ERS14634736 SAMEA112642767 8030 Salmo salar Salmon 16S amplicon sequencing data from Distal gut content; animal SA10.22 from tank SA10 with treatment Jaguar ENA-FIRST-PUBLIC 2023-04-21 ENA-LAST-UPDATE 2023-04-21 External Id SAMEA112642767 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-04-21T12:19:58Z INSDC last update 2023-04-21T12:19:58Z INSDC status public Submitter Id SA10_22C1a_16S adapters AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT collection date 2019-08-12 common name Atlantic salmon geographic location (country and/or sea) Norway geographic location (latitude) 66.079905 geographic location (longitude) 12.587848 geographic location (region and locality) Dønna; Nordland county host body site Distal gut content host common name Atlantic salmon host diet Fermented algae meal (added in in oil coating) host diet treatment Jaguar SA Seaweed 2% host diet treatment concentration 2 host disease status Wounded:- host gutted mass 613.20 host length 37.00 host scientific name Salmo salar host storage container LetSea Tank: Jaguar host storage container pH 7.05 host storage container temperature 12.76 host subject id SA10.22 host taxid 8030 host total mass 716.60 library name BEST library selection PCR nucleic acid extraction D-rex protocol project HoloFood project name Holofood Salmon 16S amplicon sequencing reference host genome for decontamination GCA_000000000.0 sample name SA10_22C1a_16S sample storage buffer Shield sample storage container 2ml E-matrix sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name Salmo salar sequencing method Illumina MiSeq trial timepoint 60