate ERS2655012 SAMEA4835142 496922 coral metagenome Coral Skeleton from Diploastrea heliopora sampled from Great Barrier Reef - Central Sector, Australia as sample E3.15.Dip.heli.3F.20150105.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:42Z External Id SAMEA4835142 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:42Z INSDC status public Submitter Id E3.15.Dip.heli.3.20150105.S abundance gbr common abundance world uncommon barcodesequence TTCTGTTGCC binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Skeleton collected by Kathy Morrow collection date 2015 collection id Fork _20150105 collection time 10:00 collection_timestamp 1/5/15 10:00 coloniality colonial colony maximum diameter 500 colony maximum diameter unit cm colony_maximum_diameter 500 colony_maximum_diameter_universal 1034 colony_maximum_gcmp_recorded 1034 colony_name E3.15.Dip.heli.3.20150105 compartment_replicates 1 complex_robust robust concatenated_date 20150105 contact_description Rubble corallite width maximum 9 corallite width maximum unit mm corallite width minimum 7 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 3 date 1/5/15 depth 6.5 depth lower 30 depth lower unit m depth upper 0 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -167.1916889 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E3 family Diploastreidae field_host_genus_id Diploastrea field_host_name Diploastrea heliopora field_host_species_id heliopora full_location Indo-Pacific;Pacific;Coral Sea;Australia;E;Great Barrier Reef - Central Sector;Fork full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XV_Diploastrea_heliopora functional_group_sensu_darling Stress-tolerant genus fossil age 99.6 genus fossil age unit mya geographic area E geographic location (country and/or sea) Australia geographic location (latitude) -18.611 geographic location (longitude) 147.57515 growth form typical massive hemisphere Southern host species heliopora host_clade_sensu_fukami XV host_clade_sensu_fukami_numeric 15 host_genus Diploastrea host_genus_id Diploastrea host_name Diploastrea heliopora host_species_id heliopora huang_roy_tree_name FAV_Diploastrea_heliopora iucn red list category NT latitude -18.611 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 7_S local_sample_id GC_15_Dip_heli_3F_20150105_S longitude 147.57515 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 30.8119151 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 290 oocyte size at maturity unit um outgroup n oz_disease_mean 0 oz_disease_sd 0 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.12 prop_colony_maximum_diameter_universal 0.058027079 prop_colony_maximum_gcmp_recorded 0.058027079 range size 70449346.41 range size unit km^2 reef_name Fork reef_type Outer Shelf reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.15.Dip.heli.3.20150105.S sample type Coral Skeleton sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock616_007_S sexual system gonochore shelf_location offshore site name Great Barrier Reef - Central Sector southern-most range edge -30.63689894 species age phylogeny 64.52281751 species age phylogeny unit mya substrate Rubble. substrate attachment attached symbio_its2_sequenced n symbiodinium sp. in propagules no target gene 16S target subfragment V4 taxon id 214969 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XV taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Diploastreidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 28 tissue compartment S water clarity preference clear wave exposure preference broad western-most range edge 31.7583974 zooxanthellate zooxanthellate ERS2655013 SAMEA4835143 496922 coral metagenome Coral Mucus from Diploastrea heliopora sampled from Great Barrier Reef - Central Sector, Australia as sample E3.15.Dip.heli.3F.20150105.m of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:42Z External Id SAMEA4835143 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:42Z INSDC status public Submitter Id E3.15.Dip.heli.3.20150105.M abundance gbr common abundance world uncommon barcodesequence GTAGAAGTGG binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Mucus collected by Kathy Morrow collection date 2015 collection id Fork _20150105 collection time 10:00 collection_timestamp 1/5/15 10:00 coloniality colonial colony maximum diameter 500 colony maximum diameter unit cm colony_maximum_diameter 500 colony_maximum_diameter_universal 1034 colony_maximum_gcmp_recorded 1034 colony_name E3.15.Dip.heli.3.20150105 compartment_replicates 1 complex_robust robust concatenated_date 20150105 contact_description Rubble corallite width maximum 9 corallite width maximum unit mm corallite width minimum 7 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 3 date 1/5/15 depth 6.5 depth lower 30 depth lower unit m depth upper 0 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -167.1916889 env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E3 family Diploastreidae field_host_genus_id Diploastrea field_host_name Diploastrea heliopora field_host_species_id heliopora full_location Indo-Pacific;Pacific;Coral Sea;Australia;E;Great Barrier Reef - Central Sector;Fork full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XV_Diploastrea_heliopora functional_group_sensu_darling Stress-tolerant genus fossil age 99.6 genus fossil age unit mya geographic area E geographic location (country and/or sea) Australia geographic location (latitude) -18.611 geographic location (longitude) 147.57515 growth form typical massive hemisphere Southern host species heliopora host_clade_sensu_fukami XV host_clade_sensu_fukami_numeric 15 host_genus Diploastrea host_genus_id Diploastrea host_name Diploastrea heliopora host_species_id heliopora huang_roy_tree_name FAV_Diploastrea_heliopora iucn red list category NT latitude -18.611 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 7_M local_sample_id GC_15_Dip_heli_3F_20150105_m longitude 147.57515 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 30.8119151 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 290 oocyte size at maturity unit um outgroup n oz_disease_mean 0 oz_disease_sd 0 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.12 prop_colony_maximum_diameter_universal 0.058027079 prop_colony_maximum_gcmp_recorded 0.058027079 range size 70449346.41 range size unit km^2 reef_name Fork reef_type Outer Shelf reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.15.Dip.heli.3.20150105.M sample type Coral Mucus sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock617_007_M sexual system gonochore shelf_location offshore site name Great Barrier Reef - Central Sector southern-most range edge -30.63689894 species age phylogeny 64.52281751 species age phylogeny unit mya substrate Rubble. substrate attachment attached symbio_its2_sequenced n symbiodinium sp. in propagules no target gene 16S target subfragment V4 taxon id 214969 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XV taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Diploastreidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 28 tissue compartment M water clarity preference clear wave exposure preference broad western-most range edge 31.7583974 zooxanthellate zooxanthellate ERS2655014 SAMEA4835144 496922 coral metagenome Coral Skeleton from Diploastrea heliopora sampled from Great Barrier Reef - Central Sector, Australia as sample E3.15.Dip.heli.4F.20150105.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:42Z External Id SAMEA4835144 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:42Z INSDC status public Submitter Id E3.15.Dip.heli.4.20150105.S abundance gbr common abundance world uncommon barcodesequence GTGGAGAGCT binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Skeleton collected by Kathy Morrow collection date 2015 collection id Fork _20150105 collection time 10:00 collection_timestamp 1/5/15 10:00 coloniality colonial colony maximum diameter 500 colony maximum diameter unit cm colony_maximum_diameter 500 colony_maximum_diameter_universal 1034 colony_maximum_gcmp_recorded 1034 colony_name E3.15.Dip.heli.4.20150105 compartment_replicates 1 complex_robust robust concatenated_date 20150105 contact_description Rubble corallite width maximum 9 corallite width maximum unit mm corallite width minimum 7 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 4 date 1/5/15 depth 6.5 depth lower 30 depth lower unit m depth upper 0 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -167.1916889 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E3 family Diploastreidae field_host_genus_id Diploastrea field_host_name Diploastrea heliopora field_host_species_id heliopora full_location Indo-Pacific;Pacific;Coral Sea;Australia;E;Great Barrier Reef - Central Sector;Fork full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XV_Diploastrea_heliopora functional_group_sensu_darling Stress-tolerant genus fossil age 99.6 genus fossil age unit mya geographic area E geographic location (country and/or sea) Australia geographic location (latitude) -18.611 geographic location (longitude) 147.57515 growth form typical massive hemisphere Southern host species heliopora host_clade_sensu_fukami XV host_clade_sensu_fukami_numeric 15 host_genus Diploastrea host_genus_id Diploastrea host_name Diploastrea heliopora host_species_id heliopora huang_roy_tree_name FAV_Diploastrea_heliopora iucn red list category NT latitude -18.611 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 8_S local_sample_id GC_15_Dip_heli_4F_20150105_S longitude 147.57515 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 30.8119151 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 290 oocyte size at maturity unit um outgroup n oz_disease_mean 0 oz_disease_sd 0 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.029 prop_colony_maximum_diameter_universal 0.014023211 prop_colony_maximum_gcmp_recorded 0.014023211 range size 70449346.41 range size unit km^2 reef_name Fork reef_type Outer Shelf reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.15.Dip.heli.4.20150105.S sample type Coral Skeleton sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock618_008_S sexual system gonochore shelf_location offshore site name Great Barrier Reef - Central Sector southern-most range edge -30.63689894 species age phylogeny 64.52281751 species age phylogeny unit mya substrate Rubble. substrate attachment attached symbio_its2_sequenced n symbiodinium sp. in propagules no target gene 16S target subfragment V4 taxon id 214969 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XV taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Diploastreidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 28 tissue compartment S water clarity preference clear wave exposure preference broad western-most range edge 31.7583974 zooxanthellate zooxanthellate ERS2655015 SAMEA4835145 496922 coral metagenome Coral Mucus from Diploastrea heliopora sampled from Great Barrier Reef - Central Sector, Australia as sample E3.15.Dip.heli.4F.20150105.m of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:42Z External Id SAMEA4835145 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:42Z INSDC status public Submitter Id E3.15.Dip.heli.4.20150105.M abundance gbr common abundance world uncommon barcodesequence TCATTCAGTG binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Mucus collected by Kathy Morrow collection date 2015 collection id Fork _20150105 collection time 10:00 collection_timestamp 1/5/15 10:00 coloniality colonial colony maximum diameter 500 colony maximum diameter unit cm colony_maximum_diameter 500 colony_maximum_diameter_universal 1034 colony_maximum_gcmp_recorded 1034 colony_name E3.15.Dip.heli.4.20150105 compartment_replicates 1 complex_robust robust concatenated_date 20150105 contact_description Rubble corallite width maximum 9 corallite width maximum unit mm corallite width minimum 7 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 4 date 1/5/15 depth 6.5 depth lower 30 depth lower unit m depth upper 0 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -167.1916889 env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E3 family Diploastreidae field_host_genus_id Diploastrea field_host_name Diploastrea heliopora field_host_species_id heliopora full_location Indo-Pacific;Pacific;Coral Sea;Australia;E;Great Barrier Reef - Central Sector;Fork full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XV_Diploastrea_heliopora functional_group_sensu_darling Stress-tolerant genus fossil age 99.6 genus fossil age unit mya geographic area E geographic location (country and/or sea) Australia geographic location (latitude) -18.611 geographic location (longitude) 147.57515 growth form typical massive hemisphere Southern host species heliopora host_clade_sensu_fukami XV host_clade_sensu_fukami_numeric 15 host_genus Diploastrea host_genus_id Diploastrea host_name Diploastrea heliopora host_species_id heliopora huang_roy_tree_name FAV_Diploastrea_heliopora iucn red list category NT latitude -18.611 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 8_M local_sample_id GC_15_Dip_heli_4F_20150105_m longitude 147.57515 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 30.8119151 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 290 oocyte size at maturity unit um outgroup n oz_disease_mean 0 oz_disease_sd 0 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.029 prop_colony_maximum_diameter_universal 0.014023211 prop_colony_maximum_gcmp_recorded 0.014023211 range size 70449346.41 range size unit km^2 reef_name Fork reef_type Outer Shelf reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.15.Dip.heli.4.20150105.M sample type Coral Mucus sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock619_008_M sexual system gonochore shelf_location offshore site name Great Barrier Reef - Central Sector southern-most range edge -30.63689894 species age phylogeny 64.52281751 species age phylogeny unit mya substrate Rubble. substrate attachment attached symbio_its2_sequenced n symbiodinium sp. in propagules no target gene 16S target subfragment V4 taxon id 214969 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XV taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Diploastreidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 28 tissue compartment M water clarity preference clear wave exposure preference broad western-most range edge 31.7583974 zooxanthellate zooxanthellate ERS2655016 SAMEA4835146 496922 coral metagenome Coral Skeleton from Psammacora digitata sampled from Lizard Island, Australia as sample E1.11.Psa.digi.1.20140807.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:42Z External Id SAMEA4835146 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:42Z INSDC status public Submitter Id E1.11.Psa.digi.1.20140807.S abundance gbr uncommon abundance world common algal_contact_types turf__cyanobacteria__valonia barcodesequence GACTGTACGT binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact y binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Skeleton cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Trawler_20140807 collection time 10:00 collection_timestamp 8/7/14 10:00 coloniality colonial colony maximum diameter 6.5 colony maximum diameter unit cm colony_height_m 22 colony_maximum_diameter 6.5 colony_maximum_diameter_universal 25 colony_maximum_gcmp_recorded 25 colony_name E1.11.Psa.digi.1.20140807 colony_width1 25 colony_width2 20 compartment_replicates 1 complex_robust robust concatenated_date 20140807 corallite width maximum 2.3 corallite width maximum unit mm corallite width minimum 1.8 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 5 daily_replicate 1 date 8/7/14 depth 1.2192 depth lower 20 depth lower unit m depth upper 1 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -138.0568612 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E1 family Psammocoridae field_host_genus_id Psammocora field_host_name Psammocora digitata field_host_species_id digitata full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XI_Psammocora_digitata genus fossil age 37.2 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68344 geographic location (longitude) 145.46554 growth form typical columnar hemisphere Southern host species digitata host_clade_sensu_fukami XI host_clade_sensu_fukami_numeric 11 host_genus Psammocora host_genus_id Psammocora host_name Psammocora digitata host_species_id digitata huang_roy_tree_name SID_Psammocora_digitata iucn red list category NT latitude -14.68344 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Psammacora digitata_20140807 local_sample_id Pav Ske 140807 longitude 145.46554 macroalgal_contact_types Valonia n_algal_contacts 3 n_macroalgal_contacts 1 ncbi_inherited_blast_name stony corals northern-most range edge 31.13407822 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0 oz_disease_sd 0 par_method buoy parrotfish_bites n pcr primers 515F/806R photosynthetically_active_radiation 724.045 physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter 3.846153846 prop_colony_maximum_diameter_universal 1 prop_colony_maximum_gcmp_recorded 1 range size 73944384.08 range size unit km^2 reef_name Trawler reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.11.Psa.digi.1.20140807.S sample type Coral Skeleton sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact y sequence_center_id Pollock62 sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -33.7834359 species age phylogeny 0.932787995 species age phylogeny unit mya substrate sediment substrate attachment attached symbio_its2_sequenced y target gene 16S target subfragment V4 taxon id 371655 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XI taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Psammocoridae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.9 tissue compartment S tissue_loss_percent 0 turf_contact_percent 5 visibility 15 visibility_method Horizontal Secchi Disk water clarity preference both wave exposure preference broad western-most range edge 37.1240953 zooxanthellate zooxanthellate ERS2655017 SAMEA4835147 496922 coral metagenome Coral Skeleton from Acropora hyacinthus sampled from Great Barrier Reef - Central Sector, Australia as sample E3.6.Acr.hyac.1K.20150105.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:42Z External Id SAMEA4835147 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:42Z INSDC status public Submitter Id E3.6.Acr.hyac.1.20150106.S abundance gbr common abundance world common barcodesequence TGTTCGATAG binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Skeleton collected by Kathy Morrow collection date 2015 collection id Kelso _20150106 collection time 12:30 collection_timestamp 1/6/15 12:30 coloniality colonial colony maximum diameter 300 colony maximum diameter unit cm colony_maximum_diameter 300 colony_maximum_diameter_universal 300 colony_maximum_gcmp_recorded 108 colony_name E3.6.Acr.hyac.1.20150106 compartment_replicates 1 complex_robust complex concatenated_date 20150106 contact_description Rubble on reef flat corallite width maximum 1.1 corallite width maximum unit mm corallite width minimum 0.4 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 1/6/15 depth 3 depth lower 20 depth lower unit m depth upper 5 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -104.3007769 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E3 family Acroporidae field_host_genus_id Acropora field_host_name Acropora hyacinthus field_host_species_id hyacinthus full_location Indo-Pacific;Pacific;Coral Sea;Australia;E;Great Barrier Reef - Central Sector;Kelso full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_VI_Acropora_hyacinthus functional_group_sensu_darling Competitive genus fossil age 55.8 genus fossil age unit mya geographic area E geographic location (country and/or sea) Australia geographic location (latitude) -18.42385 geographic location (longitude) 146.985867 growth form typical tables_or_plates growth outline type determinate hemisphere Southern host species hyacinthus host_clade_sensu_fukami VI host_clade_sensu_fukami_numeric 6 host_genus Acropora host_genus_id Acropora host_name Acropora hyacinthus host_species_id hyacinthus huang_roy_tree_name ACR_Acropora_hyacinthus iucn red list category NT latitude -18.42385 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 9_S local_sample_id GC_6_Acr_hyac_1K_20150105_S longitude 146.985867 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 38.84118034 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 484 oocyte size at maturity unit um outgroup n oz_disease_mean 1.578324463 oz_disease_sd 0.456565414 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.146666667 prop_colony_maximum_diameter_universal 0.146666667 prop_colony_maximum_gcmp_recorded 0.407407407 range size 110136269.9 range size unit km^2 reef_name Kelso reef_type Mid Shelf reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.6.Acr.hyac.1.20150106.S sample type Coral Skeleton sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock620_009_S sexual system hermaphrodite shelf_location midshelf site name Great Barrier Reef - Central Sector skeletal density 1.28 skeletal density unit g cm-3 southern-most range edge -35.55462518 species age phylogeny 0.588742379 species age phylogeny unit mya substrate Rubble on reef flat. substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 55974 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_VI taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Acroporidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 28 tissue compartment S water clarity preference clear wave exposure preference exposed western-most range edge 25.4743655 zooxanthellate zooxanthellate ERS2655018 SAMEA4835148 496922 coral metagenome Coral Tissue from Acropora hyacinthus sampled from Great Barrier Reef - Central Sector, Australia as sample E3.6.Acr.hyac.1K.20150105.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:42Z External Id SAMEA4835148 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:42Z INSDC status public Submitter Id E3.6.Acr.hyac.1.20150106.T abundance gbr common abundance world common barcodesequence GTGGCTTCGT binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Tissue collected by Kathy Morrow collection date 2015 collection id Kelso _20150106 collection time 12:30 collection_timestamp 1/6/15 12:30 coloniality colonial colony maximum diameter 300 colony maximum diameter unit cm colony_maximum_diameter 300 colony_maximum_diameter_universal 300 colony_maximum_gcmp_recorded 108 colony_name E3.6.Acr.hyac.1.20150106 compartment_replicates 1 complex_robust complex concatenated_date 20150106 contact_description Rubble on reef flat corallite width maximum 1.1 corallite width maximum unit mm corallite width minimum 0.4 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 1/6/15 depth 3 depth lower 20 depth lower unit m depth upper 5 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -104.3007769 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E3 family Acroporidae field_host_genus_id Acropora field_host_name Acropora hyacinthus field_host_species_id hyacinthus full_location Indo-Pacific;Pacific;Coral Sea;Australia;E;Great Barrier Reef - Central Sector;Kelso full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_VI_Acropora_hyacinthus functional_group_sensu_darling Competitive genus fossil age 55.8 genus fossil age unit mya geographic area E geographic location (country and/or sea) Australia geographic location (latitude) -18.42385 geographic location (longitude) 146.985867 growth form typical tables_or_plates growth outline type determinate hemisphere Southern host species hyacinthus host_clade_sensu_fukami VI host_clade_sensu_fukami_numeric 6 host_genus Acropora host_genus_id Acropora host_name Acropora hyacinthus host_species_id hyacinthus huang_roy_tree_name ACR_Acropora_hyacinthus iucn red list category NT latitude -18.42385 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 9_T local_sample_id GC_6_Acr_hyac_1K_20150105_T longitude 146.985867 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 38.84118034 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 484 oocyte size at maturity unit um outgroup n oz_disease_mean 1.578324463 oz_disease_sd 0.456565414 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.146666667 prop_colony_maximum_diameter_universal 0.146666667 prop_colony_maximum_gcmp_recorded 0.407407407 range size 110136269.9 range size unit km^2 reef_name Kelso reef_type Mid Shelf reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.6.Acr.hyac.1.20150106.T sample type Coral Tissue sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock621_009_T sexual system hermaphrodite shelf_location midshelf site name Great Barrier Reef - Central Sector skeletal density 1.28 skeletal density unit g cm-3 southern-most range edge -35.55462518 species age phylogeny 0.588742379 species age phylogeny unit mya substrate Rubble on reef flat. substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 55974 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_VI taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Acroporidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 28 tissue compartment T water clarity preference clear wave exposure preference exposed western-most range edge 25.4743655 zooxanthellate zooxanthellate ERS2655019 SAMEA4835149 496922 coral metagenome Coral Mucus from Acropora hyacinthus sampled from Great Barrier Reef - Central Sector, Australia as sample E3.6.Acr.hyac.1K.20150105.m of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:42Z External Id SAMEA4835149 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:42Z INSDC status public Submitter Id E3.6.Acr.hyac.1.20150106.M abundance gbr common abundance world common barcodesequence TCTTGTTCAC binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Mucus collected by Kathy Morrow collection date 2015 collection id Kelso _20150106 collection time 12:30 collection_timestamp 1/6/15 12:30 coloniality colonial colony maximum diameter 300 colony maximum diameter unit cm colony_maximum_diameter 300 colony_maximum_diameter_universal 300 colony_maximum_gcmp_recorded 108 colony_name E3.6.Acr.hyac.1.20150106 compartment_replicates 1 complex_robust complex concatenated_date 20150106 contact_description Rubble on reef flat corallite width maximum 1.1 corallite width maximum unit mm corallite width minimum 0.4 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 1/6/15 depth 3 depth lower 20 depth lower unit m depth upper 5 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -104.3007769 env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E3 family Acroporidae field_host_genus_id Acropora field_host_name Acropora hyacinthus field_host_species_id hyacinthus full_location Indo-Pacific;Pacific;Coral Sea;Australia;E;Great Barrier Reef - Central Sector;Kelso full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_VI_Acropora_hyacinthus functional_group_sensu_darling Competitive genus fossil age 55.8 genus fossil age unit mya geographic area E geographic location (country and/or sea) Australia geographic location (latitude) -18.42385 geographic location (longitude) 146.985867 growth form typical tables_or_plates growth outline type determinate hemisphere Southern host species hyacinthus host_clade_sensu_fukami VI host_clade_sensu_fukami_numeric 6 host_genus Acropora host_genus_id Acropora host_name Acropora hyacinthus host_species_id hyacinthus huang_roy_tree_name ACR_Acropora_hyacinthus iucn red list category NT latitude -18.42385 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 9_M local_sample_id GC_6_Acr_hyac_1K_20150105_m longitude 146.985867 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 38.84118034 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 484 oocyte size at maturity unit um outgroup n oz_disease_mean 1.578324463 oz_disease_sd 0.456565414 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.146666667 prop_colony_maximum_diameter_universal 0.146666667 prop_colony_maximum_gcmp_recorded 0.407407407 range size 110136269.9 range size unit km^2 reef_name Kelso reef_type Mid Shelf reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.6.Acr.hyac.1.20150106.M sample type Coral Mucus sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock622_009_M sexual system hermaphrodite shelf_location midshelf site name Great Barrier Reef - Central Sector skeletal density 1.28 skeletal density unit g cm-3 southern-most range edge -35.55462518 species age phylogeny 0.588742379 species age phylogeny unit mya substrate Rubble on reef flat. substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 55974 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_VI taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Acroporidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 28 tissue compartment M water clarity preference clear wave exposure preference exposed western-most range edge 25.4743655 zooxanthellate zooxanthellate ERS2655020 SAMEA4835150 496922 coral metagenome Coral Skeleton from Acropora hyacinthus sampled from Great Barrier Reef - Central Sector, Australia as sample E3.6.Acr.hyac.3K.20150105.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:42Z External Id SAMEA4835150 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:42Z INSDC status public Submitter Id E3.6.Acr.hyac.2.20150106.S abundance gbr common abundance world common barcodesequence TTGCTTAGTC binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Skeleton collected by Kathy Morrow collection date 2015 collection id Kelso _20150106 collection time 12:30 collection_timestamp 1/6/15 12:30 coloniality colonial colony maximum diameter 300 colony maximum diameter unit cm colony_maximum_diameter 300 colony_maximum_diameter_universal 300 colony_maximum_gcmp_recorded 108 colony_name E3.6.Acr.hyac.2.20150106 compartment_replicates 1 complex_robust complex concatenated_date 20150106 contact_description Rubble on reef flat corallite width maximum 1.1 corallite width maximum unit mm corallite width minimum 0.4 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 2 date 1/6/15 depth 3 depth lower 20 depth lower unit m depth upper 5 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -104.3007769 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E3 family Acroporidae field_host_genus_id Acropora field_host_name Acropora hyacinthus field_host_species_id hyacinthus full_location Indo-Pacific;Pacific;Coral Sea;Australia;E;Great Barrier Reef - Central Sector;Kelso full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_VI_Acropora_hyacinthus functional_group_sensu_darling Competitive genus fossil age 55.8 genus fossil age unit mya geographic area E geographic location (country and/or sea) Australia geographic location (latitude) -18.42385 geographic location (longitude) 146.985867 growth form typical tables_or_plates growth outline type determinate hemisphere Southern host species hyacinthus host_clade_sensu_fukami VI host_clade_sensu_fukami_numeric 6 host_genus Acropora host_genus_id Acropora host_name Acropora hyacinthus host_species_id hyacinthus huang_roy_tree_name ACR_Acropora_hyacinthus iucn red list category NT latitude -18.42385 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 10_S local_sample_id GC_6_Acr_hyac_3K_20150105_S longitude 146.985867 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 38.84118034 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 484 oocyte size at maturity unit um outgroup n oz_disease_mean 1.578324463 oz_disease_sd 0.456565414 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.283333333 prop_colony_maximum_diameter_universal 0.283333333 prop_colony_maximum_gcmp_recorded 0.787037037 range size 110136269.9 range size unit km^2 reef_name Kelso reef_type Mid Shelf reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.6.Acr.hyac.2.20150106.S sample type Coral Skeleton sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock623_010_S sexual system hermaphrodite shelf_location midshelf site name Great Barrier Reef - Central Sector skeletal density 1.28 skeletal density unit g cm-3 southern-most range edge -35.55462518 species age phylogeny 0.588742379 species age phylogeny unit mya substrate Rubble on reef flat. substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 55974 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_VI taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Acroporidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 28 tissue compartment S water clarity preference clear wave exposure preference exposed western-most range edge 25.4743655 zooxanthellate zooxanthellate ERS2655021 SAMEA4835151 496922 coral metagenome Coral Tissue from Acropora hyacinthus sampled from Great Barrier Reef - Central Sector, Australia as sample E3.6.Acr.hyac.3K.20150105.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:42Z External Id SAMEA4835151 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:42Z INSDC status public Submitter Id E3.6.Acr.hyac.2.20150106.T abundance gbr common abundance world common barcodesequence CGTAATGAGC binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Tissue collected by Kathy Morrow collection date 2015 collection id Kelso _20150106 collection time 12:30 collection_timestamp 1/6/15 12:30 coloniality colonial colony maximum diameter 300 colony maximum diameter unit cm colony_maximum_diameter 300 colony_maximum_diameter_universal 300 colony_maximum_gcmp_recorded 108 colony_name E3.6.Acr.hyac.2.20150106 compartment_replicates 1 complex_robust complex concatenated_date 20150106 contact_description Rubble on reef flat corallite width maximum 1.1 corallite width maximum unit mm corallite width minimum 0.4 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 2 date 1/6/15 depth 3 depth lower 20 depth lower unit m depth upper 5 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -104.3007769 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E3 family Acroporidae field_host_genus_id Acropora field_host_name Acropora hyacinthus field_host_species_id hyacinthus full_location Indo-Pacific;Pacific;Coral Sea;Australia;E;Great Barrier Reef - Central Sector;Kelso full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_VI_Acropora_hyacinthus functional_group_sensu_darling Competitive genus fossil age 55.8 genus fossil age unit mya geographic area E geographic location (country and/or sea) Australia geographic location (latitude) -18.42385 geographic location (longitude) 146.985867 growth form typical tables_or_plates growth outline type determinate hemisphere Southern host species hyacinthus host_clade_sensu_fukami VI host_clade_sensu_fukami_numeric 6 host_genus Acropora host_genus_id Acropora host_name Acropora hyacinthus host_species_id hyacinthus huang_roy_tree_name ACR_Acropora_hyacinthus iucn red list category NT latitude -18.42385 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 10_T local_sample_id GC_6_Acr_hyac_3K_20150105_T longitude 146.985867 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 38.84118034 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 484 oocyte size at maturity unit um outgroup n oz_disease_mean 1.578324463 oz_disease_sd 0.456565414 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.283333333 prop_colony_maximum_diameter_universal 0.283333333 prop_colony_maximum_gcmp_recorded 0.787037037 range size 110136269.9 range size unit km^2 reef_name Kelso reef_type Mid Shelf reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.6.Acr.hyac.2.20150106.T sample type Coral Tissue sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock624_010_T sexual system hermaphrodite shelf_location midshelf site name Great Barrier Reef - Central Sector skeletal density 1.28 skeletal density unit g cm-3 southern-most range edge -35.55462518 species age phylogeny 0.588742379 species age phylogeny unit mya substrate Rubble on reef flat. substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 55974 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_VI taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Acroporidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 28 tissue compartment T water clarity preference clear wave exposure preference exposed western-most range edge 25.4743655 zooxanthellate zooxanthellate ERS2655022 SAMEA4835152 496922 coral metagenome Coral Skeleton from Turbinaria reniformis sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.2.Tur.reni.L13.20150124.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:42Z External Id SAMEA4835152 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:42Z INSDC status public Submitter Id E3.2.Tur.reni.1.20150124.S abundance gbr common abundance world uncommon barcodesequence TGTCAGCTTA binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Skeleton collected by Joe Pollock collection date 2015 collection id Trawler_20150124 collection time 15:17 collection_timestamp 1/24/15 15:17 coloniality colonial colony maximum diameter 500 colony maximum diameter unit cm colony_maximum_diameter 500 colony_maximum_diameter_universal 500 colony_maximum_gcmp_recorded 230 colony_name E3.2.Tur.reni.1.20150124 compartment_replicates 1 complex_robust complex concatenated_date 20150124 contact_description Field of Turbinaria Reef edge near P cylindrica field corallite width maximum 4.2 corallite width maximum unit mm corallite width minimum 2.8 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 1/24/15 depth 2.6 depth lower 15 depth lower unit m depth upper 2 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -136.9957288 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E3 family Dendrophylliidae field_host_genus_id Turbinaria field_host_name Turbinaria reniformis field_host_species_id reniformis full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_II_Turbinaria_reniformis genus fossil age 28.4 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 growth form typical laminar hemisphere Southern host species reniformis host_clade_sensu_fukami II host_clade_sensu_fukami_numeric 2 host_genus Turbinaria host_genus_id Turbinaria host_name Turbinaria reniformis host_species_id reniformis huang_roy_tree_name DEN_Turbinaria iucn red list category VU latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 75_S local_sample_id GN_2_Tur_reni_L13_20150124_S longitude 145.4665 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 36.21196191 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.44973545 oz_disease_sd 0.44973545 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.46 prop_colony_maximum_diameter_universal 0.46 prop_colony_maximum_gcmp_recorded 1 range size 90605636.14 range size unit km^2 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.2.Tur.reni.1.20150124.S sample type Coral Skeleton sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock625_075_S sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -37.43026469 species age phylogeny 0.876113954 species age phylogeny unit mya substrate Field of Turbinaria. Reef edge near P. cylindrica field substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 1381352 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_II taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Dendrophylliidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 29 tissue compartment S visibility 13 visibility_method Diver Estimate water clarity preference turbid wave exposure preference protected western-most range edge 31.6765571 zooxanthellate zooxanthellate ERS2655023 SAMEA4835153 496922 coral metagenome Coral Tissue from Turbinaria reniformis sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.2.Tur.reni.L13.20150124.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:42Z External Id SAMEA4835153 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:42Z INSDC status public Submitter Id E3.2.Tur.reni.1.20150124.T abundance gbr common abundance world uncommon barcodesequence CTGGAGGCTA binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Tissue collected by Joe Pollock collection date 2015 collection id Trawler_20150124 collection time 15:17 collection_timestamp 1/24/15 15:17 coloniality colonial colony maximum diameter 500 colony maximum diameter unit cm colony_maximum_diameter 500 colony_maximum_diameter_universal 500 colony_maximum_gcmp_recorded 230 colony_name E3.2.Tur.reni.1.20150124 compartment_replicates 1 complex_robust complex concatenated_date 20150124 contact_description Field of Turbinaria Reef edge near P cylindrica field corallite width maximum 4.2 corallite width maximum unit mm corallite width minimum 2.8 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 1/24/15 depth 2.6 depth lower 15 depth lower unit m depth upper 2 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -136.9957288 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E3 family Dendrophylliidae field_host_genus_id Turbinaria field_host_name Turbinaria reniformis field_host_species_id reniformis full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_II_Turbinaria_reniformis genus fossil age 28.4 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 growth form typical laminar hemisphere Southern host species reniformis host_clade_sensu_fukami II host_clade_sensu_fukami_numeric 2 host_genus Turbinaria host_genus_id Turbinaria host_name Turbinaria reniformis host_species_id reniformis huang_roy_tree_name DEN_Turbinaria iucn red list category VU latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 75_T local_sample_id GN_2_Tur_reni_L13_20150124_T longitude 145.4665 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 36.21196191 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.44973545 oz_disease_sd 0.44973545 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.46 prop_colony_maximum_diameter_universal 0.46 prop_colony_maximum_gcmp_recorded 1 range size 90605636.14 range size unit km^2 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.2.Tur.reni.1.20150124.T sample type Coral Tissue sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock626_075_T sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -37.43026469 species age phylogeny 0.876113954 species age phylogeny unit mya substrate Field of Turbinaria. Reef edge near P. cylindrica field substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 1381352 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_II taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Dendrophylliidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 29 tissue compartment T visibility 13 visibility_method Diver Estimate water clarity preference turbid wave exposure preference protected western-most range edge 31.6765571 zooxanthellate zooxanthellate ERS2655024 SAMEA4835154 496922 coral metagenome Coral Mucus from Turbinaria reniformis sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.2.Tur.reni.L13.20150124.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:42Z External Id SAMEA4835154 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:42Z INSDC status public Submitter Id E3.2.Tur.reni.1.20150124.M abundance gbr common abundance world uncommon barcodesequence TTGTCACATC binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Mucus collected by Joe Pollock collection date 2015 collection id Trawler_20150124 collection time 15:17 collection_timestamp 1/24/15 15:17 coloniality colonial colony maximum diameter 500 colony maximum diameter unit cm colony_maximum_diameter 500 colony_maximum_diameter_universal 500 colony_maximum_gcmp_recorded 230 colony_name E3.2.Tur.reni.1.20150124 compartment_replicates 1 complex_robust complex concatenated_date 20150124 contact_description Field of Turbinaria Reef edge near P cylindrica field corallite width maximum 4.2 corallite width maximum unit mm corallite width minimum 2.8 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 1/24/15 depth 2.6 depth lower 15 depth lower unit m depth upper 2 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -136.9957288 env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E3 family Dendrophylliidae field_host_genus_id Turbinaria field_host_name Turbinaria reniformis field_host_species_id reniformis full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_II_Turbinaria_reniformis genus fossil age 28.4 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 growth form typical laminar hemisphere Southern host species reniformis host_clade_sensu_fukami II host_clade_sensu_fukami_numeric 2 host_genus Turbinaria host_genus_id Turbinaria host_name Turbinaria reniformis host_species_id reniformis huang_roy_tree_name DEN_Turbinaria iucn red list category VU latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 75_M local_sample_id GN_2_Tur_reni_L13_20150124_M longitude 145.4665 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 36.21196191 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.44973545 oz_disease_sd 0.44973545 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.46 prop_colony_maximum_diameter_universal 0.46 prop_colony_maximum_gcmp_recorded 1 range size 90605636.14 range size unit km^2 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.2.Tur.reni.1.20150124.M sample type Coral Mucus sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock627_075_M sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -37.43026469 species age phylogeny 0.876113954 species age phylogeny unit mya substrate Field of Turbinaria. Reef edge near P. cylindrica field substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 1381352 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_II taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Dendrophylliidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 29 tissue compartment M visibility 13 visibility_method Diver Estimate water clarity preference turbid wave exposure preference protected western-most range edge 31.6765571 zooxanthellate zooxanthellate ERS2655025 SAMEA4835155 496922 coral metagenome Coral Skeleton from Turbinaria reniformis sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.2.Tur.reni.L14.20150124.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:42Z External Id SAMEA4835155 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:42Z INSDC status public Submitter Id E3.2.Tur.reni.2.20150124.S abundance gbr common abundance world uncommon barcodesequence GAATAGCTGA binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Skeleton collected by Joe Pollock collection date 2015 collection id Trawler_20150124 collection time 15:28 collection_timestamp 1/24/15 15:28 coloniality colonial colony maximum diameter 500 colony maximum diameter unit cm colony_maximum_diameter 500 colony_maximum_diameter_universal 500 colony_maximum_gcmp_recorded 230 colony_name E3.2.Tur.reni.2.20150124 compartment_replicates 1 complex_robust complex concatenated_date 20150124 contact_description Field of Turbinaria on reef flat corallite width maximum 4.2 corallite width maximum unit mm corallite width minimum 2.8 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 2 date 1/24/15 depth 1.3 depth lower 15 depth lower unit m depth upper 2 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -136.9957288 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E3 family Dendrophylliidae field_host_genus_id Turbinaria field_host_name Turbinaria reniformis field_host_species_id reniformis full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_II_Turbinaria_reniformis genus fossil age 28.4 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 growth form typical laminar hemisphere Southern host species reniformis host_clade_sensu_fukami II host_clade_sensu_fukami_numeric 2 host_genus Turbinaria host_genus_id Turbinaria host_name Turbinaria reniformis host_species_id reniformis huang_roy_tree_name DEN_Turbinaria iucn red list category VU latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 76_S local_sample_id GN_2_Tur_reni_L14_20150124_S longitude 145.4665 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 36.21196191 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.44973545 oz_disease_sd 0.44973545 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.07 prop_colony_maximum_diameter_universal 0.07 prop_colony_maximum_gcmp_recorded 0.152173913 range size 90605636.14 range size unit km^2 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.2.Tur.reni.2.20150124.S sample type Coral Skeleton sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock628_076_S sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -37.43026469 species age phylogeny 0.876113954 species age phylogeny unit mya substrate Field of Turbinaria on reef flat. substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 1381352 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_II taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Dendrophylliidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 29 tissue compartment S visibility 13 visibility_method Diver Estimate water clarity preference turbid wave exposure preference protected western-most range edge 31.6765571 zooxanthellate zooxanthellate ERS2655026 SAMEA4835156 496922 coral metagenome Coral Tissue from Turbinaria reniformis sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.2.Tur.reni.L14.20150124.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:42Z External Id SAMEA4835156 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:42Z INSDC status public Submitter Id E3.2.Tur.reni.2.20150124.T abundance gbr common abundance world uncommon barcodesequence TCGTGAATGA binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Tissue collected by Joe Pollock collection date 2015 collection id Trawler_20150124 collection time 15:28 collection_timestamp 1/24/15 15:28 coloniality colonial colony maximum diameter 500 colony maximum diameter unit cm colony_maximum_diameter 500 colony_maximum_diameter_universal 500 colony_maximum_gcmp_recorded 230 colony_name E3.2.Tur.reni.2.20150124 compartment_replicates 1 complex_robust complex concatenated_date 20150124 contact_description Field of Turbinaria on reef flat corallite width maximum 4.2 corallite width maximum unit mm corallite width minimum 2.8 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 2 date 1/24/15 depth 1.3 depth lower 15 depth lower unit m depth upper 2 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -136.9957288 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E3 family Dendrophylliidae field_host_genus_id Turbinaria field_host_name Turbinaria reniformis field_host_species_id reniformis full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_II_Turbinaria_reniformis genus fossil age 28.4 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 growth form typical laminar hemisphere Southern host species reniformis host_clade_sensu_fukami II host_clade_sensu_fukami_numeric 2 host_genus Turbinaria host_genus_id Turbinaria host_name Turbinaria reniformis host_species_id reniformis huang_roy_tree_name DEN_Turbinaria iucn red list category VU latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 76_T local_sample_id GN_2_Tur_reni_L14_20150124_T longitude 145.4665 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 36.21196191 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.44973545 oz_disease_sd 0.44973545 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.07 prop_colony_maximum_diameter_universal 0.07 prop_colony_maximum_gcmp_recorded 0.152173913 range size 90605636.14 range size unit km^2 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.2.Tur.reni.2.20150124.T sample type Coral Tissue sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock629_076_T sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -37.43026469 species age phylogeny 0.876113954 species age phylogeny unit mya substrate Field of Turbinaria on reef flat. substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 1381352 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_II taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Dendrophylliidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 29 tissue compartment T visibility 13 visibility_method Diver Estimate water clarity preference turbid wave exposure preference protected western-most range edge 31.6765571 zooxanthellate zooxanthellate ERS2655027 SAMEA4835157 496922 coral metagenome Coral Tissue from Diploastrea heliopora sampled from Lizard Island, Australia as sample E1.15.Dip.heli.1.20140809.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:42Z External Id SAMEA4835157 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:42Z INSDC status public Submitter Id E1.15.Dip.heli.1.20140809.T abundance gbr common abundance world uncommon algal_contact_types turf__cyanobacteria barcodesequence GTGAGAGACA binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Tissue cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Horseshoe_20140809 collection time 10:20 collection_timestamp 8/9/14 10:20 coloniality colonial colony maximum diameter 500 colony maximum diameter unit cm colony_height_m 80 colony_maximum_diameter 500 colony_maximum_diameter_universal 1034 colony_maximum_gcmp_recorded 1034 colony_name E1.15.Dip.heli.1.20140809 colony_width1 120 colony_width2 100 compartment_replicates 1 complex_robust robust concatenated_date 20140809 corallite width maximum 9 corallite width maximum unit mm corallite width minimum 7 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 10 daily_replicate 1 date 8/9/14 depth 1.2192 depth lower 30 depth lower unit m depth upper 0 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -167.1916889 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E1 family Diploastreidae field_host_genus_id Diploastrea field_host_name Diploastrea heliopora field_host_species_id heliopora full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Horseshoe full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XV_Diploastrea_heliopora functional_group_sensu_darling Stress-tolerant genus fossil age 99.6 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68716 geographic location (longitude) 145.44449 growth form typical massive hemisphere Southern host species heliopora host_clade_sensu_fukami XV host_clade_sensu_fukami_numeric 15 host_genus Diploastrea host_genus_id Diploastrea host_name Diploastrea heliopora host_species_id heliopora huang_roy_tree_name FAV_Diploastrea_heliopora invertebrate_contact_types lobophytum__acropora__porites__tridacna iucn red list category NT latitude -14.68716 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Diploastrea heliopora_20140809 local_sample_id Dip Tis 140809 longitude 145.44449 mode of larval development spawner n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 30.8119151 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 290 oocyte size at maturity unit um outgroup n oz_disease_mean 0 oz_disease_sd 0 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter 0.24 prop_colony_maximum_diameter_universal 0.116054159 prop_colony_maximum_gcmp_recorded 0.116054159 range size 70449346.41 range size unit km^2 reef_name Horseshoe reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.15.Dip.heli.1.20140809.T sample type Coral Tissue sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock63 sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -30.63689894 species age phylogeny 64.52281751 species age phylogeny unit mya substrate pavement substrate attachment attached symbio_its2_sequenced y symbiodinium sp. in propagules no target gene 16S target subfragment V4 taxon id 214969 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XV taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Diploastreidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.3 tissue compartment T tissue_loss_percent 0 turf_contact_percent 15 visibility 9 visibility_method Horizontal Secchi Disk water clarity preference clear wave exposure preference broad western-most range edge 31.7583974 zooxanthellate zooxanthellate ERS2655028 SAMEA4835158 496922 coral metagenome Coral Mucus from Turbinaria reniformis sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.2.Tur.reni.L14.20150124.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:42Z External Id SAMEA4835158 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:42Z INSDC status public Submitter Id E3.2.Tur.reni.2.20150124.M abundance gbr common abundance world uncommon barcodesequence CGAATGTATG binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Mucus collected by Joe Pollock collection date 2015 collection id Trawler_20150124 collection time 15:28 collection_timestamp 1/24/15 15:28 coloniality colonial colony maximum diameter 500 colony maximum diameter unit cm colony_maximum_diameter 500 colony_maximum_diameter_universal 500 colony_maximum_gcmp_recorded 230 colony_name E3.2.Tur.reni.2.20150124 compartment_replicates 1 complex_robust complex concatenated_date 20150124 contact_description Field of Turbinaria on reef flat corallite width maximum 4.2 corallite width maximum unit mm corallite width minimum 2.8 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 2 date 1/24/15 depth 1.3 depth lower 15 depth lower unit m depth upper 2 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -136.9957288 env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E3 family Dendrophylliidae field_host_genus_id Turbinaria field_host_name Turbinaria reniformis field_host_species_id reniformis full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_II_Turbinaria_reniformis genus fossil age 28.4 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 growth form typical laminar hemisphere Southern host species reniformis host_clade_sensu_fukami II host_clade_sensu_fukami_numeric 2 host_genus Turbinaria host_genus_id Turbinaria host_name Turbinaria reniformis host_species_id reniformis huang_roy_tree_name DEN_Turbinaria iucn red list category VU latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 76_M local_sample_id GN_2_Tur_reni_L14_20150124_M longitude 145.4665 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 36.21196191 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.44973545 oz_disease_sd 0.44973545 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.07 prop_colony_maximum_diameter_universal 0.07 prop_colony_maximum_gcmp_recorded 0.152173913 range size 90605636.14 range size unit km^2 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.2.Tur.reni.2.20150124.M sample type Coral Mucus sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock630_076_M sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -37.43026469 species age phylogeny 0.876113954 species age phylogeny unit mya substrate Field of Turbinaria on reef flat. substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 1381352 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_II taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Dendrophylliidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 29 tissue compartment M visibility 13 visibility_method Diver Estimate water clarity preference turbid wave exposure preference protected western-most range edge 31.6765571 zooxanthellate zooxanthellate ERS2655029 SAMEA4835159 496922 coral metagenome Coral Skeleton from Stylophora pistillata sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.10.Sty.pist.L15.20150124.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:42Z External Id SAMEA4835159 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:42Z INSDC status public Submitter Id E3.10.Sty.pist.1.20150124.S abundance gbr common abundance world common barcodesequence GAAGGAGATA binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Skeleton collected by Joe Pollock collection date 2015 collection id Trawler_20150124 collection time 15:43 collection_timestamp 1/24/15 15:43 coloniality colonial colony_maximum_diameter_universal 40 colony_maximum_gcmp_recorded 40 colony_name E3.10.Sty.pist.1.20150124 compartment_replicates 1 complex_robust robust concatenated_date 20150124 contact_description Reef flat Colony perhaps a bit pale corallite width maximum 1.4 corallite width maximum unit mm corallite width minimum 0.9 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 1/24/15 depth 2.6 depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -136.8753767 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E3 family Pocilloporidae field_host_genus_id Stylophora field_host_name Stylophora pistillata field_host_species_id pistillata full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_X_Stylophora_pistillata functional_group_sensu_darling Weedy genus fossil age 65.5 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 growth form typical branching_closed hemisphere Southern host species pistillata host_clade_sensu_fukami X host_clade_sensu_fukami_numeric 10 host_genus Stylophora host_genus_id Stylophora host_name Stylophora pistillata host_species_id pistillata huang_roy_tree_name POC_Stylophora iucn red list category NT latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 77_S local_sample_id GN_10_Sty_pist_L15_20150124_S longitude 145.4665 mode of larval development brooder n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 37.59605597 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 3.135283206 oz_disease_sd 1.53794235 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter_universal 0.75 prop_colony_maximum_gcmp_recorded 0.75 range size 93217615.57 range size unit km^2 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.10.Sty.pist.1.20150124.S sample type Coral Skeleton sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock631_077_S sexual system hermaphrodite shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector skeletal density 1.7031045 skeletal density unit g cm-3 southern-most range edge -35.16725933 species age phylogeny 1.035433103 species age phylogeny unit mya substrate Reef flat. Colony perhaps a bit pale. substrate attachment attached symbio_its2_sequenced n symbiodinium sp. in propagules yes target gene 16S target subfragment V4 taxon id 50429 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_X taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Pocilloporidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 29 tissue compartment S visibility 13 visibility_method Diver Estimate water clarity preference clear wave exposure preference exposed western-most range edge 27.7376321 zooxanthellate zooxanthellate ERS2655030 SAMEA4835160 496922 coral metagenome Coral Tissue from Stylophora pistillata sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.10.Sty.pist.L15.20150124.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:43Z External Id SAMEA4835160 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:43Z INSDC status public Submitter Id E3.10.Sty.pist.1.20150124.T abundance gbr common abundance world common barcodesequence TGGAGCATGT binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Tissue collected by Joe Pollock collection date 2015 collection id Trawler_20150124 collection time 15:43 collection_timestamp 1/24/15 15:43 coloniality colonial colony_maximum_diameter_universal 40 colony_maximum_gcmp_recorded 40 colony_name E3.10.Sty.pist.1.20150124 compartment_replicates 1 complex_robust robust concatenated_date 20150124 contact_description Reef flat Colony perhaps a bit pale corallite width maximum 1.4 corallite width maximum unit mm corallite width minimum 0.9 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 1/24/15 depth 2.6 depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -136.8753767 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E3 family Pocilloporidae field_host_genus_id Stylophora field_host_name Stylophora pistillata field_host_species_id pistillata full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_X_Stylophora_pistillata functional_group_sensu_darling Weedy genus fossil age 65.5 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 growth form typical branching_closed hemisphere Southern host species pistillata host_clade_sensu_fukami X host_clade_sensu_fukami_numeric 10 host_genus Stylophora host_genus_id Stylophora host_name Stylophora pistillata host_species_id pistillata huang_roy_tree_name POC_Stylophora iucn red list category NT latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 77_T local_sample_id GN_10_Sty_pist_L15_20150124_T longitude 145.4665 mode of larval development brooder n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 37.59605597 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 3.135283206 oz_disease_sd 1.53794235 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter_universal 0.75 prop_colony_maximum_gcmp_recorded 0.75 range size 93217615.57 range size unit km^2 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.10.Sty.pist.1.20150124.T sample type Coral Tissue sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock632_077_T sexual system hermaphrodite shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector skeletal density 1.7031045 skeletal density unit g cm-3 southern-most range edge -35.16725933 species age phylogeny 1.035433103 species age phylogeny unit mya substrate Reef flat. Colony perhaps a bit pale. substrate attachment attached symbio_its2_sequenced n symbiodinium sp. in propagules yes target gene 16S target subfragment V4 taxon id 50429 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_X taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Pocilloporidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 29 tissue compartment T visibility 13 visibility_method Diver Estimate water clarity preference clear wave exposure preference exposed western-most range edge 27.7376321 zooxanthellate zooxanthellate ERS2655031 SAMEA4835161 496922 coral metagenome Coral Mucus from Stylophora pistillata sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.10.Sty.pist.L15.20150124.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:43Z External Id SAMEA4835161 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:43Z INSDC status public Submitter Id E3.10.Sty.pist.1.20150124.M abundance gbr common abundance world common barcodesequence TAACTCTGCT binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Mucus collected by Joe Pollock collection date 2015 collection id Trawler_20150124 collection time 15:43 collection_timestamp 1/24/15 15:43 coloniality colonial colony_maximum_diameter_universal 40 colony_maximum_gcmp_recorded 40 colony_name E3.10.Sty.pist.1.20150124 compartment_replicates 1 complex_robust robust concatenated_date 20150124 contact_description Reef flat Colony perhaps a bit pale corallite width maximum 1.4 corallite width maximum unit mm corallite width minimum 0.9 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 1/24/15 depth 2.6 depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -136.8753767 env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E3 family Pocilloporidae field_host_genus_id Stylophora field_host_name Stylophora pistillata field_host_species_id pistillata full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_X_Stylophora_pistillata functional_group_sensu_darling Weedy genus fossil age 65.5 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 growth form typical branching_closed hemisphere Southern host species pistillata host_clade_sensu_fukami X host_clade_sensu_fukami_numeric 10 host_genus Stylophora host_genus_id Stylophora host_name Stylophora pistillata host_species_id pistillata huang_roy_tree_name POC_Stylophora iucn red list category NT latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 77_M local_sample_id GN_10_Sty_pist_L15_20150124_M longitude 145.4665 mode of larval development brooder n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 37.59605597 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 3.135283206 oz_disease_sd 1.53794235 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter_universal 0.75 prop_colony_maximum_gcmp_recorded 0.75 range size 93217615.57 range size unit km^2 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.10.Sty.pist.1.20150124.M sample type Coral Mucus sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock633_077_M sexual system hermaphrodite shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector skeletal density 1.7031045 skeletal density unit g cm-3 southern-most range edge -35.16725933 species age phylogeny 1.035433103 species age phylogeny unit mya substrate Reef flat. Colony perhaps a bit pale. substrate attachment attached symbio_its2_sequenced n symbiodinium sp. in propagules yes target gene 16S target subfragment V4 taxon id 50429 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_X taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Pocilloporidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 29 tissue compartment M visibility 13 visibility_method Diver Estimate water clarity preference clear wave exposure preference exposed western-most range edge 27.7376321 zooxanthellate zooxanthellate ERS2655032 SAMEA4835162 496922 coral metagenome Coral Skeleton from Stylophora pistillata sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.10.Sty.pist.L16.20150124.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:43Z External Id SAMEA4835162 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:43Z INSDC status public Submitter Id E3.10.Sty.pist.2.20150124.S abundance gbr common abundance world common barcodesequence TGACTAGCTT binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Skeleton collected by Joe Pollock collection date 2015 collection id Trawler_20150124 collection time 15:53 collection_timestamp 1/24/15 15:53 coloniality colonial colony_maximum_diameter_universal 40 colony_maximum_gcmp_recorded 40 colony_name E3.10.Sty.pist.2.20150124 compartment_replicates 1 complex_robust robust concatenated_date 20150124 contact_description Sand Attached to massive Porites corallite width maximum 1.4 corallite width maximum unit mm corallite width minimum 0.9 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 2 date 1/24/15 depth 2.4 depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -136.8753767 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E3 family Pocilloporidae field_host_genus_id Stylophora field_host_name Stylophora pistillata field_host_species_id pistillata full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_X_Stylophora_pistillata functional_group_sensu_darling Weedy genus fossil age 65.5 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 growth form typical branching_closed hemisphere Southern host species pistillata host_clade_sensu_fukami X host_clade_sensu_fukami_numeric 10 host_genus Stylophora host_genus_id Stylophora host_name Stylophora pistillata host_species_id pistillata huang_roy_tree_name POC_Stylophora iucn red list category NT latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 78_S local_sample_id GN_10_Sty_pist_L16_20150124_S longitude 145.4665 mode of larval development brooder n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 37.59605597 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 3.135283206 oz_disease_sd 1.53794235 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter_universal 0.825 prop_colony_maximum_gcmp_recorded 0.825 range size 93217615.57 range size unit km^2 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.10.Sty.pist.2.20150124.S sample type Coral Skeleton sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock634_078_S sexual system hermaphrodite shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector skeletal density 1.7031045 skeletal density unit g cm-3 southern-most range edge -35.16725933 species age phylogeny 1.035433103 species age phylogeny unit mya substrate Sand. Attached to massive Porites. substrate attachment attached symbio_its2_sequenced n symbiodinium sp. in propagules yes target gene 16S target subfragment V4 taxon id 50429 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_X taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Pocilloporidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 29 tissue compartment S visibility 13 visibility_method Diver Estimate water clarity preference clear wave exposure preference exposed western-most range edge 27.7376321 zooxanthellate zooxanthellate ERS2655033 SAMEA4835163 496922 coral metagenome Coral Tissue from Stylophora pistillata sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.10.Sty.pist.L16.20150124.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:43Z External Id SAMEA4835163 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:43Z INSDC status public Submitter Id E3.10.Sty.pist.2.20150124.T abundance gbr common abundance world common barcodesequence CGATCCTATA binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Tissue collected by Joe Pollock collection date 2015 collection id Trawler_20150124 collection time 15:53 collection_timestamp 1/24/15 15:53 coloniality colonial colony_maximum_diameter_universal 40 colony_maximum_gcmp_recorded 40 colony_name E3.10.Sty.pist.2.20150124 compartment_replicates 1 complex_robust robust concatenated_date 20150124 contact_description Sand Attached to massive Porites corallite width maximum 1.4 corallite width maximum unit mm corallite width minimum 0.9 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 2 date 1/24/15 depth 2.4 depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -136.8753767 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E3 family Pocilloporidae field_host_genus_id Stylophora field_host_name Stylophora pistillata field_host_species_id pistillata full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_X_Stylophora_pistillata functional_group_sensu_darling Weedy genus fossil age 65.5 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 growth form typical branching_closed hemisphere Southern host species pistillata host_clade_sensu_fukami X host_clade_sensu_fukami_numeric 10 host_genus Stylophora host_genus_id Stylophora host_name Stylophora pistillata host_species_id pistillata huang_roy_tree_name POC_Stylophora iucn red list category NT latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 78_T local_sample_id GN_10_Sty_pist_L16_20150124_T longitude 145.4665 mode of larval development brooder n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 37.59605597 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 3.135283206 oz_disease_sd 1.53794235 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter_universal 0.825 prop_colony_maximum_gcmp_recorded 0.825 range size 93217615.57 range size unit km^2 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.10.Sty.pist.2.20150124.T sample type Coral Tissue sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock635_078_T sexual system hermaphrodite shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector skeletal density 1.7031045 skeletal density unit g cm-3 southern-most range edge -35.16725933 species age phylogeny 1.035433103 species age phylogeny unit mya substrate Sand. Attached to massive Porites. substrate attachment attached symbio_its2_sequenced n symbiodinium sp. in propagules yes target gene 16S target subfragment V4 taxon id 50429 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_X taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Pocilloporidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 29 tissue compartment T visibility 13 visibility_method Diver Estimate water clarity preference clear wave exposure preference exposed western-most range edge 27.7376321 zooxanthellate zooxanthellate ERS2655034 SAMEA4835164 496922 coral metagenome Coral Mucus from Stylophora pistillata sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.10.Sty.pist.L16.20150124.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:43Z External Id SAMEA4835164 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:43Z INSDC status public Submitter Id E3.10.Sty.pist.2.20150124.M abundance gbr common abundance world common barcodesequence CCATATGATC binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Mucus collected by Joe Pollock collection date 2015 collection id Trawler_20150124 collection time 15:53 collection_timestamp 1/24/15 15:53 coloniality colonial colony_maximum_diameter_universal 40 colony_maximum_gcmp_recorded 40 colony_name E3.10.Sty.pist.2.20150124 compartment_replicates 1 complex_robust robust concatenated_date 20150124 contact_description Sand Attached to massive Porites corallite width maximum 1.4 corallite width maximum unit mm corallite width minimum 0.9 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 2 date 1/24/15 depth 2.4 depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -136.8753767 env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E3 family Pocilloporidae field_host_genus_id Stylophora field_host_name Stylophora pistillata field_host_species_id pistillata full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_X_Stylophora_pistillata functional_group_sensu_darling Weedy genus fossil age 65.5 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 growth form typical branching_closed hemisphere Southern host species pistillata host_clade_sensu_fukami X host_clade_sensu_fukami_numeric 10 host_genus Stylophora host_genus_id Stylophora host_name Stylophora pistillata host_species_id pistillata huang_roy_tree_name POC_Stylophora iucn red list category NT latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 78_M local_sample_id GN_10_Sty_pist_L16_20150124_M longitude 145.4665 mode of larval development brooder n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 37.59605597 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 3.135283206 oz_disease_sd 1.53794235 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter_universal 0.825 prop_colony_maximum_gcmp_recorded 0.825 range size 93217615.57 range size unit km^2 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.10.Sty.pist.2.20150124.M sample type Coral Mucus sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock636_078_M sexual system hermaphrodite shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector skeletal density 1.7031045 skeletal density unit g cm-3 southern-most range edge -35.16725933 species age phylogeny 1.035433103 species age phylogeny unit mya substrate Sand. Attached to massive Porites. substrate attachment attached symbio_its2_sequenced n symbiodinium sp. in propagules yes target gene 16S target subfragment V4 taxon id 50429 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_X taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Pocilloporidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 29 tissue compartment M visibility 13 visibility_method Diver Estimate water clarity preference clear wave exposure preference exposed western-most range edge 27.7376321 zooxanthellate zooxanthellate ERS2655035 SAMEA4835165 496922 coral metagenome Coral Tissue from Galaxea astreata sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.5.Gal.astr.L17.20150124.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:43Z External Id SAMEA4835165 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:43Z INSDC status public Submitter Id E3.5.Gal.astr.1.20150124.T abundance gbr common abundance world common barcodesequence TGAGAAGGTA binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Tissue collected by Joe Pollock collection date 2015 collection id Trawler_20150124 collection time 16:04 collection_timestamp 1/24/15 16:04 coloniality colonial colony maximum diameter 200 colony maximum diameter unit cm colony_maximum_diameter 200 colony_maximum_diameter_universal 200 colony_maximum_gcmp_recorded 35 colony_name E3.5.Gal.astr.1.20150124 compartment_replicates 1 complex_robust complex concatenated_date 20150124 contact_description Reef rubble corallite width maximum 3.7 corallite width maximum unit mm corallite width minimum 3.4 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 1/24/15 depth 1.2 depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -168.0535591 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E3 family Euphylliidae field_host_genus_id Galaxea field_host_name Galaxea astreata field_host_species_id astreata full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_V_Galaxea_astreata functional_group_sensu_darling Stress-tolerant genus fossil age 23.03 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 growth form typical submassive hemisphere Southern host species astreata host_clade_sensu_fukami V host_clade_sensu_fukami_numeric 5 host_genus Galaxea host_genus_id Galaxea host_name Galaxea astreata host_species_id astreata huang_roy_tree_name OCU_Galaxea_astreata iucn red list category VU latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 79_T local_sample_id GN_5_Gal_astr_L17_20150124_T longitude 145.4665 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 37.11571178 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.258673969 oz_disease_sd 0.173267011 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.07 prop_colony_maximum_diameter_universal 0.07 prop_colony_maximum_gcmp_recorded 0.4 range size 72703639.29 range size unit km^2 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.5.Gal.astr.1.20150124.T sample type Coral Tissue sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock637_079_T sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -32.22433312 species age phylogeny 0.518269449 species age phylogeny unit mya substrate Reef rubble. substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 154325 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_V taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Euphylliidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 29 tissue compartment T visibility 13 visibility_method Diver Estimate water clarity preference turbid wave exposure preference protected western-most range edge 31.7398894 zooxanthellate zooxanthellate ERS2655036 SAMEA4835166 496922 coral metagenome Coral Mucus from Galaxea astreata sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.5.Gal.astr.L17.20150124.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:43Z External Id SAMEA4835166 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:43Z INSDC status public Submitter Id E3.5.Gal.astr.1.20150124.M abundance gbr common abundance world common barcodesequence GTAGCCAGTA binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Mucus collected by Joe Pollock collection date 2015 collection id Trawler_20150124 collection time 16:04 collection_timestamp 1/24/15 16:04 coloniality colonial colony maximum diameter 200 colony maximum diameter unit cm colony_maximum_diameter 200 colony_maximum_diameter_universal 200 colony_maximum_gcmp_recorded 35 colony_name E3.5.Gal.astr.1.20150124 compartment_replicates 1 complex_robust complex concatenated_date 20150124 contact_description Reef rubble corallite width maximum 3.7 corallite width maximum unit mm corallite width minimum 3.4 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 1/24/15 depth 1.2 depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -168.0535591 env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E3 family Euphylliidae field_host_genus_id Galaxea field_host_name Galaxea astreata field_host_species_id astreata full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_V_Galaxea_astreata functional_group_sensu_darling Stress-tolerant genus fossil age 23.03 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 growth form typical submassive hemisphere Southern host species astreata host_clade_sensu_fukami V host_clade_sensu_fukami_numeric 5 host_genus Galaxea host_genus_id Galaxea host_name Galaxea astreata host_species_id astreata huang_roy_tree_name OCU_Galaxea_astreata iucn red list category VU latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 79_M local_sample_id GN_5_Gal_astr_L17_20150124_M longitude 145.4665 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 37.11571178 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.258673969 oz_disease_sd 0.173267011 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.07 prop_colony_maximum_diameter_universal 0.07 prop_colony_maximum_gcmp_recorded 0.4 range size 72703639.29 range size unit km^2 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.5.Gal.astr.1.20150124.M sample type Coral Mucus sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock638_079_M sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -32.22433312 species age phylogeny 0.518269449 species age phylogeny unit mya substrate Reef rubble. substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 154325 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_V taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Euphylliidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 29 tissue compartment M visibility 13 visibility_method Diver Estimate water clarity preference turbid wave exposure preference protected western-most range edge 31.7398894 zooxanthellate zooxanthellate ERS2655037 SAMEA4835167 496922 coral metagenome Coral Tissue from Galaxea astreata sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.5.Gal.astr.L18.20150124.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:43Z External Id SAMEA4835167 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:43Z INSDC status public Submitter Id E3.5.Gal.astr.2.20150124.T abundance gbr common abundance world common barcodesequence TTACACGTTC binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Tissue collected by Joe Pollock collection date 2015 collection id Trawler_20150124 collection time 16:13 collection_timestamp 1/24/15 16:13 coloniality colonial colony maximum diameter 200 colony maximum diameter unit cm colony_maximum_diameter 200 colony_maximum_diameter_universal 200 colony_maximum_gcmp_recorded 35 colony_name E3.5.Gal.astr.2.20150124 compartment_replicates 1 complex_robust complex concatenated_date 20150124 contact_description Reef rubble Bit pale corallite width maximum 3.7 corallite width maximum unit mm corallite width minimum 3.4 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 2 date 1/24/15 depth 1.4 depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -168.0535591 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E3 family Euphylliidae field_host_genus_id Galaxea field_host_name Galaxea astreata field_host_species_id astreata full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_V_Galaxea_astreata functional_group_sensu_darling Stress-tolerant genus fossil age 23.03 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 growth form typical submassive hemisphere Southern host species astreata host_clade_sensu_fukami V host_clade_sensu_fukami_numeric 5 host_genus Galaxea host_genus_id Galaxea host_name Galaxea astreata host_species_id astreata huang_roy_tree_name OCU_Galaxea_astreata iucn red list category VU latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 80_T local_sample_id GN_5_Gal_astr_L18_20150124_T longitude 145.4665 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 37.11571178 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.258673969 oz_disease_sd 0.173267011 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.05 prop_colony_maximum_diameter_universal 0.05 prop_colony_maximum_gcmp_recorded 0.285714286 range size 72703639.29 range size unit km^2 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.5.Gal.astr.2.20150124.T sample type Coral Tissue sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock639_080_T sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -32.22433312 species age phylogeny 0.518269449 species age phylogeny unit mya substrate Reef rubble. Bit pale. substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 154325 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_V taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Euphylliidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 29 tissue compartment T visibility 13 visibility_method Diver Estimate water clarity preference turbid wave exposure preference protected western-most range edge 31.7398894 zooxanthellate zooxanthellate ERS2655038 SAMEA4835168 496922 coral metagenome Coral Skeleton from Diploastrea heliopora sampled from Lizard Island, Australia as sample E1.15.Dip.heli.1.20140809.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:43Z External Id SAMEA4835168 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:43Z INSDC status public Submitter Id E1.15.Dip.heli.1.20140809.S abundance gbr common abundance world uncommon algal_contact_types turf__cyanobacteria barcodesequence TACATCGCTG binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Skeleton cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Horseshoe_20140809 collection time 10:20 collection_timestamp 8/9/14 10:20 coloniality colonial colony maximum diameter 500 colony maximum diameter unit cm colony_height_m 80 colony_maximum_diameter 500 colony_maximum_diameter_universal 1034 colony_maximum_gcmp_recorded 1034 colony_name E1.15.Dip.heli.1.20140809 colony_width1 120 colony_width2 100 compartment_replicates 1 complex_robust robust concatenated_date 20140809 corallite width maximum 9 corallite width maximum unit mm corallite width minimum 7 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 10 daily_replicate 1 date 8/9/14 depth 1.2192 depth lower 30 depth lower unit m depth upper 0 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -167.1916889 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E1 family Diploastreidae field_host_genus_id Diploastrea field_host_name Diploastrea heliopora field_host_species_id heliopora full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Horseshoe full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XV_Diploastrea_heliopora functional_group_sensu_darling Stress-tolerant genus fossil age 99.6 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68716 geographic location (longitude) 145.44449 growth form typical massive hemisphere Southern host species heliopora host_clade_sensu_fukami XV host_clade_sensu_fukami_numeric 15 host_genus Diploastrea host_genus_id Diploastrea host_name Diploastrea heliopora host_species_id heliopora huang_roy_tree_name FAV_Diploastrea_heliopora invertebrate_contact_types lobophytum__acropora__porites__tridacna iucn red list category NT latitude -14.68716 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Diploastrea heliopora_20140809 local_sample_id Dip Ske 140809 longitude 145.44449 mode of larval development spawner n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 30.8119151 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 290 oocyte size at maturity unit um outgroup n oz_disease_mean 0 oz_disease_sd 0 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter 0.24 prop_colony_maximum_diameter_universal 0.116054159 prop_colony_maximum_gcmp_recorded 0.116054159 range size 70449346.41 range size unit km^2 reef_name Horseshoe reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.15.Dip.heli.1.20140809.S sample type Coral Skeleton sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock64 sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -30.63689894 species age phylogeny 64.52281751 species age phylogeny unit mya substrate pavement substrate attachment attached symbio_its2_sequenced y symbiodinium sp. in propagules no target gene 16S target subfragment V4 taxon id 214969 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XV taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Diploastreidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.3 tissue compartment S tissue_loss_percent 0 turf_contact_percent 15 visibility 9 visibility_method Horizontal Secchi Disk water clarity preference clear wave exposure preference broad western-most range edge 31.7583974 zooxanthellate zooxanthellate ERS2655039 SAMEA4835169 496922 coral metagenome Coral Mucus from Galaxea astreata sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.5.Gal.astr.L18.20150124.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:43Z External Id SAMEA4835169 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:43Z INSDC status public Submitter Id E3.5.Gal.astr.2.20150124.M abundance gbr common abundance world common barcodesequence GTTCTTCGTA binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Mucus collected by Joe Pollock collection date 2015 collection id Trawler_20150124 collection time 16:13 collection_timestamp 1/24/15 16:13 coloniality colonial colony maximum diameter 200 colony maximum diameter unit cm colony_maximum_diameter 200 colony_maximum_diameter_universal 200 colony_maximum_gcmp_recorded 35 colony_name E3.5.Gal.astr.2.20150124 compartment_replicates 1 complex_robust complex concatenated_date 20150124 contact_description Reef rubble Bit pale corallite width maximum 3.7 corallite width maximum unit mm corallite width minimum 3.4 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 2 date 1/24/15 depth 1.4 depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -168.0535591 env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E3 family Euphylliidae field_host_genus_id Galaxea field_host_name Galaxea astreata field_host_species_id astreata full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_V_Galaxea_astreata functional_group_sensu_darling Stress-tolerant genus fossil age 23.03 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 growth form typical submassive hemisphere Southern host species astreata host_clade_sensu_fukami V host_clade_sensu_fukami_numeric 5 host_genus Galaxea host_genus_id Galaxea host_name Galaxea astreata host_species_id astreata huang_roy_tree_name OCU_Galaxea_astreata iucn red list category VU latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 80_M local_sample_id GN_5_Gal_astr_L18_20150124_M longitude 145.4665 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 37.11571178 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.258673969 oz_disease_sd 0.173267011 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.05 prop_colony_maximum_diameter_universal 0.05 prop_colony_maximum_gcmp_recorded 0.285714286 range size 72703639.29 range size unit km^2 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.5.Gal.astr.2.20150124.M sample type Coral Mucus sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock640_080_M sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -32.22433312 species age phylogeny 0.518269449 species age phylogeny unit mya substrate Reef rubble. Bit pale. substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 154325 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_V taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Euphylliidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 29 tissue compartment M visibility 13 visibility_method Diver Estimate water clarity preference turbid wave exposure preference protected western-most range edge 31.7398894 zooxanthellate zooxanthellate ERS2655040 SAMEA4835170 496922 coral metagenome Coral Tissue from Pavona varians sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.7.Pav.vari.L19.20150124.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:43Z External Id SAMEA4835170 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:43Z INSDC status public Submitter Id E3.7.Pav.vari.1.20150124.T abundance gbr common abundance world common barcodesequence GGTCTGGTGT binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Tissue collected by Joe Pollock collection date 2015 collection id Trawler_20150124 collection time 16:25 collection_timestamp 1/24/15 16:25 coloniality colonial colony_maximum_diameter_universal 80 colony_maximum_gcmp_recorded 80 colony_name E3.7.Pav.vari.1.20150124 compartment_replicates 1 complex_robust complex concatenated_date 20150124 contact_description Reef rubble Under soft coral corallite width maximum 9.3 corallite width maximum unit mm corallite width minimum 4.7 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 1/24/15 depth 1.5 depth lower 80 depth lower unit m depth upper 2 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -75.92220916 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E3 family Agariciidae field_host_genus_id Pavona field_host_name Pavona varians field_host_species_id varians full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_VII_Pavona_varians functional_group_sensu_darling Stress-tolerant genus fossil age 55.8 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 growth form typical encrusting hemisphere Southern host species varians host_clade_sensu_fukami VII host_clade_sensu_fukami_numeric 7 host_genus Pavona host_genus_id Pavona host_name Pavona varians host_species_id varians huang_roy_tree_name AGA_Pavona_varians invertebrate_contact_types Unidentified_soft_coral iucn red list category LC latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 81_T local_sample_id GN_7_Pav_vari_L19_20150124_T longitude 145.4665 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 36.7647214 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.090909091 oz_disease_sd 0.090909091 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter_universal 0.3375 prop_colony_maximum_gcmp_recorded 0.3375 range size 122496267.5 range size unit km^2 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.7.Pav.vari.1.20150124.T sample type Coral Tissue sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock641_081_T sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector skeletal density 1.965 skeletal density unit g cm-3 southern-most range edge -31.90717291 species age phylogeny 4.081376792 species age phylogeny unit mya substrate Reef rubble. Under soft coral. substrate attachment attached symbio_its2_sequenced n symbiodinium sp. in propagules no target gene 16S target subfragment V4 taxon id 46726 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_VII taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Agariciidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 29 tissue compartment T visibility 13 visibility_method Diver Estimate water clarity preference both wave exposure preference broad western-most range edge 31.7085793 zooxanthellate zooxanthellate ERS2655041 SAMEA4835171 496922 coral metagenome Coral Tissue from Pavona varians sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.7.Pav.vari.L20.20150124.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:43Z External Id SAMEA4835171 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:43Z INSDC status public Submitter Id E3.7.Pav.vari.2.20150124.T abundance gbr common abundance world common barcodesequence TTCGAGCTAT binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Tissue collected by Joe Pollock collection date 2015 collection id Trawler_20150124 collection time 16:34 collection_timestamp 1/24/15 16:34 coloniality colonial colony_maximum_diameter_universal 80 colony_maximum_gcmp_recorded 80 colony_name E3.7.Pav.vari.2.20150124 compartment_replicates 1 complex_robust complex concatenated_date 20150124 contact_description Reef rubble corallite width maximum 9.3 corallite width maximum unit mm corallite width minimum 4.7 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 2 date 1/24/15 depth 1.5 depth lower 80 depth lower unit m depth upper 2 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -75.92220916 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E3 family Agariciidae field_host_genus_id Pavona field_host_name Pavona varians field_host_species_id varians full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_VII_Pavona_varians functional_group_sensu_darling Stress-tolerant genus fossil age 55.8 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 growth form typical encrusting hemisphere Southern host species varians host_clade_sensu_fukami VII host_clade_sensu_fukami_numeric 7 host_genus Pavona host_genus_id Pavona host_name Pavona varians host_species_id varians huang_roy_tree_name AGA_Pavona_varians iucn red list category LC latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 82_T local_sample_id GN_7_Pav_vari_L20_20150124_T longitude 145.4665 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 36.7647214 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.090909091 oz_disease_sd 0.090909091 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter_universal 0.125 prop_colony_maximum_gcmp_recorded 0.125 range size 122496267.5 range size unit km^2 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.7.Pav.vari.2.20150124.T sample type Coral Tissue sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock642_082_T sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector skeletal density 1.965 skeletal density unit g cm-3 southern-most range edge -31.90717291 species age phylogeny 4.081376792 species age phylogeny unit mya substrate Reef rubble. substrate attachment attached symbio_its2_sequenced n symbiodinium sp. in propagules no target gene 16S target subfragment V4 taxon id 46726 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_VII taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Agariciidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 29 tissue compartment T visibility 13 visibility_method Diver Estimate water clarity preference both wave exposure preference broad western-most range edge 31.7085793 zooxanthellate zooxanthellate ERS2655042 SAMEA4835172 496922 coral metagenome Coral Tissue from Symphyllia sp sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.19.Sym.spL24.20150125.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:43Z External Id SAMEA4835172 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:43Z INSDC status public Submitter Id E3.19.Sym.sp.1.20150125.T barcodesequence TGCGGATGGT binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Tissue collected by Joe Pollock collection date 2015 collection id Trawler_20150125 collection time 14:37 collection_timestamp 1/25/15 14:37 colony_maximum_diameter_universal 50 colony_maximum_gcmp_recorded 50 colony_name E3.19.Sym.sp.1.20150125 compartment_replicates 1 complex_robust robust concatenated_date 20150125 contact_description Rubble on reef flat country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 1/25/15 depth 1.5 depth_method measured disease_percent 0 dna_extracted y env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E3 family Lobophylliidae field_host_genus_id Symphyllia field_host_name Symphyllia sp field_host_species_id sp full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XIX_Symphyllia_sp geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 hemisphere Southern host species sp host_clade_sensu_fukami XIX host_clade_sensu_fukami_numeric 19 host_genus Symphyllia host_genus_id Symphyllia host_name Symphyllia sp host_species_id sp huang_roy_tree_name MUS_Symphyllia latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 86_T local_sample_id GN_19_Sym_sp_L24_20150125_T longitude 145.4665 n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.277777778 oz_disease_sd 0.277777778 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter_universal 0.8 prop_colony_maximum_gcmp_recorded 0.8 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.19.Sym.sp.1.20150125.T sample type Coral Tissue sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock643_086_T shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector substrate Rubble on reef flat. symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 242739 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XIX taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Lobophylliidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 29 tissue compartment T visibility 15 visibility_method Diver Estimate ERS2655043 SAMEA4835173 496922 coral metagenome Coral Tissue from Symphyllia sp sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.19.Sym.spL25.20150125.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:43Z External Id SAMEA4835173 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:43Z INSDC status public Submitter Id E3.19.Sym.sp.2.20150125.T barcodesequence TCGAGGTACT binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Tissue collected by Joe Pollock collection date 2015 collection id Trawler_20150125 collection time 14:45 collection_timestamp 1/25/15 14:45 colony_maximum_diameter_universal 50 colony_maximum_gcmp_recorded 50 colony_name E3.19.Sym.sp.2.20150125 compartment_replicates 1 complex_robust robust concatenated_date 20150125 contact_description Rubble /sand on reef flat Soft coral adjacent country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 2 date 1/25/15 depth 1.8 depth_method measured disease_percent 0 dna_extracted y env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E3 family Lobophylliidae field_host_genus_id Symphyllia field_host_name Symphyllia sp field_host_species_id sp full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XIX_Symphyllia_sp geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 hemisphere Southern host species sp host_clade_sensu_fukami XIX host_clade_sensu_fukami_numeric 19 host_genus Symphyllia host_genus_id Symphyllia host_name Symphyllia sp host_species_id sp huang_roy_tree_name MUS_Symphyllia invertebrate_contact_types Unidentified_soft_coral latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 87_T local_sample_id GN_19_Sym_sp_L25_20150125_T longitude 145.4665 n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.277777778 oz_disease_sd 0.277777778 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter_universal 1 prop_colony_maximum_gcmp_recorded 1 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.19.Sym.sp.2.20150125.T sample type Coral Tissue sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock644_087_T shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector substrate Rubble /sand on reef flat. Soft coral adjacent. symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 242739 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XIX taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Lobophylliidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 29 tissue compartment T visibility 15 visibility_method Diver Estimate ERS2655044 SAMEA4835174 496922 coral metagenome Coral Mucus from Millepora sp sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.Out.Mil.spL28.20150125.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:43Z External Id SAMEA4835174 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:43Z INSDC status public Submitter Id E3.Out.Mil.sp.1.20150125.M barcodesequence GAACTATCAC binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Mucus collected by Joe Pollock collection date 2015 collection id Trawler_20150125 collection time 15:14 collection_timestamp 1/25/15 15:14 colony_maximum_diameter_universal 93 colony_maximum_gcmp_recorded 93 colony_name E3.Out.Mil.sp.1.20150125 compartment_replicates 1 complex_robust outgroup concatenated_date 20150125 contact_description Reef edge over sand country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 1/25/15 depth 2.7 depth_method measured disease_percent 0 dna_extracted y env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E3 family Milleporidae field_host_genus_id Millepora field_host_name Millepora sp field_host_species_id sp full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Hydrozoa_Anthoathecata_Milleporidae_Millepora_sp geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 hemisphere Southern host species sp host_clade_sensu_fukami Outgroup_Cnidaria_Hydrozoa_Anthoathecata_Milleporidae host_clade_sensu_fukami_numeric Outgroup_Cnidaria_Hydrozoa_Anthoathecata_Milleporidae host_genus Millepora host_genus_id Millepora host_name Millepora sp host_species_id sp latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 90_M local_sample_id GN_Out_Mil_sp_L28_20150125_M longitude 145.4665 n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name hydrozoans ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup y parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter_universal 1 prop_colony_maximum_gcmp_recorded 1 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.Out.Mil.sp.1.20150125.M sample type Coral Mucus sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock645_090_M shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector substrate Reef edge over sand symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 51117 taxonomy_string_to_clade Cnidaria_Hydrozoa_Anthoathecata_Milleporidae taxonomy_string_to_class Cnidaria_Hydrozoa taxonomy_string_to_family Cnidaria_Hydrozoa_Anthoathecata_Milleporidae taxonomy_string_to_order Cnidaria_Hydrozoa_Anthoathecata taxonomy_string_to_subclass Cnidaria_Hydrozoa_Leptolinae temperature 29 tissue compartment M visibility 15 visibility_method Diver Estimate ERS2655045 SAMEA4835175 496922 coral metagenome Coral Tissue from Physogyra lichtensteini sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.14.Phy.lich.L29.20150125.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:43Z External Id SAMEA4835175 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:43Z INSDC status public Submitter Id E3.14.Phy.lich.1.20150125.T abundance gbr common abundance world common barcodesequence GCGTTATTGC binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Tissue collected by Joe Pollock collection date 2015 collection id Trawler_20150125 collection time 15:20 collection_timestamp 1/25/15 15:20 coloniality colonial colony maximum diameter 100 colony maximum diameter unit cm colony_maximum_diameter 100 colony_maximum_diameter_universal 100 colony_maximum_gcmp_recorded 80 colony_name E3.14.Phy.lich.1.20150125 compartment_replicates 1 complex_robust robust concatenated_date 20150125 contact_description Reef edge over sand corallite width maximum 20 corallite width maximum unit mm corallite width minimum 6 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 1/25/15 depth 2.2 depth lower 20 depth lower unit m depth upper 1 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -173.2615884 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E3 family incertae sedis field_host_genus_id Physogyra field_host_name Physogyra lichtensteini field_host_species_id lichtensteini full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XIV_Physogyra_lichtensteini functional_group_sensu_darling Stress-tolerant genus fossil age 0.01 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 growth form typical massive hemisphere Southern host species lichtensteini host_clade_sensu_fukami XIV host_clade_sensu_fukami_numeric 14 host_genus Physogyra host_genus_id Physogyra host_name Physogyra lichtensteini host_species_id lichtensteini huang_roy_tree_name EUP_Physogyra_lichtensteini iucn red list category VU latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 91_T local_sample_id GN_14_Phy_lich_L29_20150125_T longitude 145.4665 n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 33.94501258 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0 oz_disease_sd 0 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.8 prop_colony_maximum_diameter_universal 0.8 prop_colony_maximum_gcmp_recorded 1 range size 78301486.65 range size unit km^2 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.14.Phy.lich.1.20150125.T sample type Coral Tissue sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock646_091_T shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -35.38256235 species age phylogeny 1.648875415 species age phylogeny unit mya substrate Reef edge over sand substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 419442 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XIV taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_incertae sedis taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 29 tissue compartment T visibility 15 visibility_method Diver Estimate water clarity preference turbid wave exposure preference protected western-most range edge 30.6437165 zooxanthellate zooxanthellate ERS2655046 SAMEA4835176 496922 coral metagenome Coral Tissue from Physogyra lichtensteini sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.14.Phy.lich.L30.20150125.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:43Z External Id SAMEA4835176 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:43Z INSDC status public Submitter Id E3.14.Phy.lich.2.20150125.T abundance gbr common abundance world common barcodesequence TCGCTGAACA binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Tissue collected by Joe Pollock collection date 2015 collection id Trawler_20150125 collection time 15:30 collection_timestamp 1/25/15 15:30 coloniality colonial colony maximum diameter 100 colony maximum diameter unit cm colony_maximum_diameter 100 colony_maximum_diameter_universal 100 colony_maximum_gcmp_recorded 80 colony_name E3.14.Phy.lich.2.20150125 compartment_replicates 1 complex_robust robust concatenated_date 20150125 contact_description Reef edge over sand corallite width maximum 20 corallite width maximum unit mm corallite width minimum 6 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 2 date 1/25/15 depth 2.7 depth lower 20 depth lower unit m depth upper 1 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -173.2615884 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E3 family incertae sedis field_host_genus_id Physogyra field_host_name Physogyra lichtensteini field_host_species_id lichtensteini full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XIV_Physogyra_lichtensteini functional_group_sensu_darling Stress-tolerant genus fossil age 0.01 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 growth form typical massive hemisphere Southern host species lichtensteini host_clade_sensu_fukami XIV host_clade_sensu_fukami_numeric 14 host_genus Physogyra host_genus_id Physogyra host_name Physogyra lichtensteini host_species_id lichtensteini huang_roy_tree_name EUP_Physogyra_lichtensteini iucn red list category VU latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 92_T local_sample_id GN_14_Phy_lich_L30_20150125_T longitude 145.4665 n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 33.94501258 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0 oz_disease_sd 0 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.28 prop_colony_maximum_diameter_universal 0.28 prop_colony_maximum_gcmp_recorded 0.35 range size 78301486.65 range size unit km^2 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.14.Phy.lich.2.20150125.T sample type Coral Tissue sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock647_092_T shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -35.38256235 species age phylogeny 1.648875415 species age phylogeny unit mya substrate Reef edge over sand substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 419442 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XIV taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_incertae sedis taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 29 tissue compartment T visibility 15 visibility_method Diver Estimate water clarity preference turbid wave exposure preference protected western-most range edge 30.6437165 zooxanthellate zooxanthellate ERS2655047 SAMEA4835177 496922 coral metagenome .Millepora Mucus from Millepora sp sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.Out.Mil.spL31.20150125.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:43Z External Id SAMEA4835177 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:43Z INSDC status public Submitter Id E3.Out.Mil.sp.2.20150125.M barcodesequence TCGAATGTGC binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Millepora Mucus collected by Joe Pollock collection date 2015 collection id Trawler_20150125 collection time 15:43 collection_timestamp 1/25/15 15:43 colony_maximum_diameter_universal 93 colony_maximum_gcmp_recorded 93 colony_name E3.Out.Mil.sp.2.20150125 compartment_replicates 1 complex_robust outgroup concatenated_date 20150125 contact_description Sand country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 2 date 1/25/15 depth 5.3 depth_method measured disease_percent 0 dna_extracted y env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Millepora Mucus environmental sample Yes expedition_number E3 family Milleporidae field_host_genus_id Millepora field_host_name Millepora sp field_host_species_id sp full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Hydrozoa_Anthoathecata_Milleporidae_Millepora_sp geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 hemisphere Southern host species sp host_clade_sensu_fukami Outgroup_Cnidaria_Hydrozoa_Anthoathecata_Milleporidae host_clade_sensu_fukami_numeric Outgroup_Cnidaria_Hydrozoa_Anthoathecata_Milleporidae host_genus Millepora host_genus_id Millepora host_name Millepora sp host_species_id sp latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 93_M local_sample_id GN_Out_Mil_sp_L31_20150125_M longitude 145.4665 n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name hydrozoans ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup y parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter_universal 0.591397849 prop_colony_maximum_gcmp_recorded 0.591397849 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.Out.Mil.sp.2.20150125.M sample type Millepora Mucus sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock648_093_M shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector substrate Sand. symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 51117 taxonomy_string_to_clade Cnidaria_Hydrozoa_Anthoathecata_Milleporidae taxonomy_string_to_class Cnidaria_Hydrozoa taxonomy_string_to_family Cnidaria_Hydrozoa_Anthoathecata_Milleporidae taxonomy_string_to_order Cnidaria_Hydrozoa_Anthoathecata taxonomy_string_to_subclass Cnidaria_Hydrozoa_Leptolinae temperature 29 tissue compartment M visibility 15 visibility_method Diver Estimate ERS2655048 SAMEA4835178 496922 coral metagenome Coral Mucus from Porites cylindrica sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.3.Por.cyli.L33.20150127.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:43Z External Id SAMEA4835178 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:43Z INSDC status public Submitter Id E3.3.Por.cyli.1.20150127.M abundance gbr common abundance world common algal_contact_types Unidentified_red_fleshy_algae barcodesequence GTCGGTCTGA binary_algal_contact y binary_disease n binary_macroalgal_contact y biologicalmatter Coral Mucus collected by Joe Pollock collection date 2015 collection id Trawler_20150127 collection time 14:40 collection_timestamp 1/27/15 14:40 coloniality colonial colony maximum diameter 1000 colony maximum diameter unit cm colony_maximum_diameter 1000 colony_maximum_diameter_universal 1000 colony_maximum_gcmp_recorded 220 colony_name E3.3.Por.cyli.1.20150127 compartment_replicates 1 complex_robust complex concatenated_date 20150127 contact_description Sand Some red algea at base corallite width maximum 1.1 corallite width maximum unit mm corallite width minimum 0.8 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 1/27/15 depth 4.5 depth lower 20 depth lower unit m depth upper 1 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -170.6131631 env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E3 family Poritidae field_host_genus_id Porites field_host_name Porites cylindrica field_host_species_id cylindrica full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_III_Porites_cylindrica functional_group_sensu_darling Weedy genus fossil age 55.8 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 growth form typical encrusting_long_uprights hemisphere Southern host species cylindrica host_clade_sensu_fukami III host_clade_sensu_fukami_numeric 3 host_genus Porites host_genus_id Porites host_name Porites cylindrica host_species_id cylindrica huang_roy_tree_name POR_Porites_cylindrica iucn red list category NT latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 95_M local_sample_id GN_3_Por_cyli_L33_20150127_M longitude 145.4665 macroalgal_contact_types Unidentified_red_fleshy_algae mode of larval development spawner n_algal_contacts 1 n_macroalgal_contacts 1 ncbi_inherited_blast_name stony corals northern-most range edge 36.76112236 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 231 oocyte size at maturity unit um outgroup n oz_disease_mean 0 oz_disease_sd 0 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.1 prop_colony_maximum_diameter_universal 0.1 prop_colony_maximum_gcmp_recorded 0.454545455 propagule size on release mean 250 propagule size on release mean unit um range size 70707476.82 range size unit km^2 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.3.Por.cyli.1.20150127.M sample type Coral Mucus sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock649_095_M sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector skeletal density 1.42 skeletal density unit g cm-3 southern-most range edge -32.13441332 species age phylogeny 1.811871403 species age phylogeny unit mya substrate Sand. Some red algea at base. substrate attachment attached symbio_its2_sequenced n symbiodinium sp. in propagules yes target gene 16S target subfragment V4 taxon id 126659 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_III taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Poritidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 29 tissue compartment M visibility 15 visibility_method Diver Estimate water clarity preference clear wave exposure preference protected western-most range edge 33.9466006 zooxanthellate zooxanthellate ERS2655049 SAMEA4835179 496922 coral metagenome Coral Mucus from Lobophyllia sp sampled from Lizard Island, Australia as sample E1.19.Lob.sp1.20140809.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:44Z External Id SAMEA4835179 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:44Z INSDC status public Submitter Id E1.19.Lob.sp.1.20140809.M algal_contact_types turf__cyanobacteria barcodesequence TCGAGTAGCG binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Mucus cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Horseshoe_20140809 collection time 10:20 collection_timestamp 8/9/14 10:20 colony_height_m 10 colony_maximum_diameter_universal 30 colony_maximum_gcmp_recorded 30 colony_name E1.19.Lob.sp.1.20140809 colony_width1 30 colony_width2 22 compartment_replicates 1 complex_robust robust concatenated_date 20140809 country Australia cyanobacteria_contact y cyanobacteria_percent 2 daily_replicate 1 date 8/9/14 depth 1.2192 depth_method measured disease_percent 0 dna_extracted y env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E1 family Lobophylliidae field_host_genus_id Lobophyllia field_host_name Lobophyllia sp field_host_species_id sp full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Horseshoe full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XIX_Lobophyllia_sp functional_group_sensu_darling Stress-tolerant geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68716 geographic location (longitude) 145.44449 hemisphere Southern host species sp host_clade_sensu_fukami XIX host_clade_sensu_fukami_numeric 19 host_genus Lobophyllia host_genus_id Lobophyllia host_name Lobophyllia sp host_species_id sp huang_roy_tree_name MUS_Lobophyllia latitude -14.68716 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Lobophyllia sp._20140809 local_sample_id Lob Muc 140809 longitude 145.44449 n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 1.150843254 oz_disease_sd 0.600366999 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter_universal 1 prop_colony_maximum_gcmp_recorded 1 reef_name Horseshoe reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.19.Lob.sp.1.20140809.M sample type Coral Mucus sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock65 shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector substrate rock symbio_its2_sequenced y target gene 16S target subfragment V4 taxon id 46757 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XIX taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Lobophylliidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.3 tissue compartment M tissue_loss_percent 0 turf_contact_percent 5 visibility 9 visibility_method Horizontal Secchi Disk ERS2655050 SAMEA4835180 496922 coral metagenome Coral Tissue from Symphyllia sp sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.19.Sym.spL34.20150127.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:44Z External Id SAMEA4835180 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:44Z INSDC status public Submitter Id E3.19.Sym.sp.1.20150127.T barcodesequence GATCCTGAGC binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Tissue collected by Joe Pollock collection date 2015 collection id Trawler_20150127 collection time 14:51 collection_timestamp 1/27/15 14:51 colony_maximum_diameter_universal 50 colony_maximum_gcmp_recorded 50 colony_name E3.19.Sym.sp.1.20150127 compartment_replicates 1 complex_robust robust concatenated_date 20150127 contact_description Rubble on reef flat country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 1/27/15 depth 1.3 depth_method measured disease_percent 0 dna_extracted y env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E3 family Lobophylliidae field_host_genus_id Symphyllia field_host_name Symphyllia sp field_host_species_id sp full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XIX_Symphyllia_sp geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 hemisphere Southern host species sp host_clade_sensu_fukami XIX host_clade_sensu_fukami_numeric 19 host_genus Symphyllia host_genus_id Symphyllia host_name Symphyllia sp host_species_id sp huang_roy_tree_name MUS_Symphyllia latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 96_T local_sample_id GN_19_Sym_sp_L34_20150127_T longitude 145.4665 n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.277777778 oz_disease_sd 0.277777778 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter_universal 0.9 prop_colony_maximum_gcmp_recorded 0.9 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.19.Sym.sp.1.20150127.T sample type Coral Tissue sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock650_096_T shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector substrate Rubble on reef flat. symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 242739 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XIX taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Lobophylliidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 29 tissue compartment T visibility 15 visibility_method Diver Estimate ERS2655051 SAMEA4835181 496922 coral metagenome Coral Mucus from Fungia sp sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.11.Fun.spL35.20150127.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:44Z External Id SAMEA4835181 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:44Z INSDC status public Submitter Id E3.11.Fun.sp.1.20150127.M barcodesequence TGGATGACAT binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Mucus collected by Joe Pollock collection date 2015 collection id Trawler_20150127 collection time 14:58 collection_timestamp 1/27/15 14:58 colony_maximum_diameter_universal 20 colony_maximum_gcmp_recorded 20 colony_name E3.11.Fun.sp.1.20150127 compartment_replicates 1 complex_robust robust concatenated_date 20150127 contact_description Rubble on reef flat country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 1/27/15 depth 1.5 depth_method measured disease_percent 0 dna_extracted y env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E3 family Fungiidae field_host_genus_id Fungia field_host_name Fungia sp field_host_species_id sp full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XI_Fungia_sp functional_group_sensu_darling Stress-tolerant geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 hemisphere Southern host species sp host_clade_sensu_fukami XI host_clade_sensu_fukami_numeric 11 host_genus Fungia host_genus_id Fungia host_name Fungia sp host_species_id sp huang_roy_tree_name FUN latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 97_M local_sample_id GN_11_Fun_sp_L35_20150127_M longitude 145.4665 n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.078431373 oz_disease_sd 0.078431373 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter_universal 0.6 prop_colony_maximum_gcmp_recorded 0.6 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.11.Fun.sp.1.20150127.M sample type Coral Mucus sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock651_097_M shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector substrate Rubble on reef flat. symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 46712 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XI taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Fungiidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 29 tissue compartment M visibility 15 visibility_method Diver Estimate ERS2655052 SAMEA4835182 496922 coral metagenome Coral Skeleton from Stylophora pistillata sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.X.Sty.pist.L37.20150127.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:44Z External Id SAMEA4835182 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:44Z INSDC status public Submitter Id E3.10.Sty.pist.1.20150127.S abundance gbr common abundance world common barcodesequence CACTTGTGTG binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Skeleton collected by Joe Pollock collection date 2015 collection id Trawler_20150127 collection time 15:20 collection_timestamp 1/27/15 15:20 coloniality colonial colony_maximum_diameter_universal 40 colony_maximum_gcmp_recorded 40 colony_name E3.10.Sty.pist.1.20150127 compartment_replicates 1 complex_robust robust concatenated_date 20150127 contact_description Rubble on reef flat Somewhat pale corallite width maximum 1.4 corallite width maximum unit mm corallite width minimum 0.9 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 1/27/15 depth 1.5 depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -136.8753767 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E3 family Pocilloporidae field_host_genus_id Stylophora field_host_name Stylophora pistillata field_host_species_id pistillata full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_X_Stylophora_pistillata functional_group_sensu_darling Weedy genus fossil age 65.5 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 growth form typical branching_closed hemisphere Southern host species pistillata host_clade_sensu_fukami X host_clade_sensu_fukami_numeric 10 host_genus Stylophora host_genus_id Stylophora host_name Stylophora pistillata host_species_id pistillata huang_roy_tree_name POC_Stylophora iucn red list category NT latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 99_S local_sample_id GN_X_Sty_pist_L37_20150127_S longitude 145.4665 mode of larval development brooder n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 37.59605597 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 3.135283206 oz_disease_sd 1.53794235 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter_universal 0.55 prop_colony_maximum_gcmp_recorded 0.55 range size 93217615.57 range size unit km^2 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.10.Sty.pist.1.20150127.S sample type Coral Skeleton sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock652_099_S sexual system hermaphrodite shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector skeletal density 1.7031045 skeletal density unit g cm-3 southern-most range edge -35.16725933 species age phylogeny 1.035433103 species age phylogeny unit mya substrate Rubble on reef flat. Somewhat pale substrate attachment attached symbio_its2_sequenced n symbiodinium sp. in propagules yes target gene 16S target subfragment V4 taxon id 50429 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_X taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Pocilloporidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 29 tissue compartment S visibility 15 visibility_method Diver Estimate water clarity preference clear wave exposure preference exposed western-most range edge 27.7376321 zooxanthellate zooxanthellate ERS2655053 SAMEA4835183 496922 coral metagenome Coral Tissue from Stylophora pistillata sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.X.Sty.pist.L37.20150127.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:44Z External Id SAMEA4835183 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:44Z INSDC status public Submitter Id E3.10.Sty.pist.1.20150127.T abundance gbr common abundance world common barcodesequence CTGTTCTAGC binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Tissue collected by Joe Pollock collection date 2015 collection id Trawler_20150127 collection time 15:20 collection_timestamp 1/27/15 15:20 coloniality colonial colony_maximum_diameter_universal 40 colony_maximum_gcmp_recorded 40 colony_name E3.10.Sty.pist.1.20150127 compartment_replicates 1 complex_robust robust concatenated_date 20150127 contact_description Rubble on reef flat Somewhat pale corallite width maximum 1.4 corallite width maximum unit mm corallite width minimum 0.9 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 1/27/15 depth 1.5 depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -136.8753767 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E3 family Pocilloporidae field_host_genus_id Stylophora field_host_name Stylophora pistillata field_host_species_id pistillata full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_X_Stylophora_pistillata functional_group_sensu_darling Weedy genus fossil age 65.5 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 growth form typical branching_closed hemisphere Southern host species pistillata host_clade_sensu_fukami X host_clade_sensu_fukami_numeric 10 host_genus Stylophora host_genus_id Stylophora host_name Stylophora pistillata host_species_id pistillata huang_roy_tree_name POC_Stylophora iucn red list category NT latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 99_T local_sample_id GN_X_Sty_pist_L37_20150127_T longitude 145.4665 mode of larval development brooder n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 37.59605597 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 3.135283206 oz_disease_sd 1.53794235 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter_universal 0.55 prop_colony_maximum_gcmp_recorded 0.55 range size 93217615.57 range size unit km^2 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.10.Sty.pist.1.20150127.T sample type Coral Tissue sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock653_099_T sexual system hermaphrodite shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector skeletal density 1.7031045 skeletal density unit g cm-3 southern-most range edge -35.16725933 species age phylogeny 1.035433103 species age phylogeny unit mya substrate Rubble on reef flat. Somewhat pale substrate attachment attached symbio_its2_sequenced n symbiodinium sp. in propagules yes target gene 16S target subfragment V4 taxon id 50429 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_X taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Pocilloporidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 29 tissue compartment T visibility 15 visibility_method Diver Estimate water clarity preference clear wave exposure preference exposed western-most range edge 27.7376321 zooxanthellate zooxanthellate ERS2655054 SAMEA4835184 496922 coral metagenome Coral Skeleton from Galaxea astreata sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.5.Gal.astr.L39.20150127.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:44Z External Id SAMEA4835184 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:44Z INSDC status public Submitter Id E3.5.Gal.astr.2.20150127.S abundance gbr common abundance world common barcodesequence CTGCGAATGT binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Skeleton collected by Joe Pollock collection date 2015 collection id Trawler_20150127 collection time 15:38 collection_timestamp 1/27/15 15:38 coloniality colonial colony maximum diameter 200 colony maximum diameter unit cm colony_maximum_diameter 200 colony_maximum_diameter_universal 200 colony_maximum_gcmp_recorded 35 colony_name E3.5.Gal.astr.2.20150127 compartment_replicates 1 complex_robust complex concatenated_date 20150127 contact_description Attached to massive Porites corallite width maximum 3.7 corallite width maximum unit mm corallite width minimum 3.4 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 2 date 1/27/15 depth 2.2 depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -168.0535591 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E3 family Euphylliidae field_host_genus_id Galaxea field_host_name Galaxea astreata field_host_species_id astreata full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_V_Galaxea_astreata functional_group_sensu_darling Stress-tolerant genus fossil age 23.03 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 growth form typical submassive hemisphere Southern host species astreata host_clade_sensu_fukami V host_clade_sensu_fukami_numeric 5 host_genus Galaxea host_genus_id Galaxea host_name Galaxea astreata host_species_id astreata huang_roy_tree_name OCU_Galaxea_astreata iucn red list category VU latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 101_S local_sample_id GN_5_Gal_astr_L39_20150127_S longitude 145.4665 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 37.11571178 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.258673969 oz_disease_sd 0.173267011 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.055 prop_colony_maximum_diameter_universal 0.055 prop_colony_maximum_gcmp_recorded 0.314285714 range size 72703639.29 range size unit km^2 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.5.Gal.astr.2.20150127.S sample type Coral Skeleton sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock654_101_S sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -32.22433312 species age phylogeny 0.518269449 species age phylogeny unit mya substrate Attached to massive Porites. substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 154325 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_V taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Euphylliidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 29 tissue compartment S visibility 15 visibility_method Diver Estimate water clarity preference turbid wave exposure preference protected western-most range edge 31.7398894 zooxanthellate zooxanthellate ERS2655055 SAMEA4835185 496922 coral metagenome Coral Tissue from Galaxea astreata sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.5.Gal.astr.L39.20150127.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:44Z External Id SAMEA4835185 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:44Z INSDC status public Submitter Id E3.5.Gal.astr.2.20150127.T abundance gbr common abundance world common barcodesequence TTGCAGATCA binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Tissue collected by Joe Pollock collection date 2015 collection id Trawler_20150127 collection time 15:38 collection_timestamp 1/27/15 15:38 coloniality colonial colony maximum diameter 200 colony maximum diameter unit cm colony_maximum_diameter 200 colony_maximum_diameter_universal 200 colony_maximum_gcmp_recorded 35 colony_name E3.5.Gal.astr.2.20150127 compartment_replicates 1 complex_robust complex concatenated_date 20150127 contact_description Attached to massive Porites corallite width maximum 3.7 corallite width maximum unit mm corallite width minimum 3.4 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 2 date 1/27/15 depth 2.2 depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -168.0535591 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E3 family Euphylliidae field_host_genus_id Galaxea field_host_name Galaxea astreata field_host_species_id astreata full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_V_Galaxea_astreata functional_group_sensu_darling Stress-tolerant genus fossil age 23.03 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 growth form typical submassive hemisphere Southern host species astreata host_clade_sensu_fukami V host_clade_sensu_fukami_numeric 5 host_genus Galaxea host_genus_id Galaxea host_name Galaxea astreata host_species_id astreata huang_roy_tree_name OCU_Galaxea_astreata iucn red list category VU latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 101_T local_sample_id GN_5_Gal_astr_L39_20150127_T longitude 145.4665 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 37.11571178 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.258673969 oz_disease_sd 0.173267011 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.055 prop_colony_maximum_diameter_universal 0.055 prop_colony_maximum_gcmp_recorded 0.314285714 range size 72703639.29 range size unit km^2 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.5.Gal.astr.2.20150127.T sample type Coral Tissue sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock655_101_T sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -32.22433312 species age phylogeny 0.518269449 species age phylogeny unit mya substrate Attached to massive Porites. substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 154325 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_V taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Euphylliidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 29 tissue compartment T visibility 15 visibility_method Diver Estimate water clarity preference turbid wave exposure preference protected western-most range edge 31.7398894 zooxanthellate zooxanthellate ERS2655056 SAMEA4835186 496922 coral metagenome Coral Mucus from Galaxea astreata sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.5.Gal.astr.L39.20150127.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:44Z External Id SAMEA4835186 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:44Z INSDC status public Submitter Id E3.5.Gal.astr.2.20150127.M abundance gbr common abundance world common barcodesequence CTAAGTCATG binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Mucus collected by Joe Pollock collection date 2015 collection id Trawler_20150127 collection time 15:38 collection_timestamp 1/27/15 15:38 coloniality colonial colony maximum diameter 200 colony maximum diameter unit cm colony_maximum_diameter 200 colony_maximum_diameter_universal 200 colony_maximum_gcmp_recorded 35 colony_name E3.5.Gal.astr.2.20150127 compartment_replicates 1 complex_robust complex concatenated_date 20150127 contact_description Attached to massive Porites corallite width maximum 3.7 corallite width maximum unit mm corallite width minimum 3.4 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 2 date 1/27/15 depth 2.2 depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -168.0535591 env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E3 family Euphylliidae field_host_genus_id Galaxea field_host_name Galaxea astreata field_host_species_id astreata full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_V_Galaxea_astreata functional_group_sensu_darling Stress-tolerant genus fossil age 23.03 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 growth form typical submassive hemisphere Southern host species astreata host_clade_sensu_fukami V host_clade_sensu_fukami_numeric 5 host_genus Galaxea host_genus_id Galaxea host_name Galaxea astreata host_species_id astreata huang_roy_tree_name OCU_Galaxea_astreata iucn red list category VU latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 101_M local_sample_id GN_5_Gal_astr_L39_20150127_M longitude 145.4665 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 37.11571178 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.258673969 oz_disease_sd 0.173267011 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.055 prop_colony_maximum_diameter_universal 0.055 prop_colony_maximum_gcmp_recorded 0.314285714 range size 72703639.29 range size unit km^2 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.5.Gal.astr.2.20150127.M sample type Coral Mucus sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock656_101_M sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -32.22433312 species age phylogeny 0.518269449 species age phylogeny unit mya substrate Attached to massive Porites. substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 154325 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_V taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Euphylliidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 29 tissue compartment M visibility 15 visibility_method Diver Estimate water clarity preference turbid wave exposure preference protected western-most range edge 31.7398894 zooxanthellate zooxanthellate ERS2655057 SAMEA4835187 496922 coral metagenome Coral Skeleton from Turbinaria reniformis sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.2.Tur.reni.L40.20150127.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:44Z External Id SAMEA4835187 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:44Z INSDC status public Submitter Id E3.2.Tur.reni.1.20150127.S abundance gbr common abundance world uncommon algal_contact_types Unidentified_red_fleshy_algae barcodesequence TTCGTTCCTG binary_algal_contact y binary_disease n binary_macroalgal_contact y biologicalmatter Coral Skeleton collected by Joe Pollock collection date 2015 collection id Trawler_20150127 collection time 15:51 collection_timestamp 1/27/15 15:51 coloniality colonial colony maximum diameter 500 colony maximum diameter unit cm colony_maximum_diameter 500 colony_maximum_diameter_universal 500 colony_maximum_gcmp_recorded 230 colony_name E3.2.Tur.reni.1.20150127 compartment_replicates 1 complex_robust complex concatenated_date 20150127 contact_description Reef flat Surrounded by soft coral Ref fleshy algae also in contact corallite width maximum 4.2 corallite width maximum unit mm corallite width minimum 2.8 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 1/27/15 depth 1.5 depth lower 15 depth lower unit m depth upper 2 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -136.9957288 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E3 family Dendrophylliidae field_host_genus_id Turbinaria field_host_name Turbinaria reniformis field_host_species_id reniformis full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_II_Turbinaria_reniformis genus fossil age 28.4 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 growth form typical laminar hemisphere Southern host species reniformis host_clade_sensu_fukami II host_clade_sensu_fukami_numeric 2 host_genus Turbinaria host_genus_id Turbinaria host_name Turbinaria reniformis host_species_id reniformis huang_roy_tree_name DEN_Turbinaria iucn red list category VU latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 102_S local_sample_id GN_2_Tur_reni_L40_20150127_S longitude 145.4665 macroalgal_contact_types Unidentified_red_fleshy_algae mode of larval development spawner n_algal_contacts 1 n_macroalgal_contacts 1 ncbi_inherited_blast_name stony corals northern-most range edge 36.21196191 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.44973545 oz_disease_sd 0.44973545 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.03 prop_colony_maximum_diameter_universal 0.03 prop_colony_maximum_gcmp_recorded 0.065217391 range size 90605636.14 range size unit km^2 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.2.Tur.reni.1.20150127.S sample type Coral Skeleton sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock657_102_S sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -37.43026469 species age phylogeny 0.876113954 species age phylogeny unit mya substrate Reef flat. Surrounded by soft coral. Ref fleshy algae also in contact. substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 1381352 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_II taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Dendrophylliidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 29 tissue compartment S visibility 15 visibility_method Diver Estimate water clarity preference turbid wave exposure preference protected western-most range edge 31.6765571 zooxanthellate zooxanthellate ERS2655058 SAMEA4835188 496922 coral metagenome Coral Tissue from Turbinaria reniformis sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.2.Tur.reni.L40.20150127.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:44Z External Id SAMEA4835188 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:44Z INSDC status public Submitter Id E3.2.Tur.reni.1.20150127.T abundance gbr common abundance world uncommon algal_contact_types Unidentified_red_fleshy_algae barcodesequence TTACGCAGTG binary_algal_contact y binary_disease n binary_macroalgal_contact y biologicalmatter Coral Tissue collected by Joe Pollock collection date 2015 collection id Trawler_20150127 collection time 15:51 collection_timestamp 1/27/15 15:51 coloniality colonial colony maximum diameter 500 colony maximum diameter unit cm colony_maximum_diameter 500 colony_maximum_diameter_universal 500 colony_maximum_gcmp_recorded 230 colony_name E3.2.Tur.reni.1.20150127 compartment_replicates 1 complex_robust complex concatenated_date 20150127 contact_description Reef flat Surrounded by soft coral Ref fleshy algae also in contact corallite width maximum 4.2 corallite width maximum unit mm corallite width minimum 2.8 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 1/27/15 depth 1.5 depth lower 15 depth lower unit m depth upper 2 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -136.9957288 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E3 family Dendrophylliidae field_host_genus_id Turbinaria field_host_name Turbinaria reniformis field_host_species_id reniformis full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_II_Turbinaria_reniformis genus fossil age 28.4 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 growth form typical laminar hemisphere Southern host species reniformis host_clade_sensu_fukami II host_clade_sensu_fukami_numeric 2 host_genus Turbinaria host_genus_id Turbinaria host_name Turbinaria reniformis host_species_id reniformis huang_roy_tree_name DEN_Turbinaria iucn red list category VU latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 102_T local_sample_id GN_2_Tur_reni_L40_20150127_T longitude 145.4665 macroalgal_contact_types Unidentified_red_fleshy_algae mode of larval development spawner n_algal_contacts 1 n_macroalgal_contacts 1 ncbi_inherited_blast_name stony corals northern-most range edge 36.21196191 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.44973545 oz_disease_sd 0.44973545 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.03 prop_colony_maximum_diameter_universal 0.03 prop_colony_maximum_gcmp_recorded 0.065217391 range size 90605636.14 range size unit km^2 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.2.Tur.reni.1.20150127.T sample type Coral Tissue sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock658_102_T sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -37.43026469 species age phylogeny 0.876113954 species age phylogeny unit mya substrate Reef flat. Surrounded by soft coral. Ref fleshy algae also in contact. substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 1381352 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_II taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Dendrophylliidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 29 tissue compartment T visibility 15 visibility_method Diver Estimate water clarity preference turbid wave exposure preference protected western-most range edge 31.6765571 zooxanthellate zooxanthellate ERS2655059 SAMEA4835189 496922 coral metagenome Coral Mucus from Turbinaria reniformis sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.2.Tur.reni.L40.20150127.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:44Z External Id SAMEA4835189 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:44Z INSDC status public Submitter Id E3.2.Tur.reni.1.20150127.M abundance gbr common abundance world uncommon algal_contact_types Unidentified_red_fleshy_algae barcodesequence CAGATGTCCT binary_algal_contact y binary_disease n binary_macroalgal_contact y biologicalmatter Coral Mucus collected by Joe Pollock collection date 2015 collection id Trawler_20150127 collection time 15:51 collection_timestamp 1/27/15 15:51 coloniality colonial colony maximum diameter 500 colony maximum diameter unit cm colony_maximum_diameter 500 colony_maximum_diameter_universal 500 colony_maximum_gcmp_recorded 230 colony_name E3.2.Tur.reni.1.20150127 compartment_replicates 1 complex_robust complex concatenated_date 20150127 contact_description Reef flat Surrounded by soft coral Ref fleshy algae also in contact corallite width maximum 4.2 corallite width maximum unit mm corallite width minimum 2.8 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 1/27/15 depth 1.5 depth lower 15 depth lower unit m depth upper 2 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -136.9957288 env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E3 family Dendrophylliidae field_host_genus_id Turbinaria field_host_name Turbinaria reniformis field_host_species_id reniformis full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_II_Turbinaria_reniformis genus fossil age 28.4 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 growth form typical laminar hemisphere Southern host species reniformis host_clade_sensu_fukami II host_clade_sensu_fukami_numeric 2 host_genus Turbinaria host_genus_id Turbinaria host_name Turbinaria reniformis host_species_id reniformis huang_roy_tree_name DEN_Turbinaria iucn red list category VU latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 102_M local_sample_id GN_2_Tur_reni_L40_20150127_M longitude 145.4665 macroalgal_contact_types Unidentified_red_fleshy_algae mode of larval development spawner n_algal_contacts 1 n_macroalgal_contacts 1 ncbi_inherited_blast_name stony corals northern-most range edge 36.21196191 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.44973545 oz_disease_sd 0.44973545 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.03 prop_colony_maximum_diameter_universal 0.03 prop_colony_maximum_gcmp_recorded 0.065217391 range size 90605636.14 range size unit km^2 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.2.Tur.reni.1.20150127.M sample type Coral Mucus sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock659_102_M sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -37.43026469 species age phylogeny 0.876113954 species age phylogeny unit mya substrate Reef flat. Surrounded by soft coral. Ref fleshy algae also in contact. substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 1381352 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_II taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Dendrophylliidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 29 tissue compartment M visibility 15 visibility_method Diver Estimate water clarity preference turbid wave exposure preference protected western-most range edge 31.6765571 zooxanthellate zooxanthellate ERS2655060 SAMEA4835190 496922 coral metagenome Coral Tissue from Lobophyllia sp sampled from Lizard Island, Australia as sample E1.19.Lob.sp1.20140809.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:44Z External Id SAMEA4835190 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:44Z INSDC status public Submitter Id E1.19.Lob.sp.1.20140809.T algal_contact_types turf__cyanobacteria barcodesequence GTGACTCGTC binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Tissue cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Horseshoe_20140809 collection time 10:20 collection_timestamp 8/9/14 10:20 colony_height_m 10 colony_maximum_diameter_universal 30 colony_maximum_gcmp_recorded 30 colony_name E1.19.Lob.sp.1.20140809 colony_width1 30 colony_width2 22 compartment_replicates 1 complex_robust robust concatenated_date 20140809 country Australia cyanobacteria_contact y cyanobacteria_percent 2 daily_replicate 1 date 8/9/14 depth 1.2192 depth_method measured disease_percent 0 dna_extracted y env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E1 family Lobophylliidae field_host_genus_id Lobophyllia field_host_name Lobophyllia sp field_host_species_id sp full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Horseshoe full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XIX_Lobophyllia_sp functional_group_sensu_darling Stress-tolerant geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68716 geographic location (longitude) 145.44449 hemisphere Southern host species sp host_clade_sensu_fukami XIX host_clade_sensu_fukami_numeric 19 host_genus Lobophyllia host_genus_id Lobophyllia host_name Lobophyllia sp host_species_id sp huang_roy_tree_name MUS_Lobophyllia latitude -14.68716 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Lobophyllia sp._20140809 local_sample_id Lob Tis 140809 longitude 145.44449 n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 1.150843254 oz_disease_sd 0.600366999 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter_universal 1 prop_colony_maximum_gcmp_recorded 1 reef_name Horseshoe reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.19.Lob.sp.1.20140809.T sample type Coral Tissue sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock66 shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector substrate rock symbio_its2_sequenced y target gene 16S target subfragment V4 taxon id 46757 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XIX taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Lobophylliidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.3 tissue compartment T tissue_loss_percent 0 turf_contact_percent 5 visibility 9 visibility_method Horizontal Secchi Disk ERS2655061 SAMEA4835191 496922 coral metagenome Coral Skeleton from Echinopora mammiformis sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.17.Ech.mamm.L41.20150127.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:44Z External Id SAMEA4835191 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:44Z INSDC status public Submitter Id E3.17.Ech.mamm.1.20150127.S abundance gbr common abundance world common barcodesequence TAGCTTCACT binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Skeleton collected by Joe Pollock collection date 2015 collection id Trawler_20150127 collection time 16:03 collection_timestamp 1/27/15 16:03 coloniality colonial colony maximum diameter 500 colony maximum diameter unit cm colony_maximum_diameter 500 colony_maximum_diameter_universal 500 colony_maximum_gcmp_recorded 200 colony_name E3.17.Ech.mamm.1.20150127 compartment_replicates 1 complex_robust robust concatenated_date 20150127 contact_description Sand at reef edge corallite width maximum 8.9 corallite width maximum unit mm corallite width minimum 6.1 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 1/27/15 depth 2 depth lower 15 depth lower unit m depth upper 3 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -170.3991819 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E3 family Merulinidae field_host_genus_id Echinopora field_host_name Echinopora mammiformis field_host_species_id mammiformis full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XVII_Echinopora_mammiformis genus fossil age 15.97 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 growth form typical encrusting_long_uprights hemisphere Southern host species mammiformis host_clade_sensu_fukami XVII host_clade_sensu_fukami_numeric 17 host_genus Echinopora host_genus_id Echinopora host_name Echinopora mammiformis host_species_id mammiformis huang_roy_tree_name FAV_Echinopora_mammiformis iucn red list category NT latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 103_S local_sample_id GN_17_Ech_mamm_L41_20150127_S longitude 145.4665 n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 27.77323748 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.291126819 oz_disease_sd 0.143241468 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.16 prop_colony_maximum_diameter_universal 0.16 prop_colony_maximum_gcmp_recorded 0.4 range size 44919196.15 range size unit km^2 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.17.Ech.mamm.1.20150127.S sample type Coral Skeleton sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock660_103_S shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -33.67557655 species age phylogeny 9.390921099 species age phylogeny unit mya substrate Sand at reef edge. substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 983565 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XVII taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Merulinidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 29 tissue compartment S visibility 15 visibility_method Diver Estimate water clarity preference clear wave exposure preference protected western-most range edge 38.8486452 zooxanthellate zooxanthellate ERS2655062 SAMEA4835192 496922 coral metagenome Coral Tissue from Echinopora mammiformis sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.17.Ech.mamm.L41.20150127.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:44Z External Id SAMEA4835192 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:44Z INSDC status public Submitter Id E3.17.Ech.mamm.1.20150127.T abundance gbr common abundance world common barcodesequence CAGGCTCAGT binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Tissue collected by Joe Pollock collection date 2015 collection id Trawler_20150127 collection time 16:03 collection_timestamp 1/27/15 16:03 coloniality colonial colony maximum diameter 500 colony maximum diameter unit cm colony_maximum_diameter 500 colony_maximum_diameter_universal 500 colony_maximum_gcmp_recorded 200 colony_name E3.17.Ech.mamm.1.20150127 compartment_replicates 1 complex_robust robust concatenated_date 20150127 contact_description Sand at reef edge corallite width maximum 8.9 corallite width maximum unit mm corallite width minimum 6.1 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 1/27/15 depth 2 depth lower 15 depth lower unit m depth upper 3 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -170.3991819 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E3 family Merulinidae field_host_genus_id Echinopora field_host_name Echinopora mammiformis field_host_species_id mammiformis full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XVII_Echinopora_mammiformis genus fossil age 15.97 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 growth form typical encrusting_long_uprights hemisphere Southern host species mammiformis host_clade_sensu_fukami XVII host_clade_sensu_fukami_numeric 17 host_genus Echinopora host_genus_id Echinopora host_name Echinopora mammiformis host_species_id mammiformis huang_roy_tree_name FAV_Echinopora_mammiformis iucn red list category NT latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 103_T local_sample_id GN_17_Ech_mamm_L41_20150127_T longitude 145.4665 n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 27.77323748 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.291126819 oz_disease_sd 0.143241468 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.16 prop_colony_maximum_diameter_universal 0.16 prop_colony_maximum_gcmp_recorded 0.4 range size 44919196.15 range size unit km^2 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.17.Ech.mamm.1.20150127.T sample type Coral Tissue sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock661_103_T shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -33.67557655 species age phylogeny 9.390921099 species age phylogeny unit mya substrate Sand at reef edge. substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 983565 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XVII taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Merulinidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 29 tissue compartment T visibility 15 visibility_method Diver Estimate water clarity preference clear wave exposure preference protected western-most range edge 38.8486452 zooxanthellate zooxanthellate ERS2655063 SAMEA4835193 496922 coral metagenome Coral Mucus from Echinopora mammiformis sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.17.Ech.mamm.L41.20150127.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:44Z External Id SAMEA4835193 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:44Z INSDC status public Submitter Id E3.17.Ech.mamm.1.20150127.M abundance gbr common abundance world common barcodesequence GGTCGTGCAT binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Mucus collected by Joe Pollock collection date 2015 collection id Trawler_20150127 collection time 16:03 collection_timestamp 1/27/15 16:03 coloniality colonial colony maximum diameter 500 colony maximum diameter unit cm colony_maximum_diameter 500 colony_maximum_diameter_universal 500 colony_maximum_gcmp_recorded 200 colony_name E3.17.Ech.mamm.1.20150127 compartment_replicates 1 complex_robust robust concatenated_date 20150127 contact_description Sand at reef edge corallite width maximum 8.9 corallite width maximum unit mm corallite width minimum 6.1 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 1/27/15 depth 2 depth lower 15 depth lower unit m depth upper 3 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -170.3991819 env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E3 family Merulinidae field_host_genus_id Echinopora field_host_name Echinopora mammiformis field_host_species_id mammiformis full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XVII_Echinopora_mammiformis genus fossil age 15.97 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 growth form typical encrusting_long_uprights hemisphere Southern host species mammiformis host_clade_sensu_fukami XVII host_clade_sensu_fukami_numeric 17 host_genus Echinopora host_genus_id Echinopora host_name Echinopora mammiformis host_species_id mammiformis huang_roy_tree_name FAV_Echinopora_mammiformis iucn red list category NT latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 103_M local_sample_id GN_17_Ech_mamm_L41_20150127_M longitude 145.4665 n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 27.77323748 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.291126819 oz_disease_sd 0.143241468 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.16 prop_colony_maximum_diameter_universal 0.16 prop_colony_maximum_gcmp_recorded 0.4 range size 44919196.15 range size unit km^2 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.17.Ech.mamm.1.20150127.M sample type Coral Mucus sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock662_103_M shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -33.67557655 species age phylogeny 9.390921099 species age phylogeny unit mya substrate Sand at reef edge. substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 983565 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XVII taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Merulinidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 29 tissue compartment M visibility 15 visibility_method Diver Estimate water clarity preference clear wave exposure preference protected western-most range edge 38.8486452 zooxanthellate zooxanthellate ERS2655064 SAMEA4835194 496922 coral metagenome Coral Tissue from Pachyseris rugosa sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.4.Pac.rugo.L42.20150128.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:44Z External Id SAMEA4835194 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:44Z INSDC status public Submitter Id E3.4.Pac.rugo.1.20150128.T abundance gbr common abundance world common barcodesequence GTCTTGGCTC binary_algal_contact n binary_disease y binary_macroalgal_contact n binary_tissue_loss y biologicalmatter Coral Tissue collected by Joe Pollock collection date 2015 collection id Trawler_20150128 collection time 16:06 collection_timestamp 1/28/15 16:06 coloniality colonial colony maximum diameter 100 colony maximum diameter unit cm colony_maximum_diameter 100 colony_maximum_diameter_universal 400 colony_maximum_gcmp_recorded 400 colony_name E3.4.Pac.rugo.1.20150128 compartment_replicates 1 complex_robust complex concatenated_date 20150128 contact_description Rubble at reef edge HUGE colony Some parts had tissue loss related to SEB disease Sampled well 1m away from site of tissue loss corallite width maximum 4.8 corallite width maximum unit mm corallite width minimum 2.2 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 1/28/15 depth 3 depth lower 20 depth lower unit m depth upper 5 depth upper unit m depth_method measured disease_name SEB Disease dna_extracted y eastern-most range edge -176.1319621 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E3 family Agariciidae field_host_genus_id Pachyseris field_host_name Pachyseris rugosa field_host_species_id rugosa full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_IV_Pachyseris_rugosa functional_group_sensu_darling Generalist genus fossil age 33.9 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.686768 geographic location (longitude) 145.4665 growth form typical laminar hemisphere Southern host species rugosa host_clade_sensu_fukami IV host_clade_sensu_fukami_numeric 4 host_genus Pachyseris host_genus_id Pachyseris host_name Pachyseris rugosa host_species_id rugosa huang_roy_tree_name AGA_Pachyseris iucn red list category VU latitude -14.686768 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 105_T local_sample_id GN_4_Pac_rugo_L42_20150128_T longitude 145.4665 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 31.00815214 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 339 oocyte size at maturity unit um outgroup n oz_disease_mean 0 oz_disease_sd 0 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 2.5 prop_colony_maximum_diameter_universal 0.625 prop_colony_maximum_gcmp_recorded 0.625 range size 60586224.82 range size unit km^2 reef_name Trawler reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.4.Pac.rugo.1.20150128.T sample type Coral Tissue sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock663_105_T sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -27.86238998 species age phylogeny 1.524518009 species age phylogeny unit mya substrate Rubble at reef edge. HUGE colony. Some parts had tissue loss related to SEB disease. Sampled well ..1m. away from site of tissue loss. substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 1518537 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_IV taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Agariciidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 28 tissue compartment T visibility 15 visibility_method Diver Estimate water clarity preference turbid wave exposure preference broad western-most range edge 31.7723633 zooxanthellate zooxanthellate ERS2655065 SAMEA4835195 496922 coral metagenome Coral Tissue from Physogyra lichtensteini sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.14.Phy.lich.L46.20150129.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:45Z External Id SAMEA4835195 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:45Z INSDC status public Submitter Id E3.14.Phy.lich.1.20150129.T abundance gbr common abundance world common barcodesequence TGTTACGATC binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Tissue collected by Joe Pollock collection date 2015 collection id Lagoon Bommie_20150129 collection time 9:35 collection_timestamp 1/29/15 9:35 coloniality colonial colony maximum diameter 100 colony maximum diameter unit cm colony_maximum_diameter 100 colony_maximum_diameter_universal 100 colony_maximum_gcmp_recorded 80 colony_name E3.14.Phy.lich.1.20150129 compartment_replicates 1 complex_robust robust concatenated_date 20150129 contact_description Rubble n reef flat Mucus sample contains juice from inside of grapes corallite width maximum 20 corallite width maximum unit mm corallite width minimum 6 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 1/29/15 depth 2.1 depth lower 20 depth lower unit m depth upper 1 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -173.2615884 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E3 family incertae sedis field_host_genus_id Physogyra field_host_name Physogyra lichtensteini field_host_species_id lichtensteini full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Lagoon Bommie full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XIV_Physogyra_lichtensteini functional_group_sensu_darling Stress-tolerant genus fossil age 0.01 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.687533 geographic location (longitude) 145.465467 growth form typical massive hemisphere Southern host species lichtensteini host_clade_sensu_fukami XIV host_clade_sensu_fukami_numeric 14 host_genus Physogyra host_genus_id Physogyra host_name Physogyra lichtensteini host_species_id lichtensteini huang_roy_tree_name EUP_Physogyra_lichtensteini iucn red list category VU latitude -14.687533 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 109_T local_sample_id GN_14_Phy_lich_L46_20150129_T longitude 145.465467 n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 33.94501258 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0 oz_disease_sd 0 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 0.4 prop_colony_maximum_diameter_universal 0.4 prop_colony_maximum_gcmp_recorded 0.5 range size 78301486.65 range size unit km^2 reef_name Lagoon Bommie reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.14.Phy.lich.1.20150129.T sample type Coral Tissue sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock664_109_T shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -35.38256235 species age phylogeny 1.648875415 species age phylogeny unit mya substrate .Rubble n reef flat. Mucus sample contains ..juice.. from inside of ..grapes.... substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 419442 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XIV taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_incertae sedis taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 28 tissue compartment T visibility 15 visibility_method Diver Estimate water clarity preference turbid wave exposure preference protected western-most range edge 30.6437165 zooxanthellate zooxanthellate ERS2655066 SAMEA4835196 496922 coral metagenome Coral Skeleton from Pachyseris speciosa sampled from Great Barrier Reef - Northern Sector, Australia as sample E3.4.Pac.spe.L47.20150129.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:45Z External Id SAMEA4835196 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:45Z INSDC status public Submitter Id E3.4.Pac.spec.1.20150129.S abundance gbr common abundance world common barcodesequence GTGTTCGGTC binary_algal_contact n binary_disease n binary_macroalgal_contact n biologicalmatter Coral Skeleton collected by Joe Pollock collection date 2015 collection id Lagoon Bommie_20150129 collection time 9:50 collection_timestamp 1/29/15 9:50 coloniality colonial colony maximum diameter 2 colony maximum diameter unit cm colony_maximum_diameter 2 colony_maximum_diameter_universal 37 colony_maximum_gcmp_recorded 37 colony_name E3.4.Pac.spec.1.20150129 compartment_replicates 1 complex_robust complex concatenated_date 20150129 contact_description Reef edge/wall corallite width maximum 4.6 corallite width maximum unit mm corallite width minimum 2.4 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 1/29/15 depth 4.6 depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -140.3257694 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E3 family Agariciidae field_host_genus_id Pachyseris field_host_name Pachyseris speciosa field_host_species_id speciosa full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Lagoon Bommie full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_IV_Pachyseris_speciosa functional_group_sensu_darling Generalist genus fossil age 33.9 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.687533 geographic location (longitude) 145.465467 growth form typical laminar hemisphere Southern host species speciosa host_clade_sensu_fukami IV host_clade_sensu_fukami_numeric 4 host_genus Pachyseris host_genus_id Pachyseris host_name Pachyseris speciosa host_species_id speciosa huang_roy_tree_name AGA_Pachyseris iucn red list category LC latitude -14.687533 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name 110_S local_sample_id GN_4_Pac_spe_L47_20150129_S longitude 145.465467 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 36.65327262 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 314 oocyte size at maturity unit um outgroup n oz_disease_mean 0 oz_disease_sd 0 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia prop_colony_maximum_diameter 18.5 prop_colony_maximum_diameter_universal 1 prop_colony_maximum_gcmp_recorded 1 propagule size on release mean 368 propagule size on release mean unit um range size 84601943.66 range size unit km^2 reef_name Lagoon Bommie reef_type Midshelf Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid AN5UL sample name E3.4.Pac.spec.1.20150129.S sample type Coral Skeleton sampling_expedition E3_Lizard_Island_2015 scientific_name coral metagenome seagrass_contact n sequence_center_id Pollock665_110_S sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -34.47524539 species age phylogeny 1.559988321 species age phylogeny unit mya substrate Reef edge/wall. substrate attachment attached symbio_its2_sequenced n symbiodinium sp. in propagules no target gene 16S target subfragment V4 taxon id 497657 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_IV taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Agariciidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 27 tissue compartment S visibility 15 visibility_method Diver Estimate water clarity preference clear wave exposure preference broad western-most range edge 25.1595079 zooxanthellate zooxanthellate ERS2655067 SAMEA4835197 496922 coral metagenome Coral Tissue from Porites lobata sampled from Lizard Island, Australia as sample E1.3.Por.loba.1.20140724.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:45Z External Id SAMEA4835197 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:45Z INSDC status public Submitter Id E1.3.Por.loba.1.20140724.T abundance gbr common abundance world common algal_contact_types turf__cyanobacteria barcodesequence CTTACGTTGC binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss y binary_turf_contact y biologicalmatter Coral Tissue cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Lagoon entrance_20140724 collection time 11:23 collection_timestamp 7/24/14 11:23 coloniality colonial colony maximum diameter 400 colony maximum diameter unit cm colony_height_m 18 colony_maximum_diameter 400 colony_maximum_diameter_universal 400 colony_maximum_gcmp_recorded 318 colony_name E1.3.Por.loba.1.20140724 colony_width1 30 colony_width2 19 compartment_replicates 1 complex_robust complex concatenated_date 20140724 corallite width maximum 1.1 corallite width maximum unit mm corallite width minimum 0.9 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 10 daily_replicate 1 date 7/24/14 depth 2.4384 depth lower 30 depth lower unit m depth upper 0 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -74.99558841 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E1 family Poritidae field_host_genus_id Porites field_host_name Porites lobata field_host_species_id lobata full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Lagoon entrance full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_III_Porites_lobata functional_group_sensu_darling Stress-tolerant genus fossil age 55.8 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.689414 geographic location (longitude) 145.468137 growth form typical massive hemisphere Southern host species lobata host_clade_sensu_fukami III host_clade_sensu_fukami_numeric 3 host_genus Porites host_genus_id Porites host_name Porites lobata host_species_id lobata huang_roy_tree_name POR_Porites_lobata iucn red list category NT latitude -14.689414 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Porites lobata_20140724 local_sample_id Por Tis 140724 longitude 145.468137 mode of larval development spawner n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 37.1070332 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 208 oocyte size at maturity unit um outgroup n oz_disease_mean 0.702661735 oz_disease_sd 0.254208609 par_method buoy parrotfish_bites n pcr primers 515F/806R photosynthetically_active_radiation 600.663 physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter 0.075 prop_colony_maximum_diameter_universal 0.075 prop_colony_maximum_gcmp_recorded 0.094339623 range size 135900978.8 range size unit km^2 reef_name Lagoon entrance reef_type Crest backreef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.3.Por.loba.1.20140724.T sample type Coral Tissue sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock666_Por_Tis_140724 sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector skeletal density 1.375043478 skeletal density unit g cm-3 southern-most range edge -34.0380171 species age phylogeny 3.912556992 species age phylogeny unit mya substrate rock substrate attachment attached symbio_its2_sequenced n symbiodinium sp. in propagules yes target gene 16S target subfragment V4 taxon id 104759 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_III taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Poritidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 22.8 tissue compartment T tissue_loss_percent 5 turf_contact_percent 40 visibility 15 visibility_method Horizontal Secchi Disk water clarity preference clear wave exposure preference protected western-most range edge 31.8537507 zooxanthellate zooxanthellate ERS2655068 SAMEA4835198 496922 coral metagenome Coral Skeleton from Porites lobata sampled from Lizard Island, Australia as sample E1.3.Por.loba.1.20140724.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:45Z External Id SAMEA4835198 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:45Z INSDC status public Submitter Id E1.3.Por.loba.1.20140724.S abundance gbr common abundance world common algal_contact_types turf__cyanobacteria barcodesequence GGACAGATGG binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss y binary_turf_contact y biologicalmatter Coral Skeleton cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Lagoon entrance_20140724 collection time 11:23 collection_timestamp 7/24/14 11:23 coloniality colonial colony maximum diameter 400 colony maximum diameter unit cm colony_height_m 18 colony_maximum_diameter 400 colony_maximum_diameter_universal 400 colony_maximum_gcmp_recorded 318 colony_name E1.3.Por.loba.1.20140724 colony_width1 30 colony_width2 19 compartment_replicates 1 complex_robust complex concatenated_date 20140724 corallite width maximum 1.1 corallite width maximum unit mm corallite width minimum 0.9 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 10 daily_replicate 1 date 7/24/14 depth 2.4384 depth lower 30 depth lower unit m depth upper 0 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -74.99558841 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E1 family Poritidae field_host_genus_id Porites field_host_name Porites lobata field_host_species_id lobata full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Lagoon entrance full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_III_Porites_lobata functional_group_sensu_darling Stress-tolerant genus fossil age 55.8 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.689414 geographic location (longitude) 145.468137 growth form typical massive hemisphere Southern host species lobata host_clade_sensu_fukami III host_clade_sensu_fukami_numeric 3 host_genus Porites host_genus_id Porites host_name Porites lobata host_species_id lobata huang_roy_tree_name POR_Porites_lobata iucn red list category NT latitude -14.689414 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Porites lobata_20140724 local_sample_id Por Ske 140724 longitude 145.468137 mode of larval development spawner n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 37.1070332 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 208 oocyte size at maturity unit um outgroup n oz_disease_mean 0.702661735 oz_disease_sd 0.254208609 par_method buoy parrotfish_bites n pcr primers 515F/806R photosynthetically_active_radiation 600.663 physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter 0.075 prop_colony_maximum_diameter_universal 0.075 prop_colony_maximum_gcmp_recorded 0.094339623 range size 135900978.8 range size unit km^2 reef_name Lagoon entrance reef_type Crest backreef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.3.Por.loba.1.20140724.S sample type Coral Skeleton sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock667_Por_Ske_140724 sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector skeletal density 1.375043478 skeletal density unit g cm-3 southern-most range edge -34.0380171 species age phylogeny 3.912556992 species age phylogeny unit mya substrate rock substrate attachment attached symbio_its2_sequenced n symbiodinium sp. in propagules yes target gene 16S target subfragment V4 taxon id 104759 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_III taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Poritidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 22.8 tissue compartment S tissue_loss_percent 5 turf_contact_percent 40 visibility 15 visibility_method Horizontal Secchi Disk water clarity preference clear wave exposure preference protected western-most range edge 31.8537507 zooxanthellate zooxanthellate ERS2655069 SAMEA4835199 496922 coral metagenome Coral Mucus from Porites lobata sampled from Lizard Island, Australia as sample E1.3.Por.loba.1.20140724.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:45Z External Id SAMEA4835199 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:45Z INSDC status public Submitter Id E1.3.Por.loba.1.20140724.M abundance gbr common abundance world common algal_contact_types turf__cyanobacteria barcodesequence GAGATTGCTA binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss y binary_turf_contact y biologicalmatter Coral Mucus cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Lagoon entrance_20140724 collection time 11:23 collection_timestamp 7/24/14 11:23 coloniality colonial colony maximum diameter 400 colony maximum diameter unit cm colony_height_m 18 colony_maximum_diameter 400 colony_maximum_diameter_universal 400 colony_maximum_gcmp_recorded 318 colony_name E1.3.Por.loba.1.20140724 colony_width1 30 colony_width2 19 compartment_replicates 1 complex_robust complex concatenated_date 20140724 corallite width maximum 1.1 corallite width maximum unit mm corallite width minimum 0.9 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 10 daily_replicate 1 date 7/24/14 depth 2.4384 depth lower 30 depth lower unit m depth upper 0 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -74.99558841 env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E1 family Poritidae field_host_genus_id Porites field_host_name Porites lobata field_host_species_id lobata full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Lagoon entrance full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_III_Porites_lobata functional_group_sensu_darling Stress-tolerant genus fossil age 55.8 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.689414 geographic location (longitude) 145.468137 growth form typical massive hemisphere Southern host species lobata host_clade_sensu_fukami III host_clade_sensu_fukami_numeric 3 host_genus Porites host_genus_id Porites host_name Porites lobata host_species_id lobata huang_roy_tree_name POR_Porites_lobata iucn red list category NT latitude -14.689414 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Porites lobata_20140724 local_sample_id Por Muc 140724 longitude 145.468137 mode of larval development spawner n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 37.1070332 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 208 oocyte size at maturity unit um outgroup n oz_disease_mean 0.702661735 oz_disease_sd 0.254208609 par_method buoy parrotfish_bites n pcr primers 515F/806R photosynthetically_active_radiation 600.663 physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter 0.075 prop_colony_maximum_diameter_universal 0.075 prop_colony_maximum_gcmp_recorded 0.094339623 range size 135900978.8 range size unit km^2 reef_name Lagoon entrance reef_type Crest backreef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.3.Por.loba.1.20140724.M sample type Coral Mucus sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock668_Por_Muc_140724 sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector skeletal density 1.375043478 skeletal density unit g cm-3 southern-most range edge -34.0380171 species age phylogeny 3.912556992 species age phylogeny unit mya substrate rock substrate attachment attached symbio_its2_sequenced n symbiodinium sp. in propagules yes target gene 16S target subfragment V4 taxon id 104759 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_III taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Poritidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 22.8 tissue compartment M tissue_loss_percent 5 turf_contact_percent 40 visibility 15 visibility_method Horizontal Secchi Disk water clarity preference clear wave exposure preference protected western-most range edge 31.8537507 zooxanthellate zooxanthellate ERS2655070 SAMEA4835200 496922 coral metagenome Coral Mucus from Symphyllia sp sampled from Lizard Island, Australia as sample E1.19.Sym.sp1.20140724.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:45Z External Id SAMEA4835200 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:45Z INSDC status public Submitter Id E1.19.Sym.sp.1.20140724.M algal_contact_types turf barcodesequence GTCGTAACAC binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Mucus cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Lagoon entrance_20140724 collection time 11:26 collection_timestamp 7/24/14 11:26 colony_height_m 25 colony_maximum_diameter_universal 50 colony_maximum_gcmp_recorded 50 colony_name E1.19.Sym.sp.1.20140724 colony_width1 50 colony_width2 30 compartment_replicates 1 complex_robust robust concatenated_date 20140724 country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 7/24/14 depth 2.4384 depth_method measured disease_percent 0 dna_extracted y env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E1 family Lobophylliidae field_host_genus_id Symphyllia field_host_name Symphyllia sp field_host_species_id sp full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Lagoon entrance full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XIX_Symphyllia_sp geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.689414 geographic location (longitude) 145.468137 hemisphere Southern host species sp host_clade_sensu_fukami XIX host_clade_sensu_fukami_numeric 19 host_genus Symphyllia host_genus_id Symphyllia host_name Symphyllia sp host_species_id sp huang_roy_tree_name MUS_Symphyllia invertebrate_contact_types polychaete latitude -14.689414 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Symphyllia sp._20140724 local_sample_id Lob Muc 140724 longitude 145.468137 n_algal_contacts 1 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.277777778 oz_disease_sd 0.277777778 par_method buoy parrotfish_bites n pcr primers 515F/806R photosynthetically_active_radiation 600.663 physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter_universal 1 prop_colony_maximum_gcmp_recorded 1 reef_name Lagoon entrance reef_type Crest backreef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.19.Sym.sp.1.20140724.M sample type Coral Mucus sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact y sequence_center_id Pollock669_Lob_Muc_140724 shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector substrate sediment symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 242739 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XIX taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Lobophylliidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 22.8 tissue compartment M tissue_loss_percent 0 turf_contact_percent 20 visibility 15 visibility_method Horizontal Secchi Disk ERS2655071 SAMEA4835201 496922 coral metagenome Coral Skeleton from Lobophyllia sp sampled from Lizard Island, Australia as sample E1.19.Lob.sp1.20140809.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:45Z External Id SAMEA4835201 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:45Z INSDC status public Submitter Id E1.19.Lob.sp.1.20140809.S algal_contact_types turf__cyanobacteria barcodesequence TAGACGTGCT binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Skeleton cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Horseshoe_20140809 collection time 10:20 collection_timestamp 8/9/14 10:20 colony_height_m 10 colony_maximum_diameter_universal 30 colony_maximum_gcmp_recorded 30 colony_name E1.19.Lob.sp.1.20140809 colony_width1 30 colony_width2 22 compartment_replicates 1 complex_robust robust concatenated_date 20140809 country Australia cyanobacteria_contact y cyanobacteria_percent 2 daily_replicate 1 date 8/9/14 depth 1.2192 depth_method measured disease_percent 0 dna_extracted y env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E1 family Lobophylliidae field_host_genus_id Lobophyllia field_host_name Lobophyllia sp field_host_species_id sp full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Horseshoe full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XIX_Lobophyllia_sp functional_group_sensu_darling Stress-tolerant geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68716 geographic location (longitude) 145.44449 hemisphere Southern host species sp host_clade_sensu_fukami XIX host_clade_sensu_fukami_numeric 19 host_genus Lobophyllia host_genus_id Lobophyllia host_name Lobophyllia sp host_species_id sp huang_roy_tree_name MUS_Lobophyllia latitude -14.68716 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Lobophyllia sp._20140809 local_sample_id Lob Ske 140809 longitude 145.44449 n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 1.150843254 oz_disease_sd 0.600366999 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter_universal 1 prop_colony_maximum_gcmp_recorded 1 reef_name Horseshoe reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.19.Lob.sp.1.20140809.S sample type Coral Skeleton sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock67 shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector substrate rock symbio_its2_sequenced y target gene 16S target subfragment V4 taxon id 46757 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XIX taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Lobophylliidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.3 tissue compartment S tissue_loss_percent 0 turf_contact_percent 5 visibility 9 visibility_method Horizontal Secchi Disk ERS2655072 SAMEA4835202 496922 coral metagenome Coral Tissue from Acropora sp sampled from Lizard Island, Australia as sample E1.6.Acr.sp1.20140726.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:45Z External Id SAMEA4835202 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:45Z INSDC status public Submitter Id E1.6.Acr.sp.1.20140726.T algal_contact_types turf__brown_algae barcodesequence GCATAATCGC binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact y binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Tissue cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Trawler_20140726 collection time 10:35 collection_timestamp 7/26/14 10:35 colony_height_m 19 colony_maximum_diameter_universal 40 colony_maximum_gcmp_recorded 40 colony_name E1.6.Acr.sp.1.20140726 colony_width1 28 colony_width2 12 compartment_replicates 1 complex_robust complex concatenated_date 20140726 country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 7/26/14 depth 1.524 depth_method measured disease_percent 0 dna_extracted y env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E1 family Acroporidae field_host_genus_id Acropora field_host_name Acropora sp field_host_species_id sp full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_VI_Acropora_sp geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.683931 geographic location (longitude) 145.466483 hemisphere Southern host species sp_bushy host_clade_sensu_fukami VI host_clade_sensu_fukami_numeric 6 host_genus Acropora host_genus_id Acropora host_name Acropora sp_bushy host_species_id sp_bushy huang_roy_tree_name ACR_Acropora latitude -14.683931 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Acropora sp._20140726 local_sample_id Acr Tis 140726 longitude 145.466483 macroalgal_contact_types brown_algae n_algal_contacts 2 n_macroalgal_contacts 1 ncbi_inherited_blast_name stony corals ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 1.578324463 oz_disease_sd 0.456565414 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter_universal 0.7 prop_colony_maximum_gcmp_recorded 0.7 reef_name Trawler reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.6.Acr.sp.1.20140726.T sample type Coral Tissue sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock670_Acr_Tis_140726 shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector substrate pavement symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 6127 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_VI taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Acroporidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 22.8 tissue compartment T tissue_loss_percent 0 turf_contact_percent 2 visibility 14 visibility_method Horizontal Secchi Disk ERS2655073 SAMEA4835203 496922 coral metagenome Coral Skeleton from Acropora sp sampled from Lizard Island, Australia as sample E1.6.Acr.sp1.20140726.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:45Z External Id SAMEA4835203 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:45Z INSDC status public Submitter Id E1.6.Acr.sp.1.20140726.S algal_contact_types turf__brown_algae barcodesequence TCTAGCGTGG binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact y binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Skeleton cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Trawler_20140726 collection time 10:35 collection_timestamp 7/26/14 10:35 colony_height_m 19 colony_maximum_diameter_universal 40 colony_maximum_gcmp_recorded 40 colony_name E1.6.Acr.sp.1.20140726 colony_width1 28 colony_width2 12 compartment_replicates 1 complex_robust complex concatenated_date 20140726 country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 7/26/14 depth 1.524 depth_method measured disease_percent 0 dna_extracted y env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E1 family Acroporidae field_host_genus_id Acropora field_host_name Acropora sp field_host_species_id sp full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_VI_Acropora_sp geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.683931 geographic location (longitude) 145.466483 hemisphere Southern host species sp_bushy host_clade_sensu_fukami VI host_clade_sensu_fukami_numeric 6 host_genus Acropora host_genus_id Acropora host_name Acropora sp_bushy host_species_id sp_bushy huang_roy_tree_name ACR_Acropora latitude -14.683931 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Acropora sp._20140726 local_sample_id Acr Ske 140726 longitude 145.466483 macroalgal_contact_types brown_algae n_algal_contacts 2 n_macroalgal_contacts 1 ncbi_inherited_blast_name stony corals ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 1.578324463 oz_disease_sd 0.456565414 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter_universal 0.7 prop_colony_maximum_gcmp_recorded 0.7 reef_name Trawler reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.6.Acr.sp.1.20140726.S sample type Coral Skeleton sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock671_Acr_Ske_140726 shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector substrate pavement symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 6127 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_VI taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Acroporidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 22.8 tissue compartment S tissue_loss_percent 0 turf_contact_percent 2 visibility 14 visibility_method Horizontal Secchi Disk ERS2655074 SAMEA4835204 496922 coral metagenome Coral Mucus from Acropora sp sampled from Lizard Island, Australia as sample E1.6.Acr.sp1.20140726.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:45Z External Id SAMEA4835204 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:45Z INSDC status public Submitter Id E1.6.Acr.sp.1.20140726.M algal_contact_types turf__brown_algae barcodesequence CACTGCTTGA binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact y binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Mucus cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Trawler_20140726 collection time 10:35 collection_timestamp 7/26/14 10:35 colony_height_m 19 colony_maximum_diameter_universal 40 colony_maximum_gcmp_recorded 40 colony_name E1.6.Acr.sp.1.20140726 colony_width1 28 colony_width2 12 compartment_replicates 1 complex_robust complex concatenated_date 20140726 country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 7/26/14 depth 1.524 depth_method measured disease_percent 0 dna_extracted y env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E1 family Acroporidae field_host_genus_id Acropora field_host_name Acropora sp field_host_species_id sp full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_VI_Acropora_sp geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.683931 geographic location (longitude) 145.466483 hemisphere Southern host species sp_bushy host_clade_sensu_fukami VI host_clade_sensu_fukami_numeric 6 host_genus Acropora host_genus_id Acropora host_name Acropora sp_bushy host_species_id sp_bushy huang_roy_tree_name ACR_Acropora latitude -14.683931 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Acropora sp._20140726 local_sample_id Acr Muc 140726 longitude 145.466483 macroalgal_contact_types brown_algae n_algal_contacts 2 n_macroalgal_contacts 1 ncbi_inherited_blast_name stony corals ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 1.578324463 oz_disease_sd 0.456565414 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter_universal 0.7 prop_colony_maximum_gcmp_recorded 0.7 reef_name Trawler reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.6.Acr.sp.1.20140726.M sample type Coral Mucus sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock672_Acr_Muc_140726 shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector substrate pavement symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 6127 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_VI taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Acroporidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 22.8 tissue compartment M tissue_loss_percent 0 turf_contact_percent 2 visibility 14 visibility_method Horizontal Secchi Disk ERS2655075 SAMEA4835205 496922 coral metagenome Coral Mucus from Diploastrea heliopora sampled from Lizard Island, Australia as sample E1.15.Dip.heli.1.20140726.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:45Z External Id SAMEA4835205 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:45Z INSDC status public Submitter Id E1.15.Dip.heli.1.20140726.M abundance gbr common abundance world uncommon algal_contact_types turf__cyanobacteria barcodesequence TGGACTCAGA binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Mucus cca_contact_percent 1 collected by Ryan McMinds collection date 2014 collection id Trawler_20140726 collection time 10:38 collection_timestamp 7/26/14 10:38 coloniality colonial colony maximum diameter 500 colony maximum diameter unit cm colony_height_m 80 colony_maximum_diameter 500 colony_maximum_diameter_universal 1034 colony_maximum_gcmp_recorded 1034 colony_name E1.15.Dip.heli.1.20140726 colony_width1 300 colony_width2 100 compartment_replicates 1 complex_robust robust concatenated_date 20140726 corallite width maximum 9 corallite width maximum unit mm corallite width minimum 7 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 1 daily_replicate 1 date 7/26/14 depth 1.524 depth lower 30 depth lower unit m depth upper 0 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -167.1916889 env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E1 family Diploastreidae field_host_genus_id Diploastrea field_host_name Diploastrea heliopora field_host_species_id heliopora full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XV_Diploastrea_heliopora functional_group_sensu_darling Stress-tolerant genus fossil age 99.6 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.683931 geographic location (longitude) 145.466483 growth form typical massive hemisphere Southern host species heliopora host_clade_sensu_fukami XV host_clade_sensu_fukami_numeric 15 host_genus Diploastrea host_genus_id Diploastrea host_name Diploastrea heliopora host_species_id heliopora huang_roy_tree_name FAV_Diploastrea_heliopora iucn red list category NT latitude -14.683931 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Diploastrea heliopora_20140726 local_sample_id Dip Muc 140726 longitude 145.466483 mode of larval development spawner n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 30.8119151 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 290 oocyte size at maturity unit um outgroup n oz_disease_mean 0 oz_disease_sd 0 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter 0.6 prop_colony_maximum_diameter_universal 0.290135397 prop_colony_maximum_gcmp_recorded 0.290135397 range size 70449346.41 range size unit km^2 reef_name Trawler reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.15.Dip.heli.1.20140726.M sample type Coral Mucus sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact y sequence_center_id Pollock673_Dip_Muc_140726 sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -30.63689894 species age phylogeny 64.52281751 species age phylogeny unit mya substrate sediment substrate attachment attached symbio_its2_sequenced n symbiodinium sp. in propagules no target gene 16S target subfragment V4 taxon id 214969 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XV taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Diploastreidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 22.8 tissue compartment M tissue_loss_percent 0 turf_contact_percent 5 visibility 14 visibility_method Horizontal Secchi Disk water clarity preference clear wave exposure preference broad western-most range edge 31.7583974 zooxanthellate zooxanthellate ERS2655076 SAMEA4835206 496922 coral metagenome Coral Mucus from Echinopora mammiformis sampled from Lizard Island, Australia as sample E1.17.Ech.mamm.1.20140728.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:45Z External Id SAMEA4835206 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:45Z INSDC status public Submitter Id E1.17.Ech.mamm.1.20140728.M abundance gbr common abundance world common barcodesequence GTAACGATGT binary_algal_contact n binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact n biologicalmatter Coral Mucus cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Big Vickie_20140728 collection time 11:15 collection_timestamp 7/28/14 11:15 coloniality colonial colony maximum diameter 500 colony maximum diameter unit cm colony_height_m 40 colony_maximum_diameter 500 colony_maximum_diameter_universal 500 colony_maximum_gcmp_recorded 200 colony_name E1.17.Ech.mamm.1.20140728 colony_width1 200 colony_width2 140 compartment_replicates 1 complex_robust robust concatenated_date 20140728 corallite width maximum 8.9 corallite width maximum unit mm corallite width minimum 6.1 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 7/28/14 depth lower 15 depth lower unit m depth upper 3 depth upper unit m disease_percent 0 dna_extracted y eastern-most range edge -170.3991819 env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E1 family Merulinidae field_host_genus_id Echinopora field_host_name Echinopora mammiformis field_host_species_id mammiformis full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Big Vickie full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XVII_Echinopora_mammiformis genus fossil age 15.97 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68463 geographic location (longitude) 145.44175 growth form typical encrusting_long_uprights hemisphere Southern host species mammiformis host_clade_sensu_fukami XVII host_clade_sensu_fukami_numeric 17 host_genus Echinopora host_genus_id Echinopora host_name Echinopora mammiformis host_species_id mammiformis huang_roy_tree_name FAV_Echinopora_mammiformis invertebrate_contact_types sinularia__lobophytum iucn red list category NT latitude -14.68463 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Echinopora mammiformis_20140728 local_sample_id Ech Muc 140728 longitude 145.44175 n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 27.77323748 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.291126819 oz_disease_sd 0.143241468 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter 0.4 prop_colony_maximum_diameter_universal 0.4 prop_colony_maximum_gcmp_recorded 1 range size 44919196.15 range size unit km^2 reef_name Big Vickie reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.17.Ech.mamm.1.20140728.M sample type Coral Mucus sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact y sequence_center_id Pollock674_Ech_Muc_140728 shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -33.67557655 species age phylogeny 9.390921099 species age phylogeny unit mya substrate sediment substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 983565 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XVII taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Merulinidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia tissue compartment M tissue_loss_percent 0 turf_contact_percent 0 visibility 12 visibility_method Horizontal Secchi Disk water clarity preference clear wave exposure preference protected western-most range edge 38.8486452 zooxanthellate zooxanthellate ERS2655077 SAMEA4835207 496922 coral metagenome Coral Tissue from Echinopora mammiformis sampled from Lizard Island, Australia as sample E1.17.Ech.mamm.1.20140728.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:45Z External Id SAMEA4835207 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:45Z INSDC status public Submitter Id E1.17.Ech.mamm.1.20140728.T abundance gbr common abundance world common barcodesequence TCCTTGTTCT binary_algal_contact n binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact n biologicalmatter Coral Tissue cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Big Vickie_20140728 collection time 11:15 collection_timestamp 7/28/14 11:15 coloniality colonial colony maximum diameter 500 colony maximum diameter unit cm colony_height_m 40 colony_maximum_diameter 500 colony_maximum_diameter_universal 500 colony_maximum_gcmp_recorded 200 colony_name E1.17.Ech.mamm.1.20140728 colony_width1 200 colony_width2 140 compartment_replicates 1 complex_robust robust concatenated_date 20140728 corallite width maximum 8.9 corallite width maximum unit mm corallite width minimum 6.1 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 7/28/14 depth lower 15 depth lower unit m depth upper 3 depth upper unit m disease_percent 0 dna_extracted y eastern-most range edge -170.3991819 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E1 family Merulinidae field_host_genus_id Echinopora field_host_name Echinopora mammiformis field_host_species_id mammiformis full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Big Vickie full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XVII_Echinopora_mammiformis genus fossil age 15.97 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68463 geographic location (longitude) 145.44175 growth form typical encrusting_long_uprights hemisphere Southern host species mammiformis host_clade_sensu_fukami XVII host_clade_sensu_fukami_numeric 17 host_genus Echinopora host_genus_id Echinopora host_name Echinopora mammiformis host_species_id mammiformis huang_roy_tree_name FAV_Echinopora_mammiformis invertebrate_contact_types sinularia__lobophytum iucn red list category NT latitude -14.68463 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Echinopora mammiformis_20140728 local_sample_id Ech Tis 140728 longitude 145.44175 n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 27.77323748 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.291126819 oz_disease_sd 0.143241468 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter 0.4 prop_colony_maximum_diameter_universal 0.4 prop_colony_maximum_gcmp_recorded 1 range size 44919196.15 range size unit km^2 reef_name Big Vickie reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.17.Ech.mamm.1.20140728.T sample type Coral Tissue sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact y sequence_center_id Pollock675_Ech_Tis_140728 shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -33.67557655 species age phylogeny 9.390921099 species age phylogeny unit mya substrate sediment substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 983565 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XVII taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Merulinidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia tissue compartment T tissue_loss_percent 0 turf_contact_percent 0 visibility 12 visibility_method Horizontal Secchi Disk water clarity preference clear wave exposure preference protected western-most range edge 38.8486452 zooxanthellate zooxanthellate ERS2655078 SAMEA4835208 496922 coral metagenome Coral Mucus from Galaxea astreata sampled from Lizard Island, Australia as sample E1.5.Gal.astr.1.20140728.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:45Z External Id SAMEA4835208 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:45Z INSDC status public Submitter Id E1.5.Gal.astr.1.20140728.M abundance gbr common abundance world common algal_contact_types turf__cyanobacteria barcodesequence CCAAGAAGAA binary_algal_contact y binary_cca_contact y binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Mucus cca_contact_percent 10 collected by Ryan McMinds collection date 2014 collection id Big Vickie_20140728 collection time 11:27 collection_timestamp 7/28/14 11:27 coloniality colonial colony maximum diameter 200 colony maximum diameter unit cm colony_height_m 1 colony_maximum_diameter 200 colony_maximum_diameter_universal 200 colony_maximum_gcmp_recorded 35 colony_name E1.5.Gal.astr.1.20140728 colony_width1 10 colony_width2 5 compartment_replicates 1 complex_robust complex concatenated_date 20140728 corallite width maximum 3.7 corallite width maximum unit mm corallite width minimum 3.4 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 5 daily_replicate 1 date 7/28/14 depth 4.8768 depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -168.0535591 env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E1 family Euphylliidae field_host_genus_id Galaxea field_host_name Galaxea astreata field_host_species_id astreata full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Big Vickie full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_V_Galaxea_astreata functional_group_sensu_darling Stress-tolerant genus fossil age 23.03 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68463 geographic location (longitude) 145.44175 growth form typical submassive hemisphere Southern host species astreata host_clade_sensu_fukami V host_clade_sensu_fukami_numeric 5 host_genus Galaxea host_genus_id Galaxea host_name Galaxea astreata host_species_id astreata huang_roy_tree_name OCU_Galaxea_astreata invertebrate_contact_types lobophytum iucn red list category VU latitude -14.68463 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Galaxea astreata_20140728 local_sample_id Gal Muc 140728 longitude 145.44175 mode of larval development spawner n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 37.11571178 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.258673969 oz_disease_sd 0.173267011 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter 0.05 prop_colony_maximum_diameter_universal 0.05 prop_colony_maximum_gcmp_recorded 0.285714286 range size 72703639.29 range size unit km^2 reef_name Big Vickie reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.5.Gal.astr.1.20140728.M sample type Coral Mucus sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock676_Gal_Muc_140728 sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -32.22433312 species age phylogeny 0.518269449 species age phylogeny unit mya substrate rock substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 154325 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_V taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Euphylliidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 22.8 tissue compartment M tissue_loss_percent 0 turf_contact_percent 25 visibility 12 visibility_method Horizontal Secchi Disk water clarity preference turbid wave exposure preference protected western-most range edge 31.7398894 zooxanthellate zooxanthellate ERS2655079 SAMEA4835209 496922 coral metagenome Coral Mucus from Pachyseris rugosa sampled from Lizard Island, Australia as sample E1.4.Pac.rugo.1.20140728.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:45Z External Id SAMEA4835209 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:45Z INSDC status public Submitter Id E1.4.Pac.rugo.1.20140728.M abundance gbr common abundance world common algal_contact_types turf__cyanobacteria__cca barcodesequence CGAGCATTGT binary_algal_contact y binary_cca_contact y binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Mucus cca_contact_percent 10 collected by Ryan McMinds collection date 2014 collection id Big Vickie_20140728 collection time 11:28 collection_timestamp 7/28/14 11:28 coloniality colonial colony maximum diameter 100 colony maximum diameter unit cm colony_height_m 60 colony_maximum_diameter 100 colony_maximum_diameter_universal 400 colony_maximum_gcmp_recorded 400 colony_name E1.4.Pac.rugo.1.20140728 colony_width1 130 colony_width2 70 compartment_replicates 1 complex_robust complex concatenated_date 20140728 corallite width maximum 4.8 corallite width maximum unit mm corallite width minimum 2.2 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 5 daily_replicate 1 date 7/28/14 depth 3.3528 depth lower 20 depth lower unit m depth upper 5 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -176.1319621 env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E1 family Agariciidae field_host_genus_id Pachyseris field_host_name Pachyseris rugosa field_host_species_id rugosa full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Big Vickie full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_IV_Pachyseris_rugosa functional_group_sensu_darling Generalist genus fossil age 33.9 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68463 geographic location (longitude) 145.44175 growth form typical laminar hemisphere Southern host species rugosa host_clade_sensu_fukami IV host_clade_sensu_fukami_numeric 4 host_genus Pachyseris host_genus_id Pachyseris host_name Pachyseris rugosa host_species_id rugosa huang_roy_tree_name AGA_Pachyseris invertebrate_contact_types sinularia iucn red list category VU latitude -14.68463 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Pachyseris rugosa_20140728 local_sample_id Pach Muc 140728 longitude 145.44175 mode of larval development spawner n_algal_contacts 3 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 31.00815214 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 339 oocyte size at maturity unit um outgroup n oz_disease_mean 0 oz_disease_sd 0 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter 1.3 prop_colony_maximum_diameter_universal 0.325 prop_colony_maximum_gcmp_recorded 0.325 range size 60586224.82 range size unit km^2 reef_name Big Vickie reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.4.Pac.rugo.1.20140728.M sample type Coral Mucus sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact y sequence_center_id Pollock677_Pach_Muc_140728 sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -27.86238998 species age phylogeny 1.524518009 species age phylogeny unit mya substrate sediment substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 1518537 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_IV taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Agariciidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 22.8 tissue compartment M tissue_loss_percent 0 turf_contact_percent 10 visibility 12 visibility_method Horizontal Secchi Disk water clarity preference turbid wave exposure preference broad western-most range edge 31.7723633 zooxanthellate zooxanthellate ERS2655080 SAMEA4835210 496922 coral metagenome Coral Tissue from Pachyseris rugosa sampled from Lizard Island, Australia as sample E1.4.Pac.rugo.1.20140728.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:46Z External Id SAMEA4835210 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:46Z INSDC status public Submitter Id E1.4.Pac.rugo.1.20140728.T abundance gbr common abundance world common algal_contact_types turf__cyanobacteria__cca barcodesequence CTCTGGACGA binary_algal_contact y binary_cca_contact y binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Tissue cca_contact_percent 10 collected by Ryan McMinds collection date 2014 collection id Big Vickie_20140728 collection time 11:28 collection_timestamp 7/28/14 11:28 coloniality colonial colony maximum diameter 100 colony maximum diameter unit cm colony_height_m 60 colony_maximum_diameter 100 colony_maximum_diameter_universal 400 colony_maximum_gcmp_recorded 400 colony_name E1.4.Pac.rugo.1.20140728 colony_width1 130 colony_width2 70 compartment_replicates 1 complex_robust complex concatenated_date 20140728 corallite width maximum 4.8 corallite width maximum unit mm corallite width minimum 2.2 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 5 daily_replicate 1 date 7/28/14 depth 3.3528 depth lower 20 depth lower unit m depth upper 5 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -176.1319621 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E1 family Agariciidae field_host_genus_id Pachyseris field_host_name Pachyseris rugosa field_host_species_id rugosa full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Big Vickie full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_IV_Pachyseris_rugosa functional_group_sensu_darling Generalist genus fossil age 33.9 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68463 geographic location (longitude) 145.44175 growth form typical laminar hemisphere Southern host species rugosa host_clade_sensu_fukami IV host_clade_sensu_fukami_numeric 4 host_genus Pachyseris host_genus_id Pachyseris host_name Pachyseris rugosa host_species_id rugosa huang_roy_tree_name AGA_Pachyseris invertebrate_contact_types sinularia iucn red list category VU latitude -14.68463 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Pachyseris rugosa_20140728 local_sample_id Pach Tis 140728 longitude 145.44175 mode of larval development spawner n_algal_contacts 3 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 31.00815214 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 339 oocyte size at maturity unit um outgroup n oz_disease_mean 0 oz_disease_sd 0 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter 1.3 prop_colony_maximum_diameter_universal 0.325 prop_colony_maximum_gcmp_recorded 0.325 range size 60586224.82 range size unit km^2 reef_name Big Vickie reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.4.Pac.rugo.1.20140728.T sample type Coral Tissue sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact y sequence_center_id Pollock678_Pach_Tis_140728 sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -27.86238998 species age phylogeny 1.524518009 species age phylogeny unit mya substrate sediment substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 1518537 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_IV taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Agariciidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 22.8 tissue compartment T tissue_loss_percent 0 turf_contact_percent 10 visibility 12 visibility_method Horizontal Secchi Disk water clarity preference turbid wave exposure preference broad western-most range edge 31.7723633 zooxanthellate zooxanthellate ERS2655081 SAMEA4835211 496922 coral metagenome Coral Skeleton from Pachyseris rugosa sampled from Lizard Island, Australia as sample E1.4.Pac.rugo.1.20140728.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:46Z External Id SAMEA4835211 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:46Z INSDC status public Submitter Id E1.4.Pac.rugo.1.20140728.S abundance gbr common abundance world common algal_contact_types turf__cyanobacteria__cca barcodesequence TCTCGGATAG binary_algal_contact y binary_cca_contact y binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Skeleton cca_contact_percent 10 collected by Ryan McMinds collection date 2014 collection id Big Vickie_20140728 collection time 11:28 collection_timestamp 7/28/14 11:28 coloniality colonial colony maximum diameter 100 colony maximum diameter unit cm colony_height_m 60 colony_maximum_diameter 100 colony_maximum_diameter_universal 400 colony_maximum_gcmp_recorded 400 colony_name E1.4.Pac.rugo.1.20140728 colony_width1 130 colony_width2 70 compartment_replicates 1 complex_robust complex concatenated_date 20140728 corallite width maximum 4.8 corallite width maximum unit mm corallite width minimum 2.2 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 5 daily_replicate 1 date 7/28/14 depth 3.3528 depth lower 20 depth lower unit m depth upper 5 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -176.1319621 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E1 family Agariciidae field_host_genus_id Pachyseris field_host_name Pachyseris rugosa field_host_species_id rugosa full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Big Vickie full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_IV_Pachyseris_rugosa functional_group_sensu_darling Generalist genus fossil age 33.9 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68463 geographic location (longitude) 145.44175 growth form typical laminar hemisphere Southern host species rugosa host_clade_sensu_fukami IV host_clade_sensu_fukami_numeric 4 host_genus Pachyseris host_genus_id Pachyseris host_name Pachyseris rugosa host_species_id rugosa huang_roy_tree_name AGA_Pachyseris invertebrate_contact_types sinularia iucn red list category VU latitude -14.68463 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Pachyseris rugosa_20140728 local_sample_id Pach Ske 140728 longitude 145.44175 mode of larval development spawner n_algal_contacts 3 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 31.00815214 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 339 oocyte size at maturity unit um outgroup n oz_disease_mean 0 oz_disease_sd 0 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter 1.3 prop_colony_maximum_diameter_universal 0.325 prop_colony_maximum_gcmp_recorded 0.325 range size 60586224.82 range size unit km^2 reef_name Big Vickie reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.4.Pac.rugo.1.20140728.S sample type Coral Skeleton sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact y sequence_center_id Pollock679_Pach_Ske_140728 sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -27.86238998 species age phylogeny 1.524518009 species age phylogeny unit mya substrate sediment substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 1518537 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_IV taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Agariciidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 22.8 tissue compartment S tissue_loss_percent 0 turf_contact_percent 10 visibility 12 visibility_method Horizontal Secchi Disk water clarity preference turbid wave exposure preference broad western-most range edge 31.7723633 zooxanthellate zooxanthellate ERS2655082 SAMEA4835212 496922 coral metagenome Zooanthid Mucus from Palythoa caesia sampled from Lizard Island, Australia as sample E1.Outgroup.Palythoa.caesia.1.20140809.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:46Z External Id SAMEA4835212 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:46Z INSDC status public Submitter Id E1.Out.Pal.caes.1.20140809.M algal_contact_types turf__cyanobacteria__cca barcodesequence TCTGAGCGCA binary_algal_contact y binary_cca_contact y binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Zooanthid Mucus cca_contact_percent 15 collected by Ryan McMinds collection date 2014 collection id Horseshoe_20140809 collection time 10:20 collection_timestamp 8/9/14 10:20 colony_height_m 1 colony_maximum_diameter_universal 30 colony_maximum_gcmp_recorded 30 colony_name E1.Out.Pal.caes.1.20140809 colony_width1 4 colony_width2 4 compartment_replicates 1 complex_robust outgroup concatenated_date 20140809 country Australia cyanobacteria_contact y cyanobacteria_percent 10 daily_replicate 1 date 8/9/14 depth 1.2192 depth_method measured disease_percent 0 dna_extracted y env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Zooanthid Mucus environmental sample Yes expedition_number E1 family Sphenopidae field_host_genus_id Palythoa field_host_name Palythoa caesia field_host_species_id caesia full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Horseshoe full_taxonomy_string_with_clade Cnidaria_Anthozoa_Zoantharia_Sphenopidae_Palythoa_caesia geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68716 geographic location (longitude) 145.44449 hemisphere Southern host species caesia host_clade_sensu_fukami Outgroup_Cnidaria_Anthozoa_Zoantharia_Sphenopidae host_clade_sensu_fukami_numeric Outgroup_Cnidaria_Anthozoa_Zoantharia host_genus Palythoa host_genus_id Palythoa host_name Palythoa caesia host_species_id caesia latitude -14.68716 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Zooanthid_20140809 local_sample_id Zoo Muc 140809 longitude 145.44449 n_algal_contacts 3 n_macroalgal_contacts 0 ncbi_inherited_blast_name mat anemones ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup y parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter_universal 0.133333333 prop_colony_maximum_gcmp_recorded 0.133333333 reef_name Horseshoe reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.Out.Pal.caes.1.20140809.M sample type Zooanthid Mucus sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock68 shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector substrate pavement symbio_its2_sequenced y target gene 16S target subfragment V4 taxon id 134929 taxonomy_string_to_clade Cnidaria_Anthozoa_Zoantharia_Sphenopidae taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Zoantharia_Sphenopidae taxonomy_string_to_order Cnidaria_Anthozoa_Zoantharia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.3 tissue compartment M tissue_loss_percent 0 turf_contact_percent 20 visibility 9 visibility_method Horizontal Secchi Disk ERS2655083 SAMEA4835213 496922 coral metagenome Coral Mucus from Pocillopora damicornis sampled from Lizard Island, Australia as sample E1.10.Poc.dami.1.20140728.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:46Z External Id SAMEA4835213 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:46Z INSDC status public Submitter Id E1.10.Poc.dami.1.20140728.M abundance gbr common abundance world common algal_contact_types turf__cyanobacteria barcodesequence CTCAAGAAGC binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Mucus cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Big Vickie_20140728 collection time 11:22 collection_timestamp 7/28/14 11:22 coloniality colonial colony maximum diameter 200 colony maximum diameter unit cm colony_height_m 10 colony_maximum_diameter 200 colony_maximum_diameter_universal 200 colony_maximum_gcmp_recorded 55 colony_name E1.10.Poc.dami.1.20140728 colony_width1 25 colony_width2 18 compartment_replicates 1 complex_robust robust concatenated_date 20140728 corallite width maximum 1 corallite width maximum unit mm corallite width minimum 0.8 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 5 daily_replicate 1 date 7/28/14 depth 4.8768 depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -76.08342991 env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E1 family Pocilloporidae field_host_genus_id Pocillopora field_host_name Pocillopora damicornis field_host_species_id damicornis full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Big Vickie full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_X_Pocillopora_damicornis functional_group_sensu_darling Weedy genus fossil age 33.9 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68463 geographic location (longitude) 145.44175 growth form typical branching_closed hemisphere Southern host species damicornis host_clade_sensu_fukami X host_clade_sensu_fukami_numeric 10 host_genus Pocillopora host_genus_id Pocillopora host_name Pocillopora damicornis host_species_id damicornis huang_roy_tree_name POC_Pocillopora_damicornis invertebrate_contact_types sinularia iucn red list category LC latitude -14.68463 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Pocillopora damicornis_20140728 local_sample_id Poci Muc 140728 longitude 145.44175 n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 35.94968826 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 3.190353051 oz_disease_sd 0.789700055 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter 0.125 prop_colony_maximum_diameter_universal 0.125 prop_colony_maximum_gcmp_recorded 0.454545455 propagule size on release max 1440 propagule size on release max unit um range size 128235814.8 range size unit km^2 reef_name Big Vickie reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.10.Poc.dami.1.20140728.M sample type Coral Mucus sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact y sequence_center_id Pollock680_Poci_Muc_140728 sexual system hermaphrodite shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector skeletal density 1.926666667 skeletal density unit g cm-3 southern-most range edge -35.55510674 species age phylogeny 1.847284581 species age phylogeny unit mya substrate sediment substrate attachment attached symbio_its2_sequenced n symbiodinium sp. in propagules yes target gene 16S target subfragment V4 taxon id 46731 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_X taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Pocilloporidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 22.8 tissue compartment M tissue_loss_percent 0 turf_contact_percent 15 visibility 12 visibility_method Horizontal Secchi Disk water clarity preference both wave exposure preference broad western-most range edge 31.8660454 zooxanthellate zooxanthellate ERS2655084 SAMEA4835214 496922 coral metagenome Coral Tissue from Pocillopora damicornis sampled from Lizard Island, Australia as sample E1.10.Poc.dami.1.20140728.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:46Z External Id SAMEA4835214 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:46Z INSDC status public Submitter Id E1.10.Poc.dami.1.20140728.T abundance gbr common abundance world common algal_contact_types turf__cyanobacteria barcodesequence TGGTTCGCTG binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Tissue cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Big Vickie_20140728 collection time 11:22 collection_timestamp 7/28/14 11:22 coloniality colonial colony maximum diameter 200 colony maximum diameter unit cm colony_height_m 10 colony_maximum_diameter 200 colony_maximum_diameter_universal 200 colony_maximum_gcmp_recorded 55 colony_name E1.10.Poc.dami.1.20140728 colony_width1 25 colony_width2 18 compartment_replicates 1 complex_robust robust concatenated_date 20140728 corallite width maximum 1 corallite width maximum unit mm corallite width minimum 0.8 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 5 daily_replicate 1 date 7/28/14 depth 4.8768 depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -76.08342991 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E1 family Pocilloporidae field_host_genus_id Pocillopora field_host_name Pocillopora damicornis field_host_species_id damicornis full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Big Vickie full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_X_Pocillopora_damicornis functional_group_sensu_darling Weedy genus fossil age 33.9 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68463 geographic location (longitude) 145.44175 growth form typical branching_closed hemisphere Southern host species damicornis host_clade_sensu_fukami X host_clade_sensu_fukami_numeric 10 host_genus Pocillopora host_genus_id Pocillopora host_name Pocillopora damicornis host_species_id damicornis huang_roy_tree_name POC_Pocillopora_damicornis invertebrate_contact_types sinularia iucn red list category LC latitude -14.68463 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Pocillopora damicornis_20140728 local_sample_id Poci Tis 140728 longitude 145.44175 n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 35.94968826 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 3.190353051 oz_disease_sd 0.789700055 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter 0.125 prop_colony_maximum_diameter_universal 0.125 prop_colony_maximum_gcmp_recorded 0.454545455 propagule size on release max 1440 propagule size on release max unit um range size 128235814.8 range size unit km^2 reef_name Big Vickie reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.10.Poc.dami.1.20140728.T sample type Coral Tissue sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact y sequence_center_id Pollock681_Poci_Tis_140728 sexual system hermaphrodite shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector skeletal density 1.926666667 skeletal density unit g cm-3 southern-most range edge -35.55510674 species age phylogeny 1.847284581 species age phylogeny unit mya substrate sediment substrate attachment attached symbio_its2_sequenced n symbiodinium sp. in propagules yes target gene 16S target subfragment V4 taxon id 46731 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_X taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Pocilloporidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 22.8 tissue compartment T tissue_loss_percent 0 turf_contact_percent 15 visibility 12 visibility_method Horizontal Secchi Disk water clarity preference both wave exposure preference broad western-most range edge 31.8660454 zooxanthellate zooxanthellate ERS2655085 SAMEA4835215 496922 coral metagenome Coral Skeleton from Pocillopora damicornis sampled from Lizard Island, Australia as sample E1.10.Poc.dami.1.20140728.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:46Z External Id SAMEA4835215 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:46Z INSDC status public Submitter Id E1.10.Poc.dami.1.20140728.S abundance gbr common abundance world common algal_contact_types turf__cyanobacteria barcodesequence GGAACACAGG binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Skeleton cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Big Vickie_20140728 collection time 11:22 collection_timestamp 7/28/14 11:22 coloniality colonial colony maximum diameter 200 colony maximum diameter unit cm colony_height_m 10 colony_maximum_diameter 200 colony_maximum_diameter_universal 200 colony_maximum_gcmp_recorded 55 colony_name E1.10.Poc.dami.1.20140728 colony_width1 25 colony_width2 18 compartment_replicates 1 complex_robust robust concatenated_date 20140728 corallite width maximum 1 corallite width maximum unit mm corallite width minimum 0.8 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 5 daily_replicate 1 date 7/28/14 depth 4.8768 depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -76.08342991 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E1 family Pocilloporidae field_host_genus_id Pocillopora field_host_name Pocillopora damicornis field_host_species_id damicornis full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Big Vickie full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_X_Pocillopora_damicornis functional_group_sensu_darling Weedy genus fossil age 33.9 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68463 geographic location (longitude) 145.44175 growth form typical branching_closed hemisphere Southern host species damicornis host_clade_sensu_fukami X host_clade_sensu_fukami_numeric 10 host_genus Pocillopora host_genus_id Pocillopora host_name Pocillopora damicornis host_species_id damicornis huang_roy_tree_name POC_Pocillopora_damicornis invertebrate_contact_types sinularia iucn red list category LC latitude -14.68463 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Pocillopora damicornis_20140728 local_sample_id Poci Ske 140728 longitude 145.44175 n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 35.94968826 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 3.190353051 oz_disease_sd 0.789700055 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter 0.125 prop_colony_maximum_diameter_universal 0.125 prop_colony_maximum_gcmp_recorded 0.454545455 propagule size on release max 1440 propagule size on release max unit um range size 128235814.8 range size unit km^2 reef_name Big Vickie reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.10.Poc.dami.1.20140728.S sample type Coral Skeleton sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact y sequence_center_id Pollock682_Poci_Ske_140728 sexual system hermaphrodite shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector skeletal density 1.926666667 skeletal density unit g cm-3 southern-most range edge -35.55510674 species age phylogeny 1.847284581 species age phylogeny unit mya substrate sediment substrate attachment attached symbio_its2_sequenced n symbiodinium sp. in propagules yes target gene 16S target subfragment V4 taxon id 46731 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_X taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Pocilloporidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 22.8 tissue compartment S tissue_loss_percent 0 turf_contact_percent 15 visibility 12 visibility_method Horizontal Secchi Disk water clarity preference both wave exposure preference broad western-most range edge 31.8660454 zooxanthellate zooxanthellate ERS2655086 SAMEA4835216 496922 coral metagenome Coral Skeleton from Fungia sp sampled from Lizard Island, Australia as sample E1.11.Fun.sp1.20140730.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:46Z External Id SAMEA4835216 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:46Z INSDC status public Submitter Id E1.11.Fun.sp.1.20140730.S algal_contact_types turf__cyanobacteria barcodesequence GTCTAGCAGG binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Skeleton cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Trawler_20140730 collection time 10:39 collection_timestamp 7/30/14 10:39 colony_height_m 1 colony_maximum_diameter_universal 20 colony_maximum_gcmp_recorded 20 colony_name E1.11.Fun.sp.1.20140730 colony_width1 4 colony_width2 5 compartment_replicates 1 complex_robust robust concatenated_date 20140730 country Australia cyanobacteria_contact y cyanobacteria_percent 10 daily_replicate 1 date 7/30/14 depth 1.524 depth_method measured disease_percent 0 dna_extracted y env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E1 family Fungiidae field_host_genus_id Fungia field_host_name Fungia sp field_host_species_id sp full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XI_Fungia_sp functional_group_sensu_darling Stress-tolerant geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68344 geographic location (longitude) 145.46554 hemisphere Southern host species sp host_clade_sensu_fukami XI host_clade_sensu_fukami_numeric 11 host_genus Fungia host_genus_id Fungia host_name Fungia sp host_species_id sp huang_roy_tree_name FUN latitude -14.68344 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Fungia sp._20140730 local_sample_id Fun Ske 140730 longitude 145.46554 n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.078431373 oz_disease_sd 0.078431373 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter_universal 0.25 prop_colony_maximum_gcmp_recorded 0.25 reef_name Trawler reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.11.Fun.sp.1.20140730.S sample type Coral Skeleton sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact y sequence_center_id Pollock683_Fun_Ske_140730 shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector substrate rock symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 46712 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XI taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Fungiidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.9 tissue compartment S tissue_loss_percent 0 turf_contact_percent 40 visibility 17 visibility_method Horizontal Secchi Disk ERS2655087 SAMEA4835217 496922 coral metagenome Coral Tissue from Lobophyllia sp sampled from Lizard Island, Australia as sample E1.19.Lob.sp1.20140730.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:46Z External Id SAMEA4835217 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:46Z INSDC status public Submitter Id E1.19.Lob.sp.1.20140730.T algal_contact_types turf__cyanobacteria barcodesequence TTCGATAGCA binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Tissue cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Trawler_20140730 collection time 10:38 collection_timestamp 7/30/14 10:38 colony_height_m 6 colony_maximum_diameter_universal 30 colony_maximum_gcmp_recorded 30 colony_name E1.19.Lob.sp.1.20140730 colony_width1 30 colony_width2 30 compartment_replicates 1 complex_robust robust concatenated_date 20140730 country Australia cyanobacteria_contact y cyanobacteria_percent 5 daily_replicate 1 date 7/30/14 depth 1.524 depth_method measured disease_percent 0 dna_extracted y env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E1 family Lobophylliidae field_host_genus_id Lobophyllia field_host_name Lobophyllia sp field_host_species_id sp full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XIX_Lobophyllia_sp functional_group_sensu_darling Stress-tolerant geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68344 geographic location (longitude) 145.46554 hemisphere Southern host species sp host_clade_sensu_fukami XIX host_clade_sensu_fukami_numeric 19 host_genus Lobophyllia host_genus_id Lobophyllia host_name Lobophyllia sp host_species_id sp huang_roy_tree_name MUS_Lobophyllia invertebrate_contact_types sinularia latitude -14.68344 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Lobophyllia sp._20140730 local_sample_id Lob Tis 140730 longitude 145.46554 n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 1.150843254 oz_disease_sd 0.600366999 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter_universal 1 prop_colony_maximum_gcmp_recorded 1 reef_name Trawler reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.19.Lob.sp.1.20140730.T sample type Coral Tissue sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock684_Lob_Tis_140730 shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector substrate pavement symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 46757 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XIX taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Lobophylliidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.9 tissue compartment T tissue_loss_percent 0 turf_contact_percent 30 visibility 17 visibility_method Horizontal Secchi Disk ERS2655088 SAMEA4835218 496922 coral metagenome Coral Mucus from Psammacora contigua sampled from Lizard Island, Australia as sample E1.11.Psa.cont.1.20140730.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:46Z External Id SAMEA4835218 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:46Z INSDC status public Submitter Id E1.11.Psa.cont.1.20140730.M abundance gbr common abundance world common algal_contact_types turf__cyanobacteria__green barcodesequence GTCGGCTCTA binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact y binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Mucus cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Trawler_20140730 collection time 10:38 collection_timestamp 7/30/14 10:38 coloniality colonial colony maximum diameter 50 colony maximum diameter unit cm colony_height_m 7 colony_maximum_diameter 50 colony_maximum_diameter_universal 50 colony_maximum_gcmp_recorded 10 colony_name E1.11.Psa.cont.1.20140730 colony_width1 10 colony_width2 7 compartment_replicates 1 complex_robust robust concatenated_date 20140730 corallite width maximum 1.5 corallite width maximum unit mm corallite width minimum 1.1 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 5 daily_replicate 1 date 7/30/14 depth 1.524 depth lower 30 depth lower unit m depth upper 0 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -81.17315181 env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E1 family Psammocoridae field_host_genus_id Psammocora field_host_name Psammocora contigua field_host_species_id contigua full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XI_Psammocora_contigua genus fossil age 37.2 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68344 geographic location (longitude) 145.46554 growth form typical columnar hemisphere Southern host species contigua host_clade_sensu_fukami XI host_clade_sensu_fukami_numeric 11 host_genus Psammocora host_genus_id Psammocora host_name Psammocora contigua host_species_id contigua huang_roy_tree_name SID_Psammocora_contigua invertebrate_contact_types tunicate iucn red list category NT latitude -14.68344 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Psammacora contigua_20140730 local_sample_id Pav Muc 140730 longitude 145.46554 macroalgal_contact_types green n_algal_contacts 3 n_macroalgal_contacts 1 ncbi_inherited_blast_name stony corals northern-most range edge 38.25107314 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0 oz_disease_sd 0 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter 0.2 prop_colony_maximum_diameter_universal 0.2 prop_colony_maximum_gcmp_recorded 1 range size 90186356.77 range size unit km^2 reef_name Trawler reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.11.Psa.cont.1.20140730.M sample type Coral Mucus sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock685_Pav_Muc_140730 sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -35.38256235 species age phylogeny 1.883116412 species age phylogeny unit mya substrate pavement substrate attachment unattached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 213643 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XI taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Psammocoridae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.9 tissue compartment M tissue_loss_percent 0 turf_contact_percent 20 visibility 17 visibility_method Horizontal Secchi Disk water clarity preference both wave exposure preference broad western-most range edge 37.5394485 zooxanthellate zooxanthellate ERS2655089 SAMEA4835219 496922 coral metagenome Coral Tissue from Acropora humilis sampled from Lizard Island, Australia as sample E1.6.Acr.humi.1.20140731.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:46Z External Id SAMEA4835219 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:46Z INSDC status public Submitter Id E1.6.Acr.humi.1.20140731.T abundance gbr common abundance world common algal_contact_types turf_cca barcodesequence GCAGATAAGT binary_algal_contact n binary_cca_contact y binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Tissue cca_contact_percent 5 collected by Ryan McMinds collection date 2014 collection id Horseshoe_20140731 collection time 15:30 collection_timestamp 7/31/14 15:30 coloniality colonial colony_height_m 12 colony_maximum_diameter_universal 22 colony_maximum_gcmp_recorded 22 colony_name E1.6.Acr.humi.1.20140731 colony_width1 22 colony_width2 22 compartment_replicates 1 complex_robust complex concatenated_date 20140731 corallite width maximum 1.8 corallite width maximum unit mm corallite width minimum 1 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 7/31/14 depth 1.524 depth lower 11 depth lower unit m depth upper 0 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -138.6193312 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E1 family Acroporidae field_host_genus_id Acropora field_host_name Acropora humilis field_host_species_id humilis full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Horseshoe full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_VI_Acropora_humilis functional_group_sensu_darling Competitive genus fossil age 55.8 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68716 geographic location (longitude) 145.44449 growth form typical digitate growth outline type determinate hemisphere Southern host species humilis host_clade_sensu_fukami VI host_clade_sensu_fukami_numeric 6 host_genus Acropora host_genus_id Acropora host_name Acropora humilis host_species_id humilis huang_roy_tree_name ACR_Acropora_humilis invertebrate_contact_types lobophytum__pocillopora__acropora__porites iucn red list category NT latitude -14.68716 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Acropora humilis_20140731 local_sample_id Acr Tis 140731 longitude 145.44449 mode of larval development spawner n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 31.12454292 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 507 oocyte size at maturity unit um outgroup n oz_disease_mean 1.216836426 oz_disease_sd 0.573106632 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter_universal 1 prop_colony_maximum_gcmp_recorded 1 range size 95054251.69 range size unit km^2 reef_name Horseshoe reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.6.Acr.humi.1.20140731.T sample type Coral Tissue sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock686_Acr_Tis_140731 sexual system hermaphrodite shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector skeletal density 1.445384615 skeletal density unit g cm-3 southern-most range edge -35.36103205 species age phylogeny 2.035750473 species age phylogeny unit mya substrate rock substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 46687 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_VI taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Acroporidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.9 tissue compartment T tissue_loss_percent 0 turf_contact_percent 1 visibility 15 visibility_method Horizontal Secchi Disk water clarity preference clear wave exposure preference exposed western-most range edge 23.8186105 zooxanthellate zooxanthellate ERS2655090 SAMEA4835220 496922 coral metagenome Coral Skeleton from Acropora humilis sampled from Lizard Island, Australia as sample E1.6.Acr.humi.1.20140731.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:46Z External Id SAMEA4835220 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:46Z INSDC status public Submitter Id E1.6.Acr.humi.1.20140731.S abundance gbr common abundance world common algal_contact_types turf_cca barcodesequence GTATAACGCT binary_algal_contact n binary_cca_contact y binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Skeleton cca_contact_percent 5 collected by Ryan McMinds collection date 2014 collection id Horseshoe_20140731 collection time 15:30 collection_timestamp 7/31/14 15:30 coloniality colonial colony_height_m 12 colony_maximum_diameter_universal 22 colony_maximum_gcmp_recorded 22 colony_name E1.6.Acr.humi.1.20140731 colony_width1 22 colony_width2 22 compartment_replicates 1 complex_robust complex concatenated_date 20140731 corallite width maximum 1.8 corallite width maximum unit mm corallite width minimum 1 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 7/31/14 depth 1.524 depth lower 11 depth lower unit m depth upper 0 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -138.6193312 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E1 family Acroporidae field_host_genus_id Acropora field_host_name Acropora humilis field_host_species_id humilis full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Horseshoe full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_VI_Acropora_humilis functional_group_sensu_darling Competitive genus fossil age 55.8 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68716 geographic location (longitude) 145.44449 growth form typical digitate growth outline type determinate hemisphere Southern host species humilis host_clade_sensu_fukami VI host_clade_sensu_fukami_numeric 6 host_genus Acropora host_genus_id Acropora host_name Acropora humilis host_species_id humilis huang_roy_tree_name ACR_Acropora_humilis invertebrate_contact_types lobophytum__pocillopora__acropora__porites iucn red list category NT latitude -14.68716 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Acropora humilis_20140731 local_sample_id Acr Ske 140731 longitude 145.44449 mode of larval development spawner n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 31.12454292 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 507 oocyte size at maturity unit um outgroup n oz_disease_mean 1.216836426 oz_disease_sd 0.573106632 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter_universal 1 prop_colony_maximum_gcmp_recorded 1 range size 95054251.69 range size unit km^2 reef_name Horseshoe reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.6.Acr.humi.1.20140731.S sample type Coral Skeleton sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock687_Acr_Ske_140731 sexual system hermaphrodite shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector skeletal density 1.445384615 skeletal density unit g cm-3 southern-most range edge -35.36103205 species age phylogeny 2.035750473 species age phylogeny unit mya substrate rock substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 46687 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_VI taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Acroporidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.9 tissue compartment S tissue_loss_percent 0 turf_contact_percent 1 visibility 15 visibility_method Horizontal Secchi Disk water clarity preference clear wave exposure preference exposed western-most range edge 23.8186105 zooxanthellate zooxanthellate ERS2655091 SAMEA4835221 496922 coral metagenome Coral Mucus from Leptastrea transversa sampled from Lizard Island, Australia as sample E1.11.Lep.tran.1.20140731.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:46Z External Id SAMEA4835221 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:46Z INSDC status public Submitter Id E1.11.Lep.tran.1.20140731.M abundance gbr uncommon abundance world common algal_contact_types turf__cyanobacteria barcodesequence GGCATCATGC binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Mucus cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Horseshoe_20140731 collection time 15:30 collection_timestamp 7/31/14 15:30 coloniality colonial colony_height_m 1 colony_maximum_diameter_universal 9 colony_maximum_gcmp_recorded 9 colony_name E1.11.Lep.tran.1.20140731 colony_width1 9 colony_width2 5 compartment_replicates 1 complex_robust robust concatenated_date 20140731 corallite width maximum 9.2 corallite width maximum unit mm corallite width minimum 5.4 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 10 daily_replicate 1 date 7/31/14 depth 1.524 depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -134.2917403 env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E1 family incertae sedis field_host_genus_id Leptastrea field_host_name Leptastrea transversa field_host_species_id transversa full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Horseshoe full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XI_Leptastrea_transversa genus fossil age 37.2 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68716 geographic location (longitude) 145.44449 growth form typical encrusting hemisphere Southern host species transversa host_clade_sensu_fukami XI host_clade_sensu_fukami_numeric 11 host_genus Leptastrea host_genus_id Leptastrea host_name Leptastrea transversa host_species_id transversa huang_roy_tree_name FAV_Leptastrea_transversa invertebrate_contact_types lobophytum__coral__montipora iucn red list category LC latitude -14.68716 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Leptastrea transversa_20140731 local_sample_id Coel Muc 140731 longitude 145.44449 n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 32.22258836 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0 oz_disease_sd 0 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter_universal 1 prop_colony_maximum_gcmp_recorded 1 range size 108142246.8 range size unit km^2 reef_name Horseshoe reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.11.Lep.tran.1.20140731.M sample type Coral Mucus sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock688_Coel_Muc_140731 shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -33.22953208 species age phylogeny 3.408186422 species age phylogeny unit mya substrate rock substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 498490 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XI taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_incertae sedis taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.9 tissue compartment M tissue_loss_percent 0 turf_contact_percent 30 visibility 15 visibility_method Horizontal Secchi Disk water clarity preference clear wave exposure preference broad western-most range edge 30.2131105 zooxanthellate zooxanthellate ERS2655092 SAMEA4835222 496922 coral metagenome .Millepora Mucus from Millepora sp sampled from Lizard Island, Australia as sample E1.Outgroup.Millepora.sp1.20140731.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:46Z External Id SAMEA4835222 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:46Z INSDC status public Submitter Id E1.Out.Mil.sp.1.20140731.M algal_contact_types turf barcodesequence GCTCTAACAT binary_algal_contact n binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Millepora Mucus cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Horseshoe_20140731 collection time 15:30 collection_timestamp 7/31/14 15:30 colony_height_m 13 colony_maximum_diameter_universal 93 colony_maximum_gcmp_recorded 93 colony_name E1.Out.Mil.sp.1.20140731 colony_width1 9 colony_width2 9 compartment_replicates 1 complex_robust outgroup concatenated_date 20140731 country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 7/31/14 depth 1.524 depth_method measured disease_percent 0 dna_extracted y env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Millepora Mucus environmental sample Yes expedition_number E1 family Milleporidae field_host_genus_id Millepora field_host_name Millepora sp field_host_species_id sp full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Horseshoe full_taxonomy_string_with_clade Cnidaria_Hydrozoa_Anthoathecata_Milleporidae_Millepora_sp geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68716 geographic location (longitude) 145.44449 hemisphere Southern host species sp host_clade_sensu_fukami Outgroup_Cnidaria_Hydrozoa_Anthoathecata_Milleporidae host_clade_sensu_fukami_numeric Outgroup_Cnidaria_Hydrozoa_Anthoathecata_Milleporidae host_genus Millepora host_genus_id Millepora host_name Millepora sp host_species_id sp invertebrate_contact_types lobophytum__pocillopora latitude -14.68716 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Millepora sp._20140731 local_sample_id Mil Muc 140731 longitude 145.44449 n_algal_contacts 1 n_macroalgal_contacts 0 ncbi_inherited_blast_name hydrozoans ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup y parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter_universal 0.096774194 prop_colony_maximum_gcmp_recorded 0.096774194 reef_name Horseshoe reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.Out.Mil.sp.1.20140731.M sample type Millepora Mucus sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock689_Mil_Muc_140731 shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector substrate rock symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 51117 taxonomy_string_to_clade Cnidaria_Hydrozoa_Anthoathecata_Milleporidae taxonomy_string_to_class Cnidaria_Hydrozoa taxonomy_string_to_family Cnidaria_Hydrozoa_Anthoathecata_Milleporidae taxonomy_string_to_order Cnidaria_Hydrozoa_Anthoathecata taxonomy_string_to_subclass Cnidaria_Hydrozoa_Leptolinae temperature 23.9 tissue compartment M tissue_loss_percent 0 turf_contact_percent 5 visibility 15 visibility_method Horizontal Secchi Disk ERS2655093 SAMEA4835223 496922 coral metagenome Zooanthid Tissue from Palythoa caesia sampled from Lizard Island, Australia as sample E1.Outgroup.Palythoa.caesia.1.20140809.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:46Z External Id SAMEA4835223 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:46Z INSDC status public Submitter Id E1.Out.Pal.caes.1.20140809.T algal_contact_types turf__cyanobacteria__cca barcodesequence GTACTCGCGA binary_algal_contact y binary_cca_contact y binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Zooanthid Tissue cca_contact_percent 15 collected by Ryan McMinds collection date 2014 collection id Horseshoe_20140809 collection time 10:20 collection_timestamp 8/9/14 10:20 colony_height_m 1 colony_maximum_diameter_universal 30 colony_maximum_gcmp_recorded 30 colony_name E1.Out.Pal.caes.1.20140809 colony_width1 4 colony_width2 4 compartment_replicates 1 complex_robust outgroup concatenated_date 20140809 country Australia cyanobacteria_contact y cyanobacteria_percent 10 daily_replicate 1 date 8/9/14 depth 1.2192 depth_method measured disease_percent 0 dna_extracted y env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Zooanthid Tissue environmental sample Yes expedition_number E1 family Sphenopidae field_host_genus_id Palythoa field_host_name Palythoa caesia field_host_species_id caesia full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Horseshoe full_taxonomy_string_with_clade Cnidaria_Anthozoa_Zoantharia_Sphenopidae_Palythoa_caesia geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68716 geographic location (longitude) 145.44449 hemisphere Southern host species caesia host_clade_sensu_fukami Outgroup_Cnidaria_Anthozoa_Zoantharia_Sphenopidae host_clade_sensu_fukami_numeric Outgroup_Cnidaria_Anthozoa_Zoantharia host_genus Palythoa host_genus_id Palythoa host_name Palythoa caesia host_species_id caesia latitude -14.68716 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Zooanthid_20140809 local_sample_id Zoo Tis 140809 longitude 145.44449 n_algal_contacts 3 n_macroalgal_contacts 0 ncbi_inherited_blast_name mat anemones ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup y parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter_universal 0.133333333 prop_colony_maximum_gcmp_recorded 0.133333333 reef_name Horseshoe reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.Out.Pal.caes.1.20140809.T sample type Zooanthid Tissue sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock69 shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector substrate pavement symbio_its2_sequenced y target gene 16S target subfragment V4 taxon id 134929 taxonomy_string_to_clade Cnidaria_Anthozoa_Zoantharia_Sphenopidae taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Zoantharia_Sphenopidae taxonomy_string_to_order Cnidaria_Anthozoa_Zoantharia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.3 tissue compartment T tissue_loss_percent 0 turf_contact_percent 20 visibility 9 visibility_method Horizontal Secchi Disk ERS2655094 SAMEA4835224 496922 coral metagenome Coral Mucus from Pachyseris speciosa sampled from Lizard Island, Australia as sample E1.4.Pac.spec.1.20140801.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:46Z External Id SAMEA4835224 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:46Z INSDC status public Submitter Id E1.4.Pac.spec.1.20140801.M abundance gbr common abundance world common algal_contact_types turf__cyanobacteria barcodesequence GAGCACGGAA binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Mucus cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Trawler_20140801 collection time 11:00 collection_timestamp 8/1/14 11:00 coloniality colonial colony maximum diameter 2 colony maximum diameter unit cm colony_height_m 1 colony_maximum_diameter 2 colony_maximum_diameter_universal 37 colony_maximum_gcmp_recorded 37 colony_name E1.4.Pac.spec.1.20140801 colony_width1 10 colony_width2 8 compartment_replicates 1 complex_robust complex concatenated_date 20140801 corallite width maximum 4.6 corallite width maximum unit mm corallite width minimum 2.4 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 10 daily_replicate 1 date 8/1/14 depth 2.7432 depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -140.3257694 env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E1 family Agariciidae field_host_genus_id Pachyseris field_host_name Pachyseris speciosa field_host_species_id speciosa full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_IV_Pachyseris_speciosa functional_group_sensu_darling Generalist genus fossil age 33.9 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68344 geographic location (longitude) 145.46554 growth form typical laminar hemisphere Southern host species speciosa host_clade_sensu_fukami IV host_clade_sensu_fukami_numeric 4 host_genus Pachyseris host_genus_id Pachyseris host_name Pachyseris speciosa host_species_id speciosa huang_roy_tree_name AGA_Pachyseris iucn red list category LC latitude -14.68344 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Pachyseris speciosa_20140801 local_sample_id Pach Muc 140801 longitude 145.46554 mode of larval development spawner n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 36.65327262 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 314 oocyte size at maturity unit um outgroup n oz_disease_mean 0 oz_disease_sd 0 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter 5 prop_colony_maximum_diameter_universal 0.27027027 prop_colony_maximum_gcmp_recorded 0.27027027 propagule size on release mean 368 propagule size on release mean unit um range size 84601943.66 range size unit km^2 reef_name Trawler reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.4.Pac.spec.1.20140801.M sample type Coral Mucus sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact y sequence_center_id Pollock690_Pach_Muc_140801 sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -34.47524539 species age phylogeny 1.559988321 species age phylogeny unit mya substrate sediment substrate attachment attached symbio_its2_sequenced n symbiodinium sp. in propagules no target gene 16S target subfragment V4 taxon id 497657 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_IV taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Agariciidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.9 tissue compartment M tissue_loss_percent 0 turf_contact_percent 10 visibility 23 visibility_method Horizontal Secchi Disk water clarity preference clear wave exposure preference broad western-most range edge 25.1595079 zooxanthellate zooxanthellate ERS2655095 SAMEA4835225 496922 coral metagenome Coral Tissue from Pachyseris speciosa sampled from Lizard Island, Australia as sample E1.4.Pac.spec.1.20140801.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:47Z External Id SAMEA4835225 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:47Z INSDC status public Submitter Id E1.4.Pac.spec.1.20140801.T abundance gbr common abundance world common algal_contact_types turf__cyanobacteria barcodesequence GAGAGGACAT binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Tissue cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Trawler_20140801 collection time 11:00 collection_timestamp 8/1/14 11:00 coloniality colonial colony maximum diameter 2 colony maximum diameter unit cm colony_height_m 1 colony_maximum_diameter 2 colony_maximum_diameter_universal 37 colony_maximum_gcmp_recorded 37 colony_name E1.4.Pac.spec.1.20140801 colony_width1 10 colony_width2 8 compartment_replicates 1 complex_robust complex concatenated_date 20140801 corallite width maximum 4.6 corallite width maximum unit mm corallite width minimum 2.4 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 10 daily_replicate 1 date 8/1/14 depth 2.7432 depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -140.3257694 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E1 family Agariciidae field_host_genus_id Pachyseris field_host_name Pachyseris speciosa field_host_species_id speciosa full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_IV_Pachyseris_speciosa functional_group_sensu_darling Generalist genus fossil age 33.9 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68344 geographic location (longitude) 145.46554 growth form typical laminar hemisphere Southern host species speciosa host_clade_sensu_fukami IV host_clade_sensu_fukami_numeric 4 host_genus Pachyseris host_genus_id Pachyseris host_name Pachyseris speciosa host_species_id speciosa huang_roy_tree_name AGA_Pachyseris iucn red list category LC latitude -14.68344 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Pachyseris speciosa_20140801 local_sample_id Pach Tis 140801 longitude 145.46554 mode of larval development spawner n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 36.65327262 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 314 oocyte size at maturity unit um outgroup n oz_disease_mean 0 oz_disease_sd 0 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter 5 prop_colony_maximum_diameter_universal 0.27027027 prop_colony_maximum_gcmp_recorded 0.27027027 propagule size on release mean 368 propagule size on release mean unit um range size 84601943.66 range size unit km^2 reef_name Trawler reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.4.Pac.spec.1.20140801.T sample type Coral Tissue sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact y sequence_center_id Pollock691_Pach_Tis_140801 sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -34.47524539 species age phylogeny 1.559988321 species age phylogeny unit mya substrate sediment substrate attachment attached symbio_its2_sequenced n symbiodinium sp. in propagules no target gene 16S target subfragment V4 taxon id 497657 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_IV taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Agariciidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.9 tissue compartment T tissue_loss_percent 0 turf_contact_percent 10 visibility 23 visibility_method Horizontal Secchi Disk water clarity preference clear wave exposure preference broad western-most range edge 25.1595079 zooxanthellate zooxanthellate ERS2655096 SAMEA4835226 496922 coral metagenome Coral Mucus from Physogyra lichtensteini sampled from Lizard Island, Australia as sample E1.14.Phy.lich.1.20140801.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:47Z External Id SAMEA4835226 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:47Z INSDC status public Submitter Id E1.14.Phy.lich.1.20140801.M abundance gbr common abundance world common algal_contact_types turf__cyanobacteria barcodesequence TCGAACTGCA binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Mucus cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Trawler_20140801 collection time 11:00 collection_timestamp 8/1/14 11:00 coloniality colonial colony maximum diameter 100 colony maximum diameter unit cm colony_height_m 30 colony_maximum_diameter 100 colony_maximum_diameter_universal 100 colony_maximum_gcmp_recorded 80 colony_name E1.14.Phy.lich.1.20140801 colony_width1 25 colony_width2 4 compartment_replicates 1 complex_robust robust concatenated_date 20140801 corallite width maximum 20 corallite width maximum unit mm corallite width minimum 6 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 1 daily_replicate 1 date 8/1/14 depth 3.3528 depth lower 20 depth lower unit m depth upper 1 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -173.2615884 env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E1 family incertae sedis field_host_genus_id Physogyra field_host_name Physogyra lichtensteini field_host_species_id lichtensteini full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XIV_Physogyra_lichtensteini functional_group_sensu_darling Stress-tolerant genus fossil age 0.01 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68344 geographic location (longitude) 145.46554 growth form typical massive hemisphere Southern host species lichtensteini host_clade_sensu_fukami XIV host_clade_sensu_fukami_numeric 14 host_genus Physogyra host_genus_id Physogyra host_name Physogyra lichtensteini host_species_id lichtensteini huang_roy_tree_name EUP_Physogyra_lichtensteini invertebrate_contact_types porites iucn red list category VU latitude -14.68344 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Physogyra lichtensteini_20140801 local_sample_id Eup Muc 140801 longitude 145.46554 n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 33.94501258 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0 oz_disease_sd 0 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter 0.25 prop_colony_maximum_diameter_universal 0.25 prop_colony_maximum_gcmp_recorded 0.3125 range size 78301486.65 range size unit km^2 reef_name Trawler reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.14.Phy.lich.1.20140801.M sample type Coral Mucus sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact y sequence_center_id Pollock692_Eup_Muc_140801 shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -35.38256235 species age phylogeny 1.648875415 species age phylogeny unit mya substrate rock substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 419442 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XIV taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_incertae sedis taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.9 tissue compartment M tissue_loss_percent 0 turf_contact_percent 5 visibility 23 visibility_method Horizontal Secchi Disk water clarity preference turbid wave exposure preference protected western-most range edge 30.6437165 zooxanthellate zooxanthellate ERS2655097 SAMEA4835227 496922 coral metagenome Coral Tissue from Physogyra lichtensteini sampled from Lizard Island, Australia as sample E1.14.Phy.lich.1.20140801.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:47Z External Id SAMEA4835227 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:47Z INSDC status public Submitter Id E1.14.Phy.lich.1.20140801.T abundance gbr common abundance world common algal_contact_types turf__cyanobacteria barcodesequence GGAGACTGTA binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Tissue cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Trawler_20140801 collection time 11:00 collection_timestamp 8/1/14 11:00 coloniality colonial colony maximum diameter 100 colony maximum diameter unit cm colony_height_m 30 colony_maximum_diameter 100 colony_maximum_diameter_universal 100 colony_maximum_gcmp_recorded 80 colony_name E1.14.Phy.lich.1.20140801 colony_width1 25 colony_width2 4 compartment_replicates 1 complex_robust robust concatenated_date 20140801 corallite width maximum 20 corallite width maximum unit mm corallite width minimum 6 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 1 daily_replicate 1 date 8/1/14 depth 3.3528 depth lower 20 depth lower unit m depth upper 1 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -173.2615884 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E1 family incertae sedis field_host_genus_id Physogyra field_host_name Physogyra lichtensteini field_host_species_id lichtensteini full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XIV_Physogyra_lichtensteini functional_group_sensu_darling Stress-tolerant genus fossil age 0.01 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68344 geographic location (longitude) 145.46554 growth form typical massive hemisphere Southern host species lichtensteini host_clade_sensu_fukami XIV host_clade_sensu_fukami_numeric 14 host_genus Physogyra host_genus_id Physogyra host_name Physogyra lichtensteini host_species_id lichtensteini huang_roy_tree_name EUP_Physogyra_lichtensteini invertebrate_contact_types porites iucn red list category VU latitude -14.68344 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Physogyra lichtensteini_20140801 local_sample_id Eup Tis 140801 longitude 145.46554 n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 33.94501258 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0 oz_disease_sd 0 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter 0.25 prop_colony_maximum_diameter_universal 0.25 prop_colony_maximum_gcmp_recorded 0.3125 range size 78301486.65 range size unit km^2 reef_name Trawler reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.14.Phy.lich.1.20140801.T sample type Coral Tissue sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact y sequence_center_id Pollock693_Eup_Tis_140801 shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -35.38256235 species age phylogeny 1.648875415 species age phylogeny unit mya substrate rock substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 419442 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XIV taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_incertae sedis taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.9 tissue compartment T tissue_loss_percent 0 turf_contact_percent 5 visibility 23 visibility_method Horizontal Secchi Disk water clarity preference turbid wave exposure preference protected western-most range edge 30.6437165 zooxanthellate zooxanthellate ERS2655098 SAMEA4835228 496922 coral metagenome Coral Mucus from Montipora hispida sampled from Lizard Island, Australia as sample E1.6.Mon.hisp1.20140807.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:47Z External Id SAMEA4835228 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:47Z INSDC status public Submitter Id E1.6.Mon.hisp.1.20140807.M abundance gbr common abundance world common algal_contact_types turf__cyanobacteria barcodesequence GCATGCCAGT binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Mucus cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Trawler_20140807 collection time 10:00 collection_timestamp 8/7/14 10:00 coloniality colonial colony_height_m 22 colony_maximum_diameter_universal 30 colony_maximum_gcmp_recorded 30 colony_name E1.6.Mon.hisp.1.20140807 colony_width1 30 colony_width2 30 compartment_replicates 1 complex_robust complex concatenated_date 20140807 corallite width maximum 1.4 corallite width maximum unit mm corallite width minimum 0.9 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 2 daily_replicate 1 date 8/7/14 depth 1.2192 depth lower 40 depth lower unit m depth upper 1 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -136.7052151 env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E1 family Acroporidae field_host_genus_id Montipora field_host_name Montipora hispida field_host_species_id hispida full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_VI_Montipora_hispida genus fossil age 33.9 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68344 geographic location (longitude) 145.46554 growth form typical encrusting_long_uprights hemisphere Southern host species hispida host_clade_sensu_fukami VI host_clade_sensu_fukami_numeric 6 host_genus Montipora host_genus_id Montipora host_name Montipora hispida host_species_id hispida huang_roy_tree_name ACR_Montipora_hispida invertebrate_contact_types acropora__octo iucn red list category LC latitude -14.68344 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Montipora hispida_20140807 local_sample_id Tur Muc 140807 longitude 145.46554 mode of larval development spawner n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 39.2490333 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.46822174 oz_disease_sd 0.251750777 par_method buoy parrotfish_bites n pcr primers 515F/806R photosynthetically_active_radiation 724.045 physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter_universal 1 prop_colony_maximum_gcmp_recorded 1 range size 76579541.45 range size unit km^2 reef_name Trawler reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.6.Mon.hisp.1.20140807.M sample type Coral Mucus sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact y sequence_center_id Pollock694_Tur_Muc_140807 sexual system hermaphrodite shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -34.82124616 species age phylogeny 1.824355377 species age phylogeny unit mya substrate sediment substrate attachment attached symbio_its2_sequenced y symbiodinium sp. in propagules yes target gene 16S target subfragment V4 taxon id 246293 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_VI taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Acroporidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.9 tissue compartment M tissue_loss_percent 0 turf_contact_percent 5 visibility 15 visibility_method Horizontal Secchi Disk water clarity preference turbid wave exposure preference protected western-most range edge 37.801188 zooxanthellate zooxanthellate ERS2655099 SAMEA4835229 496922 coral metagenome Coral Tissue from Montipora hispida sampled from Lizard Island, Australia as sample E1.6.Mon.hisp1.20140807.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:47Z External Id SAMEA4835229 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:47Z INSDC status public Submitter Id E1.6.Mon.hisp.1.20140807.T abundance gbr common abundance world common algal_contact_types turf__cyanobacteria barcodesequence GAAGCGCACT binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Tissue cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Trawler_20140807 collection time 10:00 collection_timestamp 8/7/14 10:00 coloniality colonial colony_height_m 22 colony_maximum_diameter_universal 30 colony_maximum_gcmp_recorded 30 colony_name E1.6.Mon.hisp.1.20140807 colony_width1 30 colony_width2 30 compartment_replicates 1 complex_robust complex concatenated_date 20140807 corallite width maximum 1.4 corallite width maximum unit mm corallite width minimum 0.9 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 2 daily_replicate 1 date 8/7/14 depth 1.2192 depth lower 40 depth lower unit m depth upper 1 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -136.7052151 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E1 family Acroporidae field_host_genus_id Montipora field_host_name Montipora hispida field_host_species_id hispida full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_VI_Montipora_hispida genus fossil age 33.9 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68344 geographic location (longitude) 145.46554 growth form typical encrusting_long_uprights hemisphere Southern host species hispida host_clade_sensu_fukami VI host_clade_sensu_fukami_numeric 6 host_genus Montipora host_genus_id Montipora host_name Montipora hispida host_species_id hispida huang_roy_tree_name ACR_Montipora_hispida invertebrate_contact_types acropora__octo iucn red list category LC latitude -14.68344 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Montipora hispida_20140807 local_sample_id Tur Tis 140807 longitude 145.46554 mode of larval development spawner n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 39.2490333 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.46822174 oz_disease_sd 0.251750777 par_method buoy parrotfish_bites n pcr primers 515F/806R photosynthetically_active_radiation 724.045 physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter_universal 1 prop_colony_maximum_gcmp_recorded 1 range size 76579541.45 range size unit km^2 reef_name Trawler reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.6.Mon.hisp.1.20140807.T sample type Coral Tissue sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact y sequence_center_id Pollock695_Tur_Tis_140807 sexual system hermaphrodite shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -34.82124616 species age phylogeny 1.824355377 species age phylogeny unit mya substrate sediment substrate attachment attached symbio_its2_sequenced y symbiodinium sp. in propagules yes target gene 16S target subfragment V4 taxon id 246293 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_VI taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Acroporidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.9 tissue compartment T tissue_loss_percent 0 turf_contact_percent 5 visibility 15 visibility_method Horizontal Secchi Disk water clarity preference turbid wave exposure preference protected western-most range edge 37.801188 zooxanthellate zooxanthellate ERS2655100 SAMEA4835230 496922 coral metagenome Coral Tissue from Acropora palifera sampled from North Bay, Lord Howe Island, New South Wales, Australia as sample E10.Acr.pali.3.20150627.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:47Z External Id SAMEA4835230 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:47Z INSDC status public Submitter Id E10.Acr.pali.3.20150627.T abundance gbr common abundance world common barcodesequence GTGTATGCGT binary_algal_contact n binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact n biological_sample_notes LH_278 biologicalmatter Coral Tissue cca_contact_percent 0 cca_overgrown n collected by Joe Pollock collection date 2015 collection id North Bay_20150627 collection time 9:04 collection_timestamp 6/27/15 9:04 coloniality colonial colony_height_m 35 colony_name E10.6.Acr.pali.3.20150627 colony_width1 25 colony_width2 13 compartment_replicates 1 complex_robust complex concatenated_date 20150627 coral_color D5 corallite width maximum 1.4 corallite width maximum unit mm corallite width minimum 0.7 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_overgrown n cyanobacteria_percent 0 daily_replicate 3 date 6/27/15 depth 1.2 depth lower 20 depth lower unit m depth upper 2 depth upper unit m depth_method measured disease_percent 0 dna_extracted n dominant_cover_2m sand eastern-most range edge -176.1832106 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E10 family Acroporidae field_host_genus_id Isopora field_host_name Isopora palifera field_host_species_id palifera full_location Indo-Pacific;Pacific;Tasman Sea;Australia;SE;Lord Howe Island;North Bay full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_VI_Isopora_palifera geographic area SE geographic location (country and/or sea) Australia geographic location (latitude) -31.52135 geographic location (longitude) 159.0467333 growth form typical branching_open growth outline type indeterminate hemisphere Southern host species palifera host_clade_sensu_fukami VI host_clade_sensu_fukami_numeric 6 host_genus Isopora host_genus_id Isopora host_name Isopora palifera host_species_id palifera huang_roy_tree_name ACR_Isopora_palifera iucn red list category NT latitude -31.52135 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name E10.Acr.pali.3 local_sample_id LH_278_T longitude 159.0467333 mode of larval development brooder n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 30.04437901 ocean Pacific ocean_area Tasman Sea ocean_superregion Indo-Pacific oocyte size at maturity 249 oocyte size at maturity unit um outgroup n oz_disease_mean 0.472734632 oz_disease_sd 0.174204206 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia propagule size on release mean 1459 propagule size on release mean unit um range size 78706897.7 range size unit km^2 reef_name North Bay reef_type Fringing Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E10.Acr.pali.3.20150627.T sample type Coral Tissue sampling_expedition E10_Lord_Howe_2015 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock7 sexual system hermaphrodite shelf_location inshore site name Lord Howe Island skeletal density 1.52 skeletal density unit g cm-3 southern-most range edge -34.54927646 species age phylogeny 5.265550916 species age phylogeny unit mya substrate dead_coral substrate attachment attached symbio_its2_sequenced n synonyms Acropora palifera target gene 16S target subfragment V4 taxon id 105615 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_VI taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Acroporidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 21 tissue compartment T tissue_loss_percent 0 turf_contact_percent 0 turf_overgrown n visibility 20 visibility_method Diver Estimate water clarity preference clear wave exposure preference broad western-most range edge 26.4797142 zooxanthellate zooxanthellate ERS2655101 SAMEA4835231 496922 coral metagenome Zooanthid Skeleton from Palythoa caesia sampled from Lizard Island, Australia as sample E1.Outgroup.Palythoa.caesia.1.20140809.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:47Z External Id SAMEA4835231 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:47Z INSDC status public Submitter Id E1.Out.Pal.caes.1.20140809.S algal_contact_types turf__cyanobacteria__cca barcodesequence GACGTCTGCT binary_algal_contact y binary_cca_contact y binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Zooanthid Skeleton cca_contact_percent 15 collected by Ryan McMinds collection date 2014 collection id Horseshoe_20140809 collection time 10:20 collection_timestamp 8/9/14 10:20 colony_height_m 1 colony_maximum_diameter_universal 30 colony_maximum_gcmp_recorded 30 colony_name E1.Out.Pal.caes.1.20140809 colony_width1 4 colony_width2 4 compartment_replicates 1 complex_robust outgroup concatenated_date 20140809 country Australia cyanobacteria_contact y cyanobacteria_percent 10 daily_replicate 1 date 8/9/14 depth 1.2192 depth_method measured disease_percent 0 dna_extracted y env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Zooanthid Skeleton environmental sample Yes expedition_number E1 family Sphenopidae field_host_genus_id Palythoa field_host_name Palythoa caesia field_host_species_id caesia full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Horseshoe full_taxonomy_string_with_clade Cnidaria_Anthozoa_Zoantharia_Sphenopidae_Palythoa_caesia geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68716 geographic location (longitude) 145.44449 hemisphere Southern host species caesia host_clade_sensu_fukami Outgroup_Cnidaria_Anthozoa_Zoantharia_Sphenopidae host_clade_sensu_fukami_numeric Outgroup_Cnidaria_Anthozoa_Zoantharia host_genus Palythoa host_genus_id Palythoa host_name Palythoa caesia host_species_id caesia latitude -14.68716 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Zooanthid_20140809 local_sample_id Zoo Ske 140809 longitude 145.44449 n_algal_contacts 3 n_macroalgal_contacts 0 ncbi_inherited_blast_name mat anemones ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup y parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter_universal 0.133333333 prop_colony_maximum_gcmp_recorded 0.133333333 reef_name Horseshoe reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.Out.Pal.caes.1.20140809.S sample type Zooanthid Skeleton sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock70 shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector substrate pavement symbio_its2_sequenced y target gene 16S target subfragment V4 taxon id 134929 taxonomy_string_to_clade Cnidaria_Anthozoa_Zoantharia_Sphenopidae taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Zoantharia_Sphenopidae taxonomy_string_to_order Cnidaria_Anthozoa_Zoantharia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.3 tissue compartment S tissue_loss_percent 0 turf_contact_percent 20 visibility 9 visibility_method Horizontal Secchi Disk ERS2655102 SAMEA4835232 496922 coral metagenome Coral Mucus from Pavona venosa sampled from Lizard Island, Australia as sample E1.7.Pav.veno.1.20140809.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:47Z External Id SAMEA4835232 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:47Z INSDC status public Submitter Id E1.7.Pav.veno.1.20140809.M abundance gbr uncommon abundance world common algal_contact_types turf__cyanobacteria__cca barcodesequence TAGTAGCGCG binary_algal_contact y binary_cca_contact y binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Mucus cca_contact_percent 30 collected by Ryan McMinds collection date 2014 collection id Horseshoe_20140809 collection time 10:20 collection_timestamp 8/9/14 10:20 coloniality colonial colony_height_m 3 colony_maximum_diameter_universal 20 colony_maximum_gcmp_recorded 20 colony_name E1.7.Pav.veno.1.20140809 colony_width1 17 colony_width2 5 compartment_replicates 1 complex_robust complex concatenated_date 20140809 corallite width maximum 9.3 corallite width maximum unit mm corallite width minimum 5.2 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 1 daily_replicate 1 date 8/9/14 depth 1.2192 depth lower 20 depth lower unit m depth upper 2 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -177.2203856 env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E1 family Agariciidae field_host_genus_id Pavona field_host_name Pavona venosa field_host_species_id venosa full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Horseshoe full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_VII_Pavona_venosa genus fossil age 55.8 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68716 geographic location (longitude) 145.44449 growth form typical encrusting hemisphere Southern host species venosa host_clade_sensu_fukami VII host_clade_sensu_fukami_numeric 7 host_genus Pavona host_genus_id Pavona host_name Pavona venosa host_species_id venosa huang_roy_tree_name AGA_Pavona invertebrate_contact_types coral iucn red list category VU latitude -14.68716 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Pavona venosa_20140809 local_sample_id Pav Muc 140809 longitude 145.44449 n_algal_contacts 3 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 31.7239697 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.090909091 oz_disease_sd 0.090909091 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter_universal 0.85 prop_colony_maximum_gcmp_recorded 0.85 range size 71308679.46 range size unit km^2 reef_name Horseshoe reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.7.Pav.veno.1.20140809.M sample type Coral Mucus sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock71 shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -32.18062786 species age phylogeny 0.759083367 species age phylogeny unit mya substrate rubble substrate attachment attached symbio_its2_sequenced y target gene 16S target subfragment V4 taxon id 46725 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_VII taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Agariciidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.3 tissue compartment M tissue_loss_percent 0 turf_contact_percent 5 visibility 9 visibility_method Horizontal Secchi Disk water clarity preference clear wave exposure preference broad western-most range edge 33.2657341 zooxanthellate zooxanthellate ERS2655103 SAMEA4835233 496922 coral metagenome Coral Skeleton from Pavona venosa sampled from Lizard Island, Australia as sample E1.7.Pav.veno.1.20140809.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:47Z External Id SAMEA4835233 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:47Z INSDC status public Submitter Id E1.7.Pav.veno.1.20140809.S abundance gbr uncommon abundance world common algal_contact_types turf__cyanobacteria__cca barcodesequence TACTGAGCTG binary_algal_contact y binary_cca_contact y binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Skeleton cca_contact_percent 30 collected by Ryan McMinds collection date 2014 collection id Horseshoe_20140809 collection time 10:20 collection_timestamp 8/9/14 10:20 coloniality colonial colony_height_m 3 colony_maximum_diameter_universal 20 colony_maximum_gcmp_recorded 20 colony_name E1.7.Pav.veno.1.20140809 colony_width1 17 colony_width2 5 compartment_replicates 1 complex_robust complex concatenated_date 20140809 corallite width maximum 9.3 corallite width maximum unit mm corallite width minimum 5.2 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 1 daily_replicate 1 date 8/9/14 depth 1.2192 depth lower 20 depth lower unit m depth upper 2 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -177.2203856 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E1 family Agariciidae field_host_genus_id Pavona field_host_name Pavona venosa field_host_species_id venosa full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Horseshoe full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_VII_Pavona_venosa genus fossil age 55.8 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68716 geographic location (longitude) 145.44449 growth form typical encrusting hemisphere Southern host species venosa host_clade_sensu_fukami VII host_clade_sensu_fukami_numeric 7 host_genus Pavona host_genus_id Pavona host_name Pavona venosa host_species_id venosa huang_roy_tree_name AGA_Pavona invertebrate_contact_types coral iucn red list category VU latitude -14.68716 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Pavona venosa_20140809 local_sample_id Pav Ske 140809 longitude 145.44449 n_algal_contacts 3 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 31.7239697 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.090909091 oz_disease_sd 0.090909091 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter_universal 0.85 prop_colony_maximum_gcmp_recorded 0.85 range size 71308679.46 range size unit km^2 reef_name Horseshoe reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.7.Pav.veno.1.20140809.S sample type Coral Skeleton sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock72 shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -32.18062786 species age phylogeny 0.759083367 species age phylogeny unit mya substrate rubble substrate attachment attached symbio_its2_sequenced y target gene 16S target subfragment V4 taxon id 46725 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_VII taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Agariciidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.3 tissue compartment S tissue_loss_percent 0 turf_contact_percent 5 visibility 9 visibility_method Horizontal Secchi Disk water clarity preference clear wave exposure preference broad western-most range edge 33.2657341 zooxanthellate zooxanthellate ERS2655104 SAMEA4835234 496922 coral metagenome Coral Mucus from Favites sp sampled from Lizard Island, Australia as sample E1.17.Fav.sp.1.20140811.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:47Z External Id SAMEA4835234 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:47Z INSDC status public Submitter Id E1.17.Fav.sp.1.20140811.M abundance gbr uncommon abundance world uncommon algal_contact_types turf__cyanobacteria barcodesequence TATCTCATGC binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Mucus cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Trawler_20140811 collection time 12:45 collection_timestamp 8/11/14 12:45 coloniality colonial colony maximum diameter 50 colony maximum diameter unit cm colony_height_m 9 colony_maximum_diameter_universal 35 colony_maximum_gcmp_recorded 35 colony_name E1.17.Fav.sp.1.20140811 colony_width1 5 colony_width2 2 compartment_replicates 1 complex_robust robust concatenated_date 20140811 corallite width maximum 10.1 corallite width maximum unit mm corallite width minimum 10 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 5 daily_replicate 1 date 8/11/14 depth 3.9624 depth lower 30 depth lower unit m depth upper 1 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge 177.4580418 env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E1 family Lobophylliidae field_host_genus_id Favites field_host_name Favites sp field_host_species_id sp full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XIX_Echinophyllia_orpheensis functional_group_sensu_darling Stress-tolerant genus fossil age 15.97 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68344 geographic location (longitude) 145.46554 growth form typical submassive hemisphere Southern host species orpheensis host_clade_sensu_fukami XIX host_clade_sensu_fukami_numeric 19 host_genus Echinophyllia host_genus_id Echinophyllia host_name Echinophyllia orpheensis host_species_id orpheensis huang_roy_tree_name PEC_Echinophyllia_orpheensis iucn red list category LC latitude -14.68344 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Favites sp._20140811 local_sample_id Fav Muc 140811 longitude 145.46554 mode of larval development spawner n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 31.09645749 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0 oz_disease_sd 0 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter_universal 0.142857143 prop_colony_maximum_gcmp_recorded 0.142857143 range size 51517602.8 range size unit km^2 reef_name Trawler reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.17.Fav.sp.1.20140811.M sample type Coral Mucus sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock73 sexual system hermaphrodite shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -33.99869403 species age phylogeny 0.562951815 species age phylogeny unit mya substrate rock substrate attachment attached symbio_its2_sequenced y target gene 16S target subfragment V4 taxon id 126652 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XIX taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Lobophylliidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.9 tissue compartment M tissue_loss_percent 0 turf_contact_percent 40 visibility 15 visibility_method Horizontal Secchi Disk water clarity preference both wave exposure preference broad western-most range edge 30.4391627 zooxanthellate zooxanthellate ERS2655105 SAMEA4835235 496922 coral metagenome Coral Tissue from Favites sp sampled from Lizard Island, Australia as sample E1.17.Fav.sp.1.20140811.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:47Z External Id SAMEA4835235 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:47Z INSDC status public Submitter Id E1.17.Fav.sp.1.20140811.T abundance gbr uncommon abundance world uncommon algal_contact_types turf__cyanobacteria barcodesequence TGTCGTCATA binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Tissue cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Trawler_20140811 collection time 12:45 collection_timestamp 8/11/14 12:45 coloniality colonial colony maximum diameter 50 colony maximum diameter unit cm colony_height_m 9 colony_maximum_diameter_universal 35 colony_maximum_gcmp_recorded 35 colony_name E1.17.Fav.sp.1.20140811 colony_width1 5 colony_width2 2 compartment_replicates 1 complex_robust robust concatenated_date 20140811 corallite width maximum 10.1 corallite width maximum unit mm corallite width minimum 10 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 5 daily_replicate 1 date 8/11/14 depth 3.9624 depth lower 30 depth lower unit m depth upper 1 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge 177.4580418 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E1 family Lobophylliidae field_host_genus_id Favites field_host_name Favites sp field_host_species_id sp full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XIX_Echinophyllia_orpheensis functional_group_sensu_darling Stress-tolerant genus fossil age 15.97 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68344 geographic location (longitude) 145.46554 growth form typical submassive hemisphere Southern host species orpheensis host_clade_sensu_fukami XIX host_clade_sensu_fukami_numeric 19 host_genus Echinophyllia host_genus_id Echinophyllia host_name Echinophyllia orpheensis host_species_id orpheensis huang_roy_tree_name PEC_Echinophyllia_orpheensis iucn red list category LC latitude -14.68344 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Favites sp._20140811 local_sample_id Fav Tis 140811 longitude 145.46554 mode of larval development spawner n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 31.09645749 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0 oz_disease_sd 0 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter_universal 0.142857143 prop_colony_maximum_gcmp_recorded 0.142857143 range size 51517602.8 range size unit km^2 reef_name Trawler reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.17.Fav.sp.1.20140811.T sample type Coral Tissue sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock74 sexual system hermaphrodite shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -33.99869403 species age phylogeny 0.562951815 species age phylogeny unit mya substrate rock substrate attachment attached symbio_its2_sequenced y target gene 16S target subfragment V4 taxon id 126652 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XIX taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Lobophylliidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.9 tissue compartment T tissue_loss_percent 0 turf_contact_percent 40 visibility 15 visibility_method Horizontal Secchi Disk water clarity preference both wave exposure preference broad western-most range edge 30.4391627 zooxanthellate zooxanthellate ERS2655106 SAMEA4835236 496922 coral metagenome Coral Skeleton from Favites sp sampled from Lizard Island, Australia as sample E1.17.Fav.sp.1.20140811.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:47Z External Id SAMEA4835236 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:47Z INSDC status public Submitter Id E1.17.Fav.sp.1.20140811.S abundance gbr uncommon abundance world uncommon algal_contact_types turf__cyanobacteria barcodesequence CATGAGTGTA binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Skeleton cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Trawler_20140811 collection time 12:45 collection_timestamp 8/11/14 12:45 coloniality colonial colony maximum diameter 50 colony maximum diameter unit cm colony_height_m 9 colony_maximum_diameter_universal 35 colony_maximum_gcmp_recorded 35 colony_name E1.17.Fav.sp.1.20140811 colony_width1 5 colony_width2 2 compartment_replicates 1 complex_robust robust concatenated_date 20140811 corallite width maximum 10.1 corallite width maximum unit mm corallite width minimum 10 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 5 daily_replicate 1 date 8/11/14 depth 3.9624 depth lower 30 depth lower unit m depth upper 1 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge 177.4580418 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E1 family Lobophylliidae field_host_genus_id Favites field_host_name Favites sp field_host_species_id sp full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XIX_Echinophyllia_orpheensis functional_group_sensu_darling Stress-tolerant genus fossil age 15.97 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68344 geographic location (longitude) 145.46554 growth form typical submassive hemisphere Southern host species orpheensis host_clade_sensu_fukami XIX host_clade_sensu_fukami_numeric 19 host_genus Echinophyllia host_genus_id Echinophyllia host_name Echinophyllia orpheensis host_species_id orpheensis huang_roy_tree_name PEC_Echinophyllia_orpheensis iucn red list category LC latitude -14.68344 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Favites sp._20140811 local_sample_id Fav Ske 140811 longitude 145.46554 mode of larval development spawner n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 31.09645749 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0 oz_disease_sd 0 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter_universal 0.142857143 prop_colony_maximum_gcmp_recorded 0.142857143 range size 51517602.8 range size unit km^2 reef_name Trawler reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.17.Fav.sp.1.20140811.S sample type Coral Skeleton sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock75 sexual system hermaphrodite shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -33.99869403 species age phylogeny 0.562951815 species age phylogeny unit mya substrate rock substrate attachment attached symbio_its2_sequenced y target gene 16S target subfragment V4 taxon id 126652 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XIX taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Lobophylliidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.9 tissue compartment S tissue_loss_percent 0 turf_contact_percent 40 visibility 15 visibility_method Horizontal Secchi Disk water clarity preference both wave exposure preference broad western-most range edge 30.4391627 zooxanthellate zooxanthellate ERS2655107 SAMEA4835237 496922 coral metagenome Coral Mucus from Fungia sp sampled from Lizard Island, Australia as sample E1.11.Fun.sp1.20140811.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:47Z External Id SAMEA4835237 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:47Z INSDC status public Submitter Id E1.11.Fun.sp.1.20140811.M barcodesequence TATCATGTGC binary_algal_contact n binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact n biologicalmatter Coral Mucus cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Trawler_20140811 collection time 12:45 collection_timestamp 8/11/14 12:45 colony_height_m 1 colony_maximum_diameter_universal 20 colony_maximum_gcmp_recorded 20 colony_name E1.11.Fun.sp.1.20140811 colony_width1 5 colony_width2 5 compartment_replicates 1 complex_robust robust concatenated_date 20140811 country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 8/11/14 depth 3.9624 depth_method measured disease_percent 0 dna_extracted y env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E1 family Fungiidae field_host_genus_id Fungia field_host_name Fungia sp field_host_species_id sp full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XI_Fungia_sp functional_group_sensu_darling Stress-tolerant geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68344 geographic location (longitude) 145.46554 hemisphere Southern host species sp host_clade_sensu_fukami XI host_clade_sensu_fukami_numeric 11 host_genus Fungia host_genus_id Fungia host_name Fungia sp host_species_id sp huang_roy_tree_name FUN latitude -14.68344 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Fungia sp._20140811 local_sample_id Fun Muc 140811 longitude 145.46554 n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.078431373 oz_disease_sd 0.078431373 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter_universal 0.25 prop_colony_maximum_gcmp_recorded 0.25 reef_name Trawler reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.11.Fun.sp.1.20140811.M sample type Coral Mucus sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact y sequence_center_id Pollock76 shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector substrate sediment symbio_its2_sequenced y target gene 16S target subfragment V4 taxon id 46712 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XI taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Fungiidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.9 tissue compartment M tissue_loss_percent 0 turf_contact_percent 0 visibility 15 visibility_method Horizontal Secchi Disk ERS2655108 SAMEA4835238 496922 coral metagenome Coral Tissue from Fungia sp sampled from Lizard Island, Australia as sample E1.11.Fun.sp1.20140811.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:47Z External Id SAMEA4835238 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:47Z INSDC status public Submitter Id E1.11.Fun.sp.1.20140811.T barcodesequence CTAGAGTATC binary_algal_contact n binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact n biologicalmatter Coral Tissue cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Trawler_20140811 collection time 12:45 collection_timestamp 8/11/14 12:45 colony_height_m 1 colony_maximum_diameter_universal 20 colony_maximum_gcmp_recorded 20 colony_name E1.11.Fun.sp.1.20140811 colony_width1 5 colony_width2 5 compartment_replicates 1 complex_robust robust concatenated_date 20140811 country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 8/11/14 depth 3.9624 depth_method measured disease_percent 0 dna_extracted y env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E1 family Fungiidae field_host_genus_id Fungia field_host_name Fungia sp field_host_species_id sp full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XI_Fungia_sp functional_group_sensu_darling Stress-tolerant geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68344 geographic location (longitude) 145.46554 hemisphere Southern host species sp host_clade_sensu_fukami XI host_clade_sensu_fukami_numeric 11 host_genus Fungia host_genus_id Fungia host_name Fungia sp host_species_id sp huang_roy_tree_name FUN latitude -14.68344 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Fungia sp._20140811 local_sample_id Fun Tis 140811 longitude 145.46554 n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.078431373 oz_disease_sd 0.078431373 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter_universal 0.25 prop_colony_maximum_gcmp_recorded 0.25 reef_name Trawler reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.11.Fun.sp.1.20140811.T sample type Coral Tissue sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact y sequence_center_id Pollock77 shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector substrate sediment symbio_its2_sequenced y target gene 16S target subfragment V4 taxon id 46712 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XI taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Fungiidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.9 tissue compartment T tissue_loss_percent 0 turf_contact_percent 0 visibility 15 visibility_method Horizontal Secchi Disk ERS2655109 SAMEA4835239 496922 coral metagenome Coral Skeleton from Fungia sp sampled from Lizard Island, Australia as sample E1.11.Fun.sp1.20140811.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:47Z External Id SAMEA4835239 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:47Z INSDC status public Submitter Id E1.11.Fun.sp.1.20140811.S barcodesequence TGTCTCTATC binary_algal_contact n binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact n biologicalmatter Coral Skeleton cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Trawler_20140811 collection time 12:45 collection_timestamp 8/11/14 12:45 colony_height_m 1 colony_maximum_diameter_universal 20 colony_maximum_gcmp_recorded 20 colony_name E1.11.Fun.sp.1.20140811 colony_width1 5 colony_width2 5 compartment_replicates 1 complex_robust robust concatenated_date 20140811 country Australia cyanobacteria_contact n cyanobacteria_percent 0 daily_replicate 1 date 8/11/14 depth 3.9624 depth_method measured disease_percent 0 dna_extracted y env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E1 family Fungiidae field_host_genus_id Fungia field_host_name Fungia sp field_host_species_id sp full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XI_Fungia_sp functional_group_sensu_darling Stress-tolerant geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68344 geographic location (longitude) 145.46554 hemisphere Southern host species sp host_clade_sensu_fukami XI host_clade_sensu_fukami_numeric 11 host_genus Fungia host_genus_id Fungia host_name Fungia sp host_species_id sp huang_roy_tree_name FUN latitude -14.68344 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Fungia sp._20140811 local_sample_id Fun Ske 140811 longitude 145.46554 n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.078431373 oz_disease_sd 0.078431373 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter_universal 0.25 prop_colony_maximum_gcmp_recorded 0.25 reef_name Trawler reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.11.Fun.sp.1.20140811.S sample type Coral Skeleton sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact y sequence_center_id Pollock78 shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector substrate sediment symbio_its2_sequenced y target gene 16S target subfragment V4 taxon id 46712 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XI taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Fungiidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.9 tissue compartment S tissue_loss_percent 0 turf_contact_percent 0 visibility 15 visibility_method Horizontal Secchi Disk ERS2655110 SAMEA4835240 496922 coral metagenome .Heliopora Mucus from Heliopora coerulea sampled from Lizard Island, Australia as sample E1.Outgroup.Heliopora.coerulea.1.20140811.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:48Z External Id SAMEA4835240 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:48Z INSDC status public Submitter Id E1.Out.Hel.coer.1.20140811.M algal_contact_types turf__cyanobacteria barcodesequence TAGTCTGTCA binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Heliopora Mucus cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Trawler_20140811 collection time 12:45 collection_timestamp 8/11/14 12:45 colony_height_m 40 colony_maximum_diameter_universal 100 colony_maximum_gcmp_recorded 100 colony_name E1.Out.Hel.coer.1.20140811 colony_width1 100 colony_width2 60 compartment_replicates 1 complex_robust outgroup concatenated_date 20140811 country Australia cyanobacteria_contact y cyanobacteria_percent 2 daily_replicate 1 date 8/11/14 depth 1.2192 depth_method measured disease_percent 0 dna_extracted y env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Heliopora Mucus environmental sample Yes expedition_number E1 family Helioporidae field_host_genus_id Heliopora field_host_name Heliopora coerulea field_host_species_id coerulea full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Helioporaceae_Helioporidae_Heliopora_coerulea geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68344 geographic location (longitude) 145.46554 hemisphere Southern host species coerulea host_clade_sensu_fukami Outgroup_Cnidaria_Anthozoa_Helioporaceae host_clade_sensu_fukami_numeric Outgroup_Cnidaria_Anthozoa_Helioporaceae host_genus Heliopora host_genus_id Heliopora host_name Heliopora coerulea host_species_id coerulea invertebrate_contact_types ophiuroid__lobophytum__urchin latitude -14.68344 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Heliopora coerulea_20140811 local_sample_id Blu Muc 140811 longitude 145.46554 n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name Blue corals ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup y parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter_universal 1 prop_colony_maximum_gcmp_recorded 1 reef_name Trawler reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.Out.Hel.coer.1.20140811.M sample type Heliopora Mucus sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock79 shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector substrate rock symbio_its2_sequenced y target gene 16S target subfragment V4 taxon id 86515 taxonomy_string_to_clade Cnidaria_Anthozoa_Helioporaceae_Helioporidae taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Helioporaceae_Helioporidae taxonomy_string_to_order Cnidaria_Anthozoa_Helioporaceae taxonomy_string_to_subclass Cnidaria_Anthozoa_Octocorallia temperature 23.9 tissue compartment M tissue_loss_percent 0 turf_contact_percent 10 visibility 15 visibility_method Horizontal Secchi Disk ERS2655111 SAMEA4835241 496922 coral metagenome ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:48Z External Id SAMEA4835241 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:48Z INSDC status public Submitter Id E10.Sed.1.20150628 barcodesequence GTATCGTCGT collected by Joe Pollock collection date 2015 collection id North Bay_20150628 collection time 9:10 collection_timestamp 6/28/15 9:10 concatenated_date 20150628 country Australia daily_replicate 1 date 6/28/15 depth 1.2 dna_extracted n env matter sandy sediment environment (biome) coral reef environment (feature) coral environmental sample Yes expedition_number E10 full_location Indo-Pacific;Pacific;Tasman Sea;Australia;SE;Lord Howe Island;North Bay geographic area SE geographic location (country and/or sea) Australia geographic location (latitude) -31.52135 geographic location (longitude) 159.0467333 hemisphere Southern latitude -31.52135 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name LH_281 local_sample_id LH_281 longitude 159.0467333 ocean Pacific ocean_area Tasman Sea ocean_superregion Indo-Pacific pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia reef_name North Bay reef_type Fringing Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E10.Sed.1.20150628 sample type Reef Sediment sampling_expedition E10_Lord_Howe_2015 scientific_name coral metagenome sequence_center_id Pollock8 shelf_location inshore site name Lord Howe Island target gene 16S target subfragment V4 temperature 21 visibility 20 visibility_method Diver Estimate ERS2655112 SAMEA4835242 496922 coral metagenome .Heliopora Tissue from Heliopora coerulea sampled from Lizard Island, Australia as sample E1.Outgroup.Heliopora.coerulea.1.20140811.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:48Z External Id SAMEA4835242 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:48Z INSDC status public Submitter Id E1.Out.Hel.coer.1.20140811.T algal_contact_types turf__cyanobacteria barcodesequence CGTATGATGT binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Heliopora Tissue cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Trawler_20140811 collection time 12:45 collection_timestamp 8/11/14 12:45 colony_height_m 40 colony_maximum_diameter_universal 100 colony_maximum_gcmp_recorded 100 colony_name E1.Out.Hel.coer.1.20140811 colony_width1 100 colony_width2 60 compartment_replicates 1 complex_robust outgroup concatenated_date 20140811 country Australia cyanobacteria_contact y cyanobacteria_percent 2 daily_replicate 1 date 8/11/14 depth 1.2192 depth_method measured disease_percent 0 dna_extracted y env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Heliopora Tissue environmental sample Yes expedition_number E1 family Helioporidae field_host_genus_id Heliopora field_host_name Heliopora coerulea field_host_species_id coerulea full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Helioporaceae_Helioporidae_Heliopora_coerulea geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68344 geographic location (longitude) 145.46554 hemisphere Southern host species coerulea host_clade_sensu_fukami Outgroup_Cnidaria_Anthozoa_Helioporaceae host_clade_sensu_fukami_numeric Outgroup_Cnidaria_Anthozoa_Helioporaceae host_genus Heliopora host_genus_id Heliopora host_name Heliopora coerulea host_species_id coerulea invertebrate_contact_types ophiuroid__lobophytum__urchin latitude -14.68344 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Heliopora coerulea_20140811 local_sample_id Blu Tis 140811 longitude 145.46554 n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name Blue corals ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup y parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter_universal 1 prop_colony_maximum_gcmp_recorded 1 reef_name Trawler reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.Out.Hel.coer.1.20140811.T sample type Heliopora Tissue sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock80 shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector substrate rock symbio_its2_sequenced y target gene 16S target subfragment V4 taxon id 86515 taxonomy_string_to_clade Cnidaria_Anthozoa_Helioporaceae_Helioporidae taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Helioporaceae_Helioporidae taxonomy_string_to_order Cnidaria_Anthozoa_Helioporaceae taxonomy_string_to_subclass Cnidaria_Anthozoa_Octocorallia temperature 23.9 tissue compartment T tissue_loss_percent 0 turf_contact_percent 10 visibility 15 visibility_method Horizontal Secchi Disk ERS2655113 SAMEA4835243 496922 coral metagenome .Heliopora Skeleton from Heliopora coerulea sampled from Lizard Island, Australia as sample E1.Outgroup.Heliopora.coerulea.1.20140811.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:48Z External Id SAMEA4835243 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:48Z INSDC status public Submitter Id E1.Out.Hel.coer.1.20140811.S algal_contact_types turf__cyanobacteria barcodesequence CTAGATCTGA binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Heliopora Skeleton cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Trawler_20140811 collection time 12:45 collection_timestamp 8/11/14 12:45 colony_height_m 40 colony_maximum_diameter_universal 100 colony_maximum_gcmp_recorded 100 colony_name E1.Out.Hel.coer.1.20140811 colony_width1 100 colony_width2 60 compartment_replicates 1 complex_robust outgroup concatenated_date 20140811 country Australia cyanobacteria_contact y cyanobacteria_percent 2 daily_replicate 1 date 8/11/14 depth 1.2192 depth_method measured disease_percent 0 dna_extracted y env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Heliopora Skeleton environmental sample Yes expedition_number E1 family Helioporidae field_host_genus_id Heliopora field_host_name Heliopora coerulea field_host_species_id coerulea full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Helioporaceae_Helioporidae_Heliopora_coerulea geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68344 geographic location (longitude) 145.46554 hemisphere Southern host species coerulea host_clade_sensu_fukami Outgroup_Cnidaria_Anthozoa_Helioporaceae host_clade_sensu_fukami_numeric Outgroup_Cnidaria_Anthozoa_Helioporaceae host_genus Heliopora host_genus_id Heliopora host_name Heliopora coerulea host_species_id coerulea invertebrate_contact_types ophiuroid__lobophytum__urchin latitude -14.68344 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Heliopora coerulea_20140811 local_sample_id Blu Ske 140811 longitude 145.46554 n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name Blue corals ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup y parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter_universal 1 prop_colony_maximum_gcmp_recorded 1 reef_name Trawler reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.Out.Hel.coer.1.20140811.S sample type Heliopora Skeleton sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock81 shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector substrate rock symbio_its2_sequenced y target gene 16S target subfragment V4 taxon id 86515 taxonomy_string_to_clade Cnidaria_Anthozoa_Helioporaceae_Helioporidae taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Helioporaceae_Helioporidae taxonomy_string_to_order Cnidaria_Anthozoa_Helioporaceae taxonomy_string_to_subclass Cnidaria_Anthozoa_Octocorallia temperature 23.9 tissue compartment S tissue_loss_percent 0 turf_contact_percent 10 visibility 15 visibility_method Horizontal Secchi Disk ERS2655114 SAMEA4835244 496922 coral metagenome Coral Mucus from Pachyseris speciosa sampled from Lizard Island, Australia as sample E1.4.Pac.spec.1.20140811.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:48Z External Id SAMEA4835244 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:48Z INSDC status public Submitter Id E1.4.Pac.spec.1.20140811.M abundance gbr common abundance world common algal_contact_types turf__cyanobacteria barcodesequence GTGATACTGA binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Mucus cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Trawler_20140811 collection time 12:45 collection_timestamp 8/11/14 12:45 coloniality colonial colony maximum diameter 2 colony maximum diameter unit cm colony_height_m 15 colony_maximum_diameter 2 colony_maximum_diameter_universal 37 colony_maximum_gcmp_recorded 37 colony_name E1.4.Pac.spec.1.20140811 colony_width1 30 colony_width2 20 compartment_replicates 1 complex_robust complex concatenated_date 20140811 corallite width maximum 4.6 corallite width maximum unit mm corallite width minimum 2.4 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 10 daily_replicate 1 date 8/11/14 depth 3.9624 depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -140.3257694 env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E1 family Agariciidae field_host_genus_id Pachyseris field_host_name Pachyseris speciosa field_host_species_id speciosa full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_IV_Pachyseris_speciosa functional_group_sensu_darling Generalist genus fossil age 33.9 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68344 geographic location (longitude) 145.46554 growth form typical laminar hemisphere Southern host species speciosa host_clade_sensu_fukami IV host_clade_sensu_fukami_numeric 4 host_genus Pachyseris host_genus_id Pachyseris host_name Pachyseris speciosa host_species_id speciosa huang_roy_tree_name AGA_Pachyseris iucn red list category LC latitude -14.68344 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Pachyseris speciosa_20140811 local_sample_id Pach Muc 140811 longitude 145.46554 mode of larval development spawner n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 36.65327262 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 314 oocyte size at maturity unit um outgroup n oz_disease_mean 0 oz_disease_sd 0 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter 15 prop_colony_maximum_diameter_universal 0.810810811 prop_colony_maximum_gcmp_recorded 0.810810811 propagule size on release mean 368 propagule size on release mean unit um range size 84601943.66 range size unit km^2 reef_name Trawler reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.4.Pac.spec.1.20140811.M sample type Coral Mucus sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock82 sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -34.47524539 species age phylogeny 1.559988321 species age phylogeny unit mya substrate rock substrate attachment attached symbio_its2_sequenced y symbiodinium sp. in propagules no target gene 16S target subfragment V4 taxon id 497657 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_IV taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Agariciidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.9 tissue compartment M tissue_loss_percent 0 turf_contact_percent 20 visibility 15 visibility_method Horizontal Secchi Disk water clarity preference clear wave exposure preference broad western-most range edge 25.1595079 zooxanthellate zooxanthellate ERS2655115 SAMEA4835245 496922 coral metagenome Coral Mucus from Pavona venosa sampled from Lizard Island, Australia as sample E1.7.Pav.veno.1.20140811.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:48Z External Id SAMEA4835245 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:48Z INSDC status public Submitter Id E1.7.Pav.veno.1.20140811.M abundance gbr uncommon abundance world common algal_contact_types turf__cyanobacteria__brown barcodesequence CGTCTATGAT binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact y binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Mucus cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Trawler_20140811 collection time 12:45 collection_timestamp 8/11/14 12:45 coloniality colonial colony_height_m 15 colony_maximum_diameter_universal 20 colony_maximum_gcmp_recorded 20 colony_name E1.7.Pav.veno.1.20140811 colony_width1 20 colony_width2 15 compartment_replicates 1 complex_robust complex concatenated_date 20140811 corallite width maximum 9.3 corallite width maximum unit mm corallite width minimum 5.2 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 2 daily_replicate 1 date 8/11/14 depth 1.2192 depth lower 20 depth lower unit m depth upper 2 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -177.2203856 env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E1 family Agariciidae field_host_genus_id Pavona field_host_name Pavona venosa field_host_species_id venosa full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_VII_Pavona_venosa genus fossil age 55.8 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68344 geographic location (longitude) 145.46554 growth form typical encrusting hemisphere Southern host species venosa host_clade_sensu_fukami VII host_clade_sensu_fukami_numeric 7 host_genus Pavona host_genus_id Pavona host_name Pavona venosa host_species_id venosa huang_roy_tree_name AGA_Pavona iucn red list category VU latitude -14.68344 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Pavona venosa_20140811 local_sample_id Pav Muc 140811 longitude 145.46554 macroalgal_contact_types brown_algae n_algal_contacts 3 n_macroalgal_contacts 1 ncbi_inherited_blast_name stony corals northern-most range edge 31.7239697 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.090909091 oz_disease_sd 0.090909091 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter_universal 1 prop_colony_maximum_gcmp_recorded 1 range size 71308679.46 range size unit km^2 reef_name Trawler reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.7.Pav.veno.1.20140811.M sample type Coral Mucus sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock83 shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -32.18062786 species age phylogeny 0.759083367 species age phylogeny unit mya substrate rock substrate attachment attached symbio_its2_sequenced y target gene 16S target subfragment V4 taxon id 46725 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_VII taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Agariciidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.9 tissue compartment M tissue_loss_percent 0 turf_contact_percent 15 visibility 15 visibility_method Horizontal Secchi Disk water clarity preference clear wave exposure preference broad western-most range edge 33.2657341 zooxanthellate zooxanthellate ERS2655116 SAMEA4835246 496922 coral metagenome Coral Tissue from Pavona venosa sampled from Lizard Island, Australia as sample E1.7.Pav.veno.1.20140811.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:48Z External Id SAMEA4835246 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:48Z INSDC status public Submitter Id E1.7.Pav.veno.1.20140811.T abundance gbr uncommon abundance world common algal_contact_types turf__cyanobacteria__brown barcodesequence TGATCAGTCA binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact y binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Tissue cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Trawler_20140811 collection time 12:45 collection_timestamp 8/11/14 12:45 coloniality colonial colony_height_m 15 colony_maximum_diameter_universal 20 colony_maximum_gcmp_recorded 20 colony_name E1.7.Pav.veno.1.20140811 colony_width1 20 colony_width2 15 compartment_replicates 1 complex_robust complex concatenated_date 20140811 corallite width maximum 9.3 corallite width maximum unit mm corallite width minimum 5.2 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 2 daily_replicate 1 date 8/11/14 depth 1.2192 depth lower 20 depth lower unit m depth upper 2 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -177.2203856 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E1 family Agariciidae field_host_genus_id Pavona field_host_name Pavona venosa field_host_species_id venosa full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_VII_Pavona_venosa genus fossil age 55.8 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68344 geographic location (longitude) 145.46554 growth form typical encrusting hemisphere Southern host species venosa host_clade_sensu_fukami VII host_clade_sensu_fukami_numeric 7 host_genus Pavona host_genus_id Pavona host_name Pavona venosa host_species_id venosa huang_roy_tree_name AGA_Pavona iucn red list category VU latitude -14.68344 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Pavona venosa_20140811 local_sample_id Pav Tis 140811 longitude 145.46554 macroalgal_contact_types brown_algae n_algal_contacts 3 n_macroalgal_contacts 1 ncbi_inherited_blast_name stony corals northern-most range edge 31.7239697 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.090909091 oz_disease_sd 0.090909091 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter_universal 1 prop_colony_maximum_gcmp_recorded 1 range size 71308679.46 range size unit km^2 reef_name Trawler reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.7.Pav.veno.1.20140811.T sample type Coral Tissue sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock84 shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -32.18062786 species age phylogeny 0.759083367 species age phylogeny unit mya substrate rock substrate attachment attached symbio_its2_sequenced y target gene 16S target subfragment V4 taxon id 46725 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_VII taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Agariciidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.9 tissue compartment T tissue_loss_percent 0 turf_contact_percent 15 visibility 15 visibility_method Horizontal Secchi Disk water clarity preference clear wave exposure preference broad western-most range edge 33.2657341 zooxanthellate zooxanthellate ERS2655117 SAMEA4835247 496922 coral metagenome Coral Skeleton from Pavona venosa sampled from Lizard Island, Australia as sample E1.7.Pav.veno.1.20140811.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:48Z External Id SAMEA4835247 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:48Z INSDC status public Submitter Id E1.7.Pav.veno.1.20140811.S abundance gbr uncommon abundance world common algal_contact_types turf__cyanobacteria__brown barcodesequence CATGCATCAT binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact y binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Skeleton cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Trawler_20140811 collection time 12:45 collection_timestamp 8/11/14 12:45 coloniality colonial colony_height_m 15 colony_maximum_diameter_universal 20 colony_maximum_gcmp_recorded 20 colony_name E1.7.Pav.veno.1.20140811 colony_width1 20 colony_width2 15 compartment_replicates 1 complex_robust complex concatenated_date 20140811 corallite width maximum 9.3 corallite width maximum unit mm corallite width minimum 5.2 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 2 daily_replicate 1 date 8/11/14 depth 1.2192 depth lower 20 depth lower unit m depth upper 2 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -177.2203856 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E1 family Agariciidae field_host_genus_id Pavona field_host_name Pavona venosa field_host_species_id venosa full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_VII_Pavona_venosa genus fossil age 55.8 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68344 geographic location (longitude) 145.46554 growth form typical encrusting hemisphere Southern host species venosa host_clade_sensu_fukami VII host_clade_sensu_fukami_numeric 7 host_genus Pavona host_genus_id Pavona host_name Pavona venosa host_species_id venosa huang_roy_tree_name AGA_Pavona iucn red list category VU latitude -14.68344 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Pavona venosa_20140811 local_sample_id Pav Ske 140811 longitude 145.46554 macroalgal_contact_types brown_algae n_algal_contacts 3 n_macroalgal_contacts 1 ncbi_inherited_blast_name stony corals northern-most range edge 31.7239697 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.090909091 oz_disease_sd 0.090909091 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter_universal 1 prop_colony_maximum_gcmp_recorded 1 range size 71308679.46 range size unit km^2 reef_name Trawler reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.7.Pav.veno.1.20140811.S sample type Coral Skeleton sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock85 shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -32.18062786 species age phylogeny 0.759083367 species age phylogeny unit mya substrate rock substrate attachment attached symbio_its2_sequenced y target gene 16S target subfragment V4 taxon id 46725 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_VII taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Agariciidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.9 tissue compartment S tissue_loss_percent 0 turf_contact_percent 15 visibility 15 visibility_method Horizontal Secchi Disk water clarity preference clear wave exposure preference broad western-most range edge 33.2657341 zooxanthellate zooxanthellate ERS2655118 SAMEA4835248 496922 coral metagenome Coral Skeleton from Physogyra lichtensteini sampled from Lizard Island, Australia as sample E1.14.Phy.lich.1.20140811.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:48Z External Id SAMEA4835248 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:48Z INSDC status public Submitter Id E1.14.Phy.lich.1.20140811.S abundance gbr common abundance world common algal_contact_types turf__cyanobacteria barcodesequence TAGAGTCTGT binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Skeleton cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Trawler_20140811 collection time 12:45 collection_timestamp 8/11/14 12:45 coloniality colonial colony maximum diameter 100 colony maximum diameter unit cm colony_height_m 22 colony_maximum_diameter 100 colony_maximum_diameter_universal 100 colony_maximum_gcmp_recorded 80 colony_name E1.14.Phy.lich.1.20140811 colony_width1 18 colony_width2 4 compartment_replicates 1 complex_robust robust concatenated_date 20140811 corallite width maximum 20 corallite width maximum unit mm corallite width minimum 6 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 5 daily_replicate 1 date 8/11/14 depth 4.572 depth lower 20 depth lower unit m depth upper 1 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -173.2615884 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E1 family incertae sedis field_host_genus_id Physogyra field_host_name Physogyra lichtensteini field_host_species_id lichtensteini full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XIV_Physogyra_lichtensteini functional_group_sensu_darling Stress-tolerant genus fossil age 0.01 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68344 geographic location (longitude) 145.46554 growth form typical massive hemisphere Southern host species lichtensteini host_clade_sensu_fukami XIV host_clade_sensu_fukami_numeric 14 host_genus Physogyra host_genus_id Physogyra host_name Physogyra lichtensteini host_species_id lichtensteini huang_roy_tree_name EUP_Physogyra_lichtensteini iucn red list category VU latitude -14.68344 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Physogyra lichtensteini_20140811 local_sample_id Phy Ske 140811 longitude 145.46554 n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 33.94501258 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0 oz_disease_sd 0 parrotfish_bites n pcr primers 515F/806R physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter 0.18 prop_colony_maximum_diameter_universal 0.18 prop_colony_maximum_gcmp_recorded 0.225 range size 78301486.65 range size unit km^2 reef_name Trawler reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.14.Phy.lich.1.20140811.S sample type Coral Skeleton sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock86 shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -35.38256235 species age phylogeny 1.648875415 species age phylogeny unit mya substrate rock substrate attachment attached symbio_its2_sequenced y target gene 16S target subfragment V4 taxon id 419442 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XIV taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_incertae sedis taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.9 tissue compartment S tissue_loss_percent 0 turf_contact_percent 15 visibility 15 visibility_method Horizontal Secchi Disk water clarity preference turbid wave exposure preference protected western-most range edge 30.6437165 zooxanthellate zooxanthellate ERS2655119 SAMEA4835249 496922 coral metagenome Coral Mucus from Galaxea astreata sampled from Lizard Island, Australia as sample E1.5.Gal.astr.1.20140814.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:48Z External Id SAMEA4835249 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:48Z INSDC status public Submitter Id E1.5.Gal.astr.1.20140814.M abundance gbr common abundance world common algal_contact_types turf__cyanobacteria barcodesequence TATCGATGCT binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Mucus cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Horseshoe_20140814 collection time 11:00 collection_timestamp 8/14/14 11:00 coloniality colonial colony maximum diameter 200 colony maximum diameter unit cm colony_height_m 3 colony_maximum_diameter 200 colony_maximum_diameter_universal 200 colony_maximum_gcmp_recorded 35 colony_name E1.5.Gal.astr.1.20140814 colony_width1 10 colony_width2 7 compartment_replicates 1 complex_robust complex concatenated_date 20140814 corallite width maximum 3.7 corallite width maximum unit mm corallite width minimum 3.4 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 5 daily_replicate 1 date 8/14/14 depth 7.0104 depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -168.0535591 env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E1 family Euphylliidae field_host_genus_id Galaxea field_host_name Galaxea astreata field_host_species_id astreata full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Horseshoe full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_V_Galaxea_astreata functional_group_sensu_darling Stress-tolerant genus fossil age 23.03 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68716 geographic location (longitude) 145.44449 growth form typical submassive hemisphere Southern host species astreata host_clade_sensu_fukami V host_clade_sensu_fukami_numeric 5 host_genus Galaxea host_genus_id Galaxea host_name Galaxea astreata host_species_id astreata huang_roy_tree_name OCU_Galaxea_astreata iucn red list category VU latitude -14.68716 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Galaxea astreata_20140814 local_sample_id Gal Muc 140814 longitude 145.44449 mode of larval development spawner n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 37.11571178 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.258673969 oz_disease_sd 0.173267011 par_method buoy parrotfish_bites n pcr primers 515F/806R photosynthetically_active_radiation 414.005 physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter 0.05 prop_colony_maximum_diameter_universal 0.05 prop_colony_maximum_gcmp_recorded 0.285714286 range size 72703639.29 range size unit km^2 reef_name Horseshoe reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.5.Gal.astr.1.20140814.M sample type Coral Mucus sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock87 sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -32.22433312 species age phylogeny 0.518269449 species age phylogeny unit mya substrate pavement substrate attachment attached symbio_its2_sequenced y target gene 16S target subfragment V4 taxon id 154325 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_V taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Euphylliidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 22.8 tissue compartment M tissue_loss_percent 0 turf_contact_percent 15 visibility 13 visibility_method Horizontal Secchi Disk water clarity preference turbid wave exposure preference protected western-most range edge 31.7398894 zooxanthellate zooxanthellate ERS2655120 SAMEA4835250 496922 coral metagenome Coral Tissue from Galaxea astreata sampled from Lizard Island, Australia as sample E1.5.Gal.astr.1.20140814.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:48Z External Id SAMEA4835250 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:48Z INSDC status public Submitter Id E1.5.Gal.astr.1.20140814.T abundance gbr common abundance world common algal_contact_types turf__cyanobacteria barcodesequence TGTGTCACTA binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Tissue cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Horseshoe_20140814 collection time 11:00 collection_timestamp 8/14/14 11:00 coloniality colonial colony maximum diameter 200 colony maximum diameter unit cm colony_height_m 3 colony_maximum_diameter 200 colony_maximum_diameter_universal 200 colony_maximum_gcmp_recorded 35 colony_name E1.5.Gal.astr.1.20140814 colony_width1 10 colony_width2 7 compartment_replicates 1 complex_robust complex concatenated_date 20140814 corallite width maximum 3.7 corallite width maximum unit mm corallite width minimum 3.4 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 5 daily_replicate 1 date 8/14/14 depth 7.0104 depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -168.0535591 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E1 family Euphylliidae field_host_genus_id Galaxea field_host_name Galaxea astreata field_host_species_id astreata full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Horseshoe full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_V_Galaxea_astreata functional_group_sensu_darling Stress-tolerant genus fossil age 23.03 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68716 geographic location (longitude) 145.44449 growth form typical submassive hemisphere Southern host species astreata host_clade_sensu_fukami V host_clade_sensu_fukami_numeric 5 host_genus Galaxea host_genus_id Galaxea host_name Galaxea astreata host_species_id astreata huang_roy_tree_name OCU_Galaxea_astreata iucn red list category VU latitude -14.68716 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Galaxea astreata_20140814 local_sample_id Gal Tis 140814 longitude 145.44449 mode of larval development spawner n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 37.11571178 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.258673969 oz_disease_sd 0.173267011 par_method buoy parrotfish_bites n pcr primers 515F/806R photosynthetically_active_radiation 414.005 physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter 0.05 prop_colony_maximum_diameter_universal 0.05 prop_colony_maximum_gcmp_recorded 0.285714286 range size 72703639.29 range size unit km^2 reef_name Horseshoe reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.5.Gal.astr.1.20140814.T sample type Coral Tissue sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock88 sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -32.22433312 species age phylogeny 0.518269449 species age phylogeny unit mya substrate pavement substrate attachment attached symbio_its2_sequenced y target gene 16S target subfragment V4 taxon id 154325 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_V taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Euphylliidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 22.8 tissue compartment T tissue_loss_percent 0 turf_contact_percent 15 visibility 13 visibility_method Horizontal Secchi Disk water clarity preference turbid wave exposure preference protected western-most range edge 31.7398894 zooxanthellate zooxanthellate ERS2655121 SAMEA4835251 496922 coral metagenome Coral Skeleton from Galaxea astreata sampled from Lizard Island, Australia as sample E1.5.Gal.astr.1.20140814.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:48Z External Id SAMEA4835251 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:48Z INSDC status public Submitter Id E1.5.Gal.astr.1.20140814.S abundance gbr common abundance world common algal_contact_types turf__cyanobacteria barcodesequence GTAGTACACA binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Skeleton cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Horseshoe_20140814 collection time 11:00 collection_timestamp 8/14/14 11:00 coloniality colonial colony maximum diameter 200 colony maximum diameter unit cm colony_height_m 3 colony_maximum_diameter 200 colony_maximum_diameter_universal 200 colony_maximum_gcmp_recorded 35 colony_name E1.5.Gal.astr.1.20140814 colony_width1 10 colony_width2 7 compartment_replicates 1 complex_robust complex concatenated_date 20140814 corallite width maximum 3.7 corallite width maximum unit mm corallite width minimum 3.4 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 5 daily_replicate 1 date 8/14/14 depth 7.0104 depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -168.0535591 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E1 family Euphylliidae field_host_genus_id Galaxea field_host_name Galaxea astreata field_host_species_id astreata full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Horseshoe full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_V_Galaxea_astreata functional_group_sensu_darling Stress-tolerant genus fossil age 23.03 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68716 geographic location (longitude) 145.44449 growth form typical submassive hemisphere Southern host species astreata host_clade_sensu_fukami V host_clade_sensu_fukami_numeric 5 host_genus Galaxea host_genus_id Galaxea host_name Galaxea astreata host_species_id astreata huang_roy_tree_name OCU_Galaxea_astreata iucn red list category VU latitude -14.68716 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Galaxea astreata_20140814 local_sample_id Gal Ske 140814 longitude 145.44449 mode of larval development spawner n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 37.11571178 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.258673969 oz_disease_sd 0.173267011 par_method buoy parrotfish_bites n pcr primers 515F/806R photosynthetically_active_radiation 414.005 physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter 0.05 prop_colony_maximum_diameter_universal 0.05 prop_colony_maximum_gcmp_recorded 0.285714286 range size 72703639.29 range size unit km^2 reef_name Horseshoe reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.5.Gal.astr.1.20140814.S sample type Coral Skeleton sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock89 sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -32.22433312 species age phylogeny 0.518269449 species age phylogeny unit mya substrate pavement substrate attachment attached symbio_its2_sequenced y target gene 16S target subfragment V4 taxon id 154325 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_V taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Euphylliidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 22.8 tissue compartment S tissue_loss_percent 0 turf_contact_percent 15 visibility 13 visibility_method Horizontal Secchi Disk water clarity preference turbid wave exposure preference protected western-most range edge 31.7398894 zooxanthellate zooxanthellate ERS2655122 SAMEA4835252 496922 coral metagenome Coral Skeleton from Cyphastrea serailia sampled from North Bay, Lord Howe Island, New South Wales, Australia as sample E10.Cyp.sera.2.20150628.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:48Z External Id SAMEA4835252 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:48Z INSDC status public Submitter Id E10.Cyp.sera.2.20150628.S abundance gbr common abundance world common barcodesequence GTGCTGTCGT binary_algal_contact n binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact n biological_sample_notes LH_283 biologicalmatter Coral Skeleton cca_contact_percent 0 cca_overgrown n collected by Joe Pollock collection date 2015 collection id North Bay_20150628 collection time 8:00 collection_timestamp 6/28/15 8:00 coloniality colonial colony_height_m 20 colony_name E10.17.Cyp.sera.2.20150628 colony_width1 20 colony_width2 30 compartment_replicates 1 complex_robust robust concatenated_date 20150628 coral_color D4 corallite width maximum 2.4 corallite width maximum unit mm corallite width minimum 1.4 corallite width minimum unit mm country Australia cyanobacteria_contact n cyanobacteria_overgrown n cyanobacteria_percent 0 daily_replicate 2 date 6/28/15 depth 1.3 depth lower 50 depth lower unit m depth upper 0 depth upper unit m depth_method measured disease_percent 0 dna_extracted n dominant_cover_2m sand eastern-most range edge -125.6796192 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E10 family Merulinidae field_host_genus_id Cyphastrea field_host_name Cyphastrea serailia field_host_species_id serailia full_location Indo-Pacific;Pacific;Tasman Sea;Australia;SE;Lord Howe Island;North Bay full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XVII_Cyphastrea_serailia functional_group_sensu_darling Stress-tolerant genus fossil age 33.9 genus fossil age unit mya geographic area SE geographic location (country and/or sea) Australia geographic location (latitude) -31.52135 geographic location (longitude) 159.0467333 growth form typical massive hemisphere Southern host species serailia host_clade_sensu_fukami XVII host_clade_sensu_fukami_numeric 17 host_genus Cyphastrea host_genus_id Cyphastrea host_name Cyphastrea serailia host_species_id serailia huang_roy_tree_name FAV_Cyphastrea_serailia iucn red list category LC latitude -31.52135 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name E10.Cyp.sera.2 local_sample_id LH_283_S longitude 159.0467333 mode of larval development spawner n_algal_contacts 0 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 38.89698222 ocean Pacific ocean_area Tasman Sea ocean_superregion Indo-Pacific oocyte size at maturity 327 oocyte size at maturity unit um outgroup n oz_disease_mean 0.083333333 oz_disease_sd 0.083333333 parrotfish_bites n pcr primers 515F/806R physical samp avail now y physical_sample_location Medina Lab, Penn State, USA can be reextracted political_area Australia propagule size on release max 300 propagule size on release max unit um range size 97334326.28 range size unit km^2 reef_name North Bay reef_type Fringing Reef reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E10.Cyp.sera.2.20150628.S sample type Coral Skeleton sampling_expedition E10_Lord_Howe_2015 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock9 sexual system hermaphrodite shelf_location inshore site name Lord Howe Island southern-most range edge -35.59786538 species age phylogeny 2.223347908 species age phylogeny unit mya substrate sand substrate attachment attached symbio_its2_sequenced n target gene 16S target subfragment V4 taxon id 242754 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XVII taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Merulinidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 21 tissue compartment S tissue_loss_percent 0 turf_contact_percent 0 turf_overgrown n visibility 20 visibility_method Diver Estimate water clarity preference clear wave exposure preference broad western-most range edge 28.0600802 zooxanthellate zooxanthellate ERS2655123 SAMEA4835253 496922 coral metagenome Coral Tissue from Millepora sp sampled from Lizard Island, Australia as sample E1.Outgroup.Millepora.sp2.20140814.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:48Z External Id SAMEA4835253 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:48Z INSDC status public Submitter Id E1.Out.Mil.sp.1.20140814.T algal_contact_types turf__cyanobacteria barcodesequence CTACTGATGA binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Tissue cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Horseshoe_20140814 collection time 11:00 collection_timestamp 8/14/14 11:00 colony_height_m 7 colony_maximum_diameter_universal 93 colony_maximum_gcmp_recorded 93 colony_name E1.Out.Mil.sp.1.20140814 colony_width1 6 colony_width2 3 compartment_replicates 1 complex_robust outgroup concatenated_date 20140814 country Australia cyanobacteria_contact y cyanobacteria_percent 1 daily_replicate 1 date 8/14/14 depth 7.0104 depth_method measured disease_percent 0 dna_extracted y env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E1 family Milleporidae field_host_genus_id Millepora field_host_name Millepora sp field_host_species_id sp full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Horseshoe full_taxonomy_string_with_clade Cnidaria_Hydrozoa_Anthoathecata_Milleporidae_Millepora_sp geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68716 geographic location (longitude) 145.44449 hemisphere Southern host species sp host_clade_sensu_fukami Outgroup_Cnidaria_Hydrozoa_Anthoathecata_Milleporidae host_clade_sensu_fukami_numeric Outgroup_Cnidaria_Hydrozoa_Anthoathecata_Milleporidae host_genus Millepora host_genus_id Millepora host_name Millepora sp host_species_id sp latitude -14.68716 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Millepora sp._20140814 local_sample_id Hydr Tis 140814 longitude 145.44449 n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name hydrozoans ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup y par_method buoy parrotfish_bites n pcr primers 515F/806R photosynthetically_active_radiation 414.005 physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter_universal 0.064516129 prop_colony_maximum_gcmp_recorded 0.064516129 reef_name Horseshoe reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.Out.Mil.sp.1.20140814.T sample type Coral Tissue sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock90 shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector substrate rock symbio_its2_sequenced y target gene 16S target subfragment V4 taxon id 51117 taxonomy_string_to_clade Cnidaria_Hydrozoa_Anthoathecata_Milleporidae taxonomy_string_to_class Cnidaria_Hydrozoa taxonomy_string_to_family Cnidaria_Hydrozoa_Anthoathecata_Milleporidae taxonomy_string_to_order Cnidaria_Hydrozoa_Anthoathecata taxonomy_string_to_subclass Cnidaria_Hydrozoa_Leptolinae temperature 22.8 tissue compartment T tissue_loss_percent 0 turf_contact_percent 2 visibility 13 visibility_method Horizontal Secchi Disk ERS2655124 SAMEA4835254 496922 coral metagenome Coral Skeleton from Millepora sp sampled from Lizard Island, Australia as sample E1.Outgroup.Millepora.sp2.20140814.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:48Z External Id SAMEA4835254 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:48Z INSDC status public Submitter Id E1.Out.Mil.sp.1.20140814.S algal_contact_types turf__cyanobacteria barcodesequence TCAGCGATAT binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Skeleton cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Horseshoe_20140814 collection time 11:00 collection_timestamp 8/14/14 11:00 colony_height_m 7 colony_maximum_diameter_universal 93 colony_maximum_gcmp_recorded 93 colony_name E1.Out.Mil.sp.1.20140814 colony_width1 6 colony_width2 3 compartment_replicates 1 complex_robust outgroup concatenated_date 20140814 country Australia cyanobacteria_contact y cyanobacteria_percent 1 daily_replicate 1 date 8/14/14 depth 7.0104 depth_method measured disease_percent 0 dna_extracted y env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E1 family Milleporidae field_host_genus_id Millepora field_host_name Millepora sp field_host_species_id sp full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Horseshoe full_taxonomy_string_with_clade Cnidaria_Hydrozoa_Anthoathecata_Milleporidae_Millepora_sp geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68716 geographic location (longitude) 145.44449 hemisphere Southern host species sp host_clade_sensu_fukami Outgroup_Cnidaria_Hydrozoa_Anthoathecata_Milleporidae host_clade_sensu_fukami_numeric Outgroup_Cnidaria_Hydrozoa_Anthoathecata_Milleporidae host_genus Millepora host_genus_id Millepora host_name Millepora sp host_species_id sp latitude -14.68716 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Millepora sp._20140814 local_sample_id Hydr Ske 140814 longitude 145.44449 n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name hydrozoans ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup y par_method buoy parrotfish_bites n pcr primers 515F/806R photosynthetically_active_radiation 414.005 physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter_universal 0.064516129 prop_colony_maximum_gcmp_recorded 0.064516129 reef_name Horseshoe reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.Out.Mil.sp.1.20140814.S sample type Coral Skeleton sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock91 shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector substrate rock symbio_its2_sequenced y target gene 16S target subfragment V4 taxon id 51117 taxonomy_string_to_clade Cnidaria_Hydrozoa_Anthoathecata_Milleporidae taxonomy_string_to_class Cnidaria_Hydrozoa taxonomy_string_to_family Cnidaria_Hydrozoa_Anthoathecata_Milleporidae taxonomy_string_to_order Cnidaria_Hydrozoa_Anthoathecata taxonomy_string_to_subclass Cnidaria_Hydrozoa_Leptolinae temperature 22.8 tissue compartment S tissue_loss_percent 0 turf_contact_percent 2 visibility 13 visibility_method Horizontal Secchi Disk ERS2655125 SAMEA4835255 496922 coral metagenome Coral Mucus from Pachyseris rugosa sampled from Lizard Island, Australia as sample E1.4.Pac.rugo.1.20140814.M of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:49Z External Id SAMEA4835255 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:49Z INSDC status public Submitter Id E1.4.Pac.rugo.1.20140814.M abundance gbr common abundance world common algal_contact_types turf__cyanobacteria barcodesequence TGATACTCTG binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Mucus cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Horseshoe_20140814 collection time 11:00 collection_timestamp 8/14/14 11:00 coloniality colonial colony maximum diameter 100 colony maximum diameter unit cm colony_height_m 300 colony_maximum_diameter 100 colony_maximum_diameter_universal 400 colony_maximum_gcmp_recorded 400 colony_name E1.4.Pac.rugo.1.20140814 colony_width1 400 colony_width2 300 compartment_replicates 1 complex_robust complex concatenated_date 20140814 corallite width maximum 4.8 corallite width maximum unit mm corallite width minimum 2.2 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 5 daily_replicate 1 date 8/14/14 depth 7.0104 depth lower 20 depth lower unit m depth upper 5 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -176.1319621 env matter mucus environment (biome) coral reef environment (feature) coral environment (material) Coral Mucus environmental sample Yes expedition_number E1 family Agariciidae field_host_genus_id Pachyseris field_host_name Pachyseris rugosa field_host_species_id rugosa full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Horseshoe full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_IV_Pachyseris_rugosa functional_group_sensu_darling Generalist genus fossil age 33.9 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68716 geographic location (longitude) 145.44449 growth form typical laminar hemisphere Southern host species rugosa host_clade_sensu_fukami IV host_clade_sensu_fukami_numeric 4 host_genus Pachyseris host_genus_id Pachyseris host_name Pachyseris rugosa host_species_id rugosa huang_roy_tree_name AGA_Pachyseris invertebrate_contact_types ophiuroid iucn red list category VU latitude -14.68716 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Pachyseris rugosa_20140814 local_sample_id Pach Muc 140814 longitude 145.44449 mode of larval development spawner n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 31.00815214 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 339 oocyte size at maturity unit um outgroup n oz_disease_mean 0 oz_disease_sd 0 par_method buoy parrotfish_bites n pcr primers 515F/806R photosynthetically_active_radiation 414.005 physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter 4 prop_colony_maximum_diameter_universal 1 prop_colony_maximum_gcmp_recorded 1 range size 60586224.82 range size unit km^2 reef_name Horseshoe reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.4.Pac.rugo.1.20140814.M sample type Coral Mucus sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock92 sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -27.86238998 species age phylogeny 1.524518009 species age phylogeny unit mya substrate rock substrate attachment attached symbio_its2_sequenced y target gene 16S target subfragment V4 taxon id 1518537 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_IV taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Agariciidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 22.8 tissue compartment M tissue_loss_percent 0 turf_contact_percent 10 visibility 13 visibility_method Horizontal Secchi Disk water clarity preference turbid wave exposure preference broad western-most range edge 31.7723633 zooxanthellate zooxanthellate ERS2655126 SAMEA4835256 496922 coral metagenome Coral Skeleton from Pachyseris rugosa sampled from Lizard Island, Australia as sample E1.4.Pac.rugo.1.20140814.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:49Z External Id SAMEA4835256 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:49Z INSDC status public Submitter Id E1.4.Pac.rugo.1.20140814.S abundance gbr common abundance world common algal_contact_types turf__cyanobacteria barcodesequence CTATACAGTG binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Skeleton cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Horseshoe_20140814 collection time 11:00 collection_timestamp 8/14/14 11:00 coloniality colonial colony maximum diameter 100 colony maximum diameter unit cm colony_height_m 300 colony_maximum_diameter 100 colony_maximum_diameter_universal 400 colony_maximum_gcmp_recorded 400 colony_name E1.4.Pac.rugo.1.20140814 colony_width1 400 colony_width2 300 compartment_replicates 1 complex_robust complex concatenated_date 20140814 corallite width maximum 4.8 corallite width maximum unit mm corallite width minimum 2.2 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 5 daily_replicate 1 date 8/14/14 depth 7.0104 depth lower 20 depth lower unit m depth upper 5 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -176.1319621 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E1 family Agariciidae field_host_genus_id Pachyseris field_host_name Pachyseris rugosa field_host_species_id rugosa full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Horseshoe full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_IV_Pachyseris_rugosa functional_group_sensu_darling Generalist genus fossil age 33.9 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68716 geographic location (longitude) 145.44449 growth form typical laminar hemisphere Southern host species rugosa host_clade_sensu_fukami IV host_clade_sensu_fukami_numeric 4 host_genus Pachyseris host_genus_id Pachyseris host_name Pachyseris rugosa host_species_id rugosa huang_roy_tree_name AGA_Pachyseris invertebrate_contact_types ophiuroid iucn red list category VU latitude -14.68716 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Pachyseris rugosa_20140814 local_sample_id Pach Ske 140814 longitude 145.44449 mode of larval development spawner n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 31.00815214 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 339 oocyte size at maturity unit um outgroup n oz_disease_mean 0 oz_disease_sd 0 par_method buoy parrotfish_bites n pcr primers 515F/806R photosynthetically_active_radiation 414.005 physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter 4 prop_colony_maximum_diameter_universal 1 prop_colony_maximum_gcmp_recorded 1 range size 60586224.82 range size unit km^2 reef_name Horseshoe reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.4.Pac.rugo.1.20140814.S sample type Coral Skeleton sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock93 sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -27.86238998 species age phylogeny 1.524518009 species age phylogeny unit mya substrate rock substrate attachment attached symbio_its2_sequenced y target gene 16S target subfragment V4 taxon id 1518537 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_IV taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Agariciidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 22.8 tissue compartment S tissue_loss_percent 0 turf_contact_percent 10 visibility 13 visibility_method Horizontal Secchi Disk water clarity preference turbid wave exposure preference broad western-most range edge 31.7723633 zooxanthellate zooxanthellate ERS2655127 SAMEA4835257 496922 coral metagenome Coral Tissue from Symphyllia sp sampled from Lizard Island, Australia as sample E1.19.Sym.sp1.20140814.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:49Z External Id SAMEA4835257 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:49Z INSDC status public Submitter Id E1.19.Sym.sp.1.20140814.T algal_contact_types turf__cyanobacteria barcodesequence TATGTACGTG binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Tissue cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Horseshoe_20140814 collection time 11:00 collection_timestamp 8/14/14 11:00 colony_height_m 30 colony_maximum_diameter_universal 50 colony_maximum_gcmp_recorded 50 colony_name E1.19.Sym.sp.1.20140814 colony_width1 30 colony_width2 20 compartment_replicates 1 complex_robust robust concatenated_date 20140814 country Australia cyanobacteria_contact y cyanobacteria_percent 5 daily_replicate 1 date 8/14/14 depth 7.0104 depth_method measured disease_percent 0 dna_extracted y env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E1 family Lobophylliidae field_host_genus_id Symphyllia field_host_name Symphyllia sp field_host_species_id sp full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Horseshoe full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XIX_Symphyllia_sp geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68716 geographic location (longitude) 145.44449 hemisphere Southern host species sp host_clade_sensu_fukami XIX host_clade_sensu_fukami_numeric 19 host_genus Symphyllia host_genus_id Symphyllia host_name Symphyllia sp host_species_id sp huang_roy_tree_name MUS_Symphyllia invertebrate_contact_types porites__polychaete latitude -14.68716 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Symphyllia sp._20140814 local_sample_id Symp Tis 140814 longitude 145.44449 n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.277777778 oz_disease_sd 0.277777778 par_method buoy parrotfish_bites n pcr primers 515F/806R photosynthetically_active_radiation 414.005 physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter_universal 0.6 prop_colony_maximum_gcmp_recorded 0.6 reef_name Horseshoe reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.19.Sym.sp.1.20140814.T sample type Coral Tissue sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock94 shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector substrate rock symbio_its2_sequenced y target gene 16S target subfragment V4 taxon id 242739 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XIX taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Lobophylliidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 22.8 tissue compartment T tissue_loss_percent 0 turf_contact_percent 15 visibility 13 visibility_method Horizontal Secchi Disk ERS2655128 SAMEA4835258 496922 coral metagenome Coral Skeleton from Symphyllia sp sampled from Lizard Island, Australia as sample E1.19.Sym.sp1.20140814.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:49Z External Id SAMEA4835258 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:49Z INSDC status public Submitter Id E1.19.Sym.sp.1.20140814.S algal_contact_types turf__cyanobacteria barcodesequence TCAGATGCTA binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Skeleton cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Horseshoe_20140814 collection time 11:00 collection_timestamp 8/14/14 11:00 colony_height_m 30 colony_maximum_diameter_universal 50 colony_maximum_gcmp_recorded 50 colony_name E1.19.Sym.sp.1.20140814 colony_width1 30 colony_width2 20 compartment_replicates 1 complex_robust robust concatenated_date 20140814 country Australia cyanobacteria_contact y cyanobacteria_percent 5 daily_replicate 1 date 8/14/14 depth 7.0104 depth_method measured disease_percent 0 dna_extracted y env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E1 family Lobophylliidae field_host_genus_id Symphyllia field_host_name Symphyllia sp field_host_species_id sp full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Horseshoe full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XIX_Symphyllia_sp geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68716 geographic location (longitude) 145.44449 hemisphere Southern host species sp host_clade_sensu_fukami XIX host_clade_sensu_fukami_numeric 19 host_genus Symphyllia host_genus_id Symphyllia host_name Symphyllia sp host_species_id sp huang_roy_tree_name MUS_Symphyllia invertebrate_contact_types porites__polychaete latitude -14.68716 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Symphyllia sp._20140814 local_sample_id Symp Ske 140814 longitude 145.44449 n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.277777778 oz_disease_sd 0.277777778 par_method buoy parrotfish_bites n pcr primers 515F/806R photosynthetically_active_radiation 414.005 physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter_universal 0.6 prop_colony_maximum_gcmp_recorded 0.6 reef_name Horseshoe reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.19.Sym.sp.1.20140814.S sample type Coral Skeleton sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock95 shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector substrate rock symbio_its2_sequenced y target gene 16S target subfragment V4 taxon id 242739 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XIX taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Lobophylliidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 22.8 tissue compartment S tissue_loss_percent 0 turf_contact_percent 15 visibility 13 visibility_method Horizontal Secchi Disk ERS2655129 SAMEA4835259 496922 coral metagenome Coral Skeleton from Turbinaria peltata sampled from Lizard Island, Australia as sample E1.2.Tur.pelt.1.20140814.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:49Z External Id SAMEA4835259 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:49Z INSDC status public Submitter Id E1.2.Tur.pelt.1.20140814.S algal_contact_types turf__cyanobacteria barcodesequence TATCAGTCTG binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Skeleton cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Horseshoe_20140814 collection time 11:00 collection_timestamp 8/14/14 11:00 colony_height_m 25 colony_maximum_diameter_universal 25 colony_maximum_gcmp_recorded 25 colony_name E1.2.Tur.pelt.1.20140814 colony_width1 25 colony_width2 15 compartment_replicates 1 complex_robust complex concatenated_date 20140814 country Australia cyanobacteria_contact y cyanobacteria_percent 5 daily_replicate 1 date 8/14/14 depth 7.0104 depth_method measured disease_percent 0 dna_extracted y env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E1 family Dendrophylliidae field_host_genus_id Turbinaria field_host_name Turbinaria peltata field_host_species_id peltata full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Horseshoe full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_II_Turbinaria_peltata geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68716 geographic location (longitude) 145.44449 hemisphere Southern host species peltata host_clade_sensu_fukami II host_clade_sensu_fukami_numeric 2 host_genus Turbinaria host_genus_id Turbinaria host_name Duncanopsammia peltata host_species_id peltata huang_roy_tree_name DEN_Turbinaria invertebrate_contact_types lobophytum latitude -14.68716 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Turbinaria peltata_20140814 local_sample_id Turb1 Ske 140814 longitude 145.44449 n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.44973545 oz_disease_sd 0.44973545 par_method buoy parrotfish_bites n pcr primers 515F/806R photosynthetically_active_radiation 414.005 physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter_universal 1 prop_colony_maximum_gcmp_recorded 1 reef_name Horseshoe reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.2.Tur.pelt.1.20140814.S sample type Coral Skeleton sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact y sequence_center_id Pollock96 shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector substrate rock symbio_its2_sequenced y target gene 16S target subfragment V4 taxon id 46698 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_II taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Dendrophylliidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 22.8 tissue compartment S tissue_loss_percent 0 turf_contact_percent 10 visibility 13 visibility_method Horizontal Secchi Disk ERS2655130 SAMEA4835260 496922 coral metagenome Coral Skeleton from Turbinaria reniformis sampled from Lizard Island, Australia as sample E1.2.Tur.reni.1.20140814.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:49Z External Id SAMEA4835260 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:49Z INSDC status public Submitter Id E1.2.Tur.reni.1.20140814.S abundance gbr common abundance world uncommon algal_contact_types turf__cyanobacteria barcodesequence GCAGTATGCG binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Skeleton cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Horseshoe_20140814 collection time 11:00 collection_timestamp 8/14/14 11:00 coloniality colonial colony maximum diameter 500 colony maximum diameter unit cm colony_height_m 15 colony_maximum_diameter 500 colony_maximum_diameter_universal 500 colony_maximum_gcmp_recorded 230 colony_name E1.2.Tur.reni.1.20140814 colony_width1 30 colony_width2 20 compartment_replicates 1 complex_robust complex concatenated_date 20140814 corallite width maximum 4.2 corallite width maximum unit mm corallite width minimum 2.8 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 2 daily_replicate 1 date 8/14/14 depth 7.0104 depth lower 15 depth lower unit m depth upper 2 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -136.9957288 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E1 family Dendrophylliidae field_host_genus_id Turbinaria field_host_name Turbinaria reniformis field_host_species_id reniformis full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Horseshoe full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_II_Turbinaria_reniformis genus fossil age 28.4 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68716 geographic location (longitude) 145.44449 growth form typical laminar hemisphere Southern host species reniformis host_clade_sensu_fukami II host_clade_sensu_fukami_numeric 2 host_genus Turbinaria host_genus_id Turbinaria host_name Turbinaria reniformis host_species_id reniformis huang_roy_tree_name DEN_Turbinaria invertebrate_contact_types lobophytum__pocillopora__ophiuroid iucn red list category VU latitude -14.68716 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Turbinaria reniformis_20140814 local_sample_id Turb2 Ske 140814 longitude 145.44449 mode of larval development spawner n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 36.21196191 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific outgroup n oz_disease_mean 0.44973545 oz_disease_sd 0.44973545 par_method buoy parrotfish_bites n pcr primers 515F/806R photosynthetically_active_radiation 414.005 physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter 0.06 prop_colony_maximum_diameter_universal 0.06 prop_colony_maximum_gcmp_recorded 0.130434783 range size 90605636.14 range size unit km^2 reef_name Horseshoe reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.2.Tur.reni.1.20140814.S sample type Coral Skeleton sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock97 sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -37.43026469 species age phylogeny 0.876113954 species age phylogeny unit mya substrate rock substrate attachment attached symbio_its2_sequenced y target gene 16S target subfragment V4 taxon id 1381352 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_II taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Dendrophylliidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 22.8 tissue compartment S tissue_loss_percent 0 turf_contact_percent 5 visibility 13 visibility_method Horizontal Secchi Disk water clarity preference turbid wave exposure preference protected western-most range edge 31.6765571 zooxanthellate zooxanthellate ERS2655131 SAMEA4835261 496922 coral metagenome Coral Skeleton from Diploastrea heliopora sampled from Lizard Island, Australia as sample E1.15.Dip.heli.1.20140815.S of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:49Z External Id SAMEA4835261 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:49Z INSDC status public Submitter Id E1.15.Dip.heli.1.20140815.S abundance gbr common abundance world uncommon algal_contact_types turf__cyanobacteria barcodesequence GCACGCGTAT binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Skeleton cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Trawler_20140815 collection time 11:30 collection_timestamp 8/15/14 11:30 coloniality colonial colony maximum diameter 500 colony maximum diameter unit cm colony_height_m 60 colony_maximum_diameter 500 colony_maximum_diameter_universal 1034 colony_maximum_gcmp_recorded 1034 colony_name E1.15.Dip.heli.1.20140815 colony_width1 100 colony_width2 80 compartment_replicates 1 complex_robust robust concatenated_date 20140815 corallite width maximum 9 corallite width maximum unit mm corallite width minimum 7 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 10 daily_replicate 1 date 8/15/14 depth 1.524 depth lower 30 depth lower unit m depth upper 0 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -167.1916889 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Skeleton environmental sample Yes expedition_number E1 family Diploastreidae field_host_genus_id Diploastrea field_host_name Diploastrea heliopora field_host_species_id heliopora full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XV_Diploastrea_heliopora functional_group_sensu_darling Stress-tolerant genus fossil age 99.6 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68344 geographic location (longitude) 145.46554 growth form typical massive hemisphere Southern host species heliopora host_clade_sensu_fukami XV host_clade_sensu_fukami_numeric 15 host_genus Diploastrea host_genus_id Diploastrea host_name Diploastrea heliopora host_species_id heliopora huang_roy_tree_name FAV_Diploastrea_heliopora invertebrate_contact_types porites__tridacna__stylophora__lobophytum iucn red list category NT latitude -14.68344 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Diploastrea heliopora_20140815 local_sample_id Dip Ske 140815 longitude 145.46554 mode of larval development spawner n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 30.8119151 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 290 oocyte size at maturity unit um outgroup n oz_disease_mean 0 oz_disease_sd 0 par_method buoy parrotfish_bites n pcr primers 515F/806R photosynthetically_active_radiation 331.988 physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter 0.2 prop_colony_maximum_diameter_universal 0.096711799 prop_colony_maximum_gcmp_recorded 0.096711799 range size 70449346.41 range size unit km^2 reef_name Trawler reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.15.Dip.heli.1.20140815.S sample type Coral Skeleton sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock98 sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -30.63689894 species age phylogeny 64.52281751 species age phylogeny unit mya substrate rock substrate attachment attached symbio_its2_sequenced y symbiodinium sp. in propagules no target gene 16S target subfragment V4 taxon id 214969 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XV taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Diploastreidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.9 tissue compartment S tissue_loss_percent 0 turf_contact_percent 20 visibility 19 visibility_method Horizontal Secchi Disk water clarity preference clear wave exposure preference broad western-most range edge 31.7583974 zooxanthellate zooxanthellate ERS2655132 SAMEA4835262 496922 coral metagenome Coral Tissue from Diploastrea heliopora sampled from Lizard Island, Australia as sample E1.15.Dip.heli.1.20140815.T of the Global Coral Microbiome Project ENA-FIRST-PUBLIC 2018-10-03T17:36:42Z ENA-LAST-UPDATE 2018-08-16T22:19:49Z External Id SAMEA4835262 INSDC center name Penn State University INSDC first public 2018-10-03T17:36:42Z INSDC last update 2018-08-16T22:19:49Z INSDC status public Submitter Id E1.15.Dip.heli.1.20140815.T abundance gbr common abundance world uncommon algal_contact_types turf__cyanobacteria barcodesequence TCGATGCGCT binary_algal_contact y binary_cca_contact n binary_disease n binary_macroalgal_contact n binary_tissue_loss n binary_turf_contact y biologicalmatter Coral Tissue cca_contact_percent 0 collected by Ryan McMinds collection date 2014 collection id Trawler_20140815 collection time 11:30 collection_timestamp 8/15/14 11:30 coloniality colonial colony maximum diameter 500 colony maximum diameter unit cm colony_height_m 60 colony_maximum_diameter 500 colony_maximum_diameter_universal 1034 colony_maximum_gcmp_recorded 1034 colony_name E1.15.Dip.heli.1.20140815 colony_width1 100 colony_width2 80 compartment_replicates 1 complex_robust robust concatenated_date 20140815 corallite width maximum 9 corallite width maximum unit mm corallite width minimum 7 corallite width minimum unit mm country Australia cyanobacteria_contact y cyanobacteria_percent 10 daily_replicate 1 date 8/15/14 depth 1.524 depth lower 30 depth lower unit m depth upper 0 depth upper unit m depth_method measured disease_percent 0 dna_extracted y eastern-most range edge -167.1916889 env matter organic material environment (biome) coral reef environment (feature) coral environment (material) Coral Tissue environmental sample Yes expedition_number E1 family Diploastreidae field_host_genus_id Diploastrea field_host_name Diploastrea heliopora field_host_species_id heliopora full_location Indo-Pacific;Pacific;Coral Sea;Australia;NE;Great Barrier Reef - Lizard Island Sector;Trawler full_taxonomy_string_with_clade Cnidaria_Anthozoa_Scleractinia_XV_Diploastrea_heliopora functional_group_sensu_darling Stress-tolerant genus fossil age 99.6 genus fossil age unit mya geographic area NE geographic location (country and/or sea) Australia geographic location (latitude) -14.68344 geographic location (longitude) 145.46554 growth form typical massive hemisphere Southern host species heliopora host_clade_sensu_fukami XV host_clade_sensu_fukami_numeric 15 host_genus Diploastrea host_genus_id Diploastrea host_name Diploastrea heliopora host_species_id heliopora huang_roy_tree_name FAV_Diploastrea_heliopora invertebrate_contact_types porites__tridacna__stylophora__lobophytum iucn red list category NT latitude -14.68344 linkerprimersequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA local_colony_name Diploastrea heliopora_20140815 local_sample_id Dip Tis 140815 longitude 145.46554 mode of larval development spawner n_algal_contacts 2 n_macroalgal_contacts 0 ncbi_inherited_blast_name stony corals northern-most range edge 30.8119151 ocean Pacific ocean_area Coral Sea ocean_superregion Indo-Pacific oocyte size at maturity 290 oocyte size at maturity unit um outgroup n oz_disease_mean 0 oz_disease_sd 0 par_method buoy parrotfish_bites n pcr primers 515F/806R photosynthetically_active_radiation 331.988 physical samp avail now n physical_sample_location Bourne Lab, AIMS, Australia cannot be reextracted political_area Australia prop_colony_maximum_diameter 0.2 prop_colony_maximum_diameter_universal 0.096711799 prop_colony_maximum_gcmp_recorded 0.096711799 range size 70449346.41 range size unit km^2 reef_name Trawler reef_type Midshelf inshore reef relevant_collaborators David Bourne, Katia Nicolet, and many others at JCU, AIMS, and LIRS reverseprimer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT runid ALVCP sample name E1.15.Dip.heli.1.20140815.T sample type Coral Tissue sampling_expedition E1_Lizard_Island_2014 scientific_name coral metagenome seagrass_contact n sediment_contact n sequence_center_id Pollock99 sexual system gonochore shelf_location midshelf site name Great Barrier Reef - Lizard Island Sector southern-most range edge -30.63689894 species age phylogeny 64.52281751 species age phylogeny unit mya substrate rock substrate attachment attached symbio_its2_sequenced y symbiodinium sp. in propagules no target gene 16S target subfragment V4 taxon id 214969 taxonomy_string_to_clade Cnidaria_Anthozoa_Scleractinia_XV taxonomy_string_to_class Cnidaria_Anthozoa taxonomy_string_to_family Cnidaria_Anthozoa_Scleractinia_Diploastreidae taxonomy_string_to_order Cnidaria_Anthozoa_Scleractinia taxonomy_string_to_subclass Cnidaria_Anthozoa_Hexacorallia temperature 23.9 tissue compartment T tissue_loss_percent 0 turf_contact_percent 20 visibility 19 visibility_method Horizontal Secchi Disk water clarity preference clear wave exposure preference broad western-most range edge 31.7583974 zooxanthellate zooxanthellate