ERS3905391 SAMEA6104711 9606 Homo sapiens Protocols: Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). WBS1, WBS2, WBS3, WBS4, 7dupASD1, AtWBS1 and CTL2 fibroblasts were reprogrammed using the mRNA Reprogramming kit (Stemgent), while the 7dupASD2 and CTL1R lines were reprogrammed with the microRNA Booster kit (Stemgent). The CTL3 line was reprogrammed by transfection with the STEMCCA polycistronic lentiviral vector followed by Cre-mediated excision of the integrated polycistron. 7dupASD3 and CTL4R fibroblasts were reprogrammed using the SimpliconTM RNA Reprogramming kit (Millipore). Prior to differentiation, iPSC lines were cultured on hESC-qualified Matrigel (BD Biosciences) coated plates, diluted 1:40 in DMEM/F-12 and grown in mTeSR-1 medium (StemCell Technologies). They were passaged upon treatment with Accutase (Sigma) and then plated in mTeSR-1 medium supplemented with 5μM Y-27632 (Sigma). Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). RNA was extracted using the RNeasy Micro Plus kit (Qiagen) according to manufacturer's instructions. Retrotranscribed cDNA was obtained from 0.5-1 μg of total RNA using the SuperScript VILO Retrotranscription kit (Thermo Fisher Scientific). RT-qPCR was performed on a 7500 Fast Real-Time PCR system (Applied Biosystems) using SYBR Green Master Mix (Applied Biosystems) as detecting reagent. A total cDNA amount corresponding to 15 ng of starting RNA was used for each reaction. Each sample was analyzed in triplicate and normalized to GAPDH. Relative mRNA quantity was calculated by the comparative cycle threshold (Ct) method using the formula 2-deltaCt. BAZ1B: CCTCGCAGTAAGAAAGCAAAC (forward); ACTCATCCAGCTCCTTTTGAC (reverse). 4 GAPDH: GCACCGTCAAGGCTGAGAAC (forward); AGGGATCTCGCTCCTGGAA (reverse). NR2F1: AGAAGCTCAAGGCGCTACAC (forward); GGGTACTGGCTCCTCACGTA (reverse). NR2F2: GCAAGTGGAGAAGCTCAAGG (forward); GCTTTCCACATGGGCTACAT (reverse). TFAP2A: GCCTCTCGCTCCTCAGCTCC (forward); CGTTGGCAGCTTTACGTCTCCC (reverse). SOX9: AGTACCCGCACTTGCACAAC (forward); GTAATCCGGGTGGTCCTTCT (reverse). Library preparation for RNA sequencing was performed according to TruSeq Total RNA sample preparation protocol (Illumina), starting from 250 ng - 1 μg of total RNA. cDNA library quality was assessed at an Agilent 2100 Bioanalyzer, using the High sensitivity DNA kit. ENA-FIRST-PUBLIC 2020-02-29T04:05:15Z ENA-LAST-UPDATE 2019-10-21T16:33:18Z External Id SAMEA6104711 INSDC center name Department of Oncology and Hemato-Oncology, University of Milan, Italy INSDC first public 2020-02-29T04:05:15Z INSDC last update 2019-10-21T16:33:18Z INSDC status public Submitter Id E-MTAB-8455:7DupASD1.scr broker name ArrayExpress cell type neural stem cell common name human developmental stage adult disease 7q11.23 microduplication syndrome genotype wild type genotype individual 7DupASD1 organism part skin progenitor cell type induced pluripotent stem cell sample name E-MTAB-8455:7DupASD1.scr scientific_name Homo sapiens ERS3905392 SAMEA6104712 9606 Homo sapiens Protocols: Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). WBS1, WBS2, WBS3, WBS4, 7dupASD1, AtWBS1 and CTL2 fibroblasts were reprogrammed using the mRNA Reprogramming kit (Stemgent), while the 7dupASD2 and CTL1R lines were reprogrammed with the microRNA Booster kit (Stemgent). The CTL3 line was reprogrammed by transfection with the STEMCCA polycistronic lentiviral vector followed by Cre-mediated excision of the integrated polycistron. 7dupASD3 and CTL4R fibroblasts were reprogrammed using the SimpliconTM RNA Reprogramming kit (Millipore). Prior to differentiation, iPSC lines were cultured on hESC-qualified Matrigel (BD Biosciences) coated plates, diluted 1:40 in DMEM/F-12 and grown in mTeSR-1 medium (StemCell Technologies). They were passaged upon treatment with Accutase (Sigma) and then plated in mTeSR-1 medium supplemented with 5μM Y-27632 (Sigma). Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). RNA was extracted using the RNeasy Micro Plus kit (Qiagen) according to manufacturer's instructions. Retrotranscribed cDNA was obtained from 0.5-1 μg of total RNA using the SuperScript VILO Retrotranscription kit (Thermo Fisher Scientific). RT-qPCR was performed on a 7500 Fast Real-Time PCR system (Applied Biosystems) using SYBR Green Master Mix (Applied Biosystems) as detecting reagent. A total cDNA amount corresponding to 15 ng of starting RNA was used for each reaction. Each sample was analyzed in triplicate and normalized to GAPDH. Relative mRNA quantity was calculated by the comparative cycle threshold (Ct) method using the formula 2-deltaCt. BAZ1B: CCTCGCAGTAAGAAAGCAAAC (forward); ACTCATCCAGCTCCTTTTGAC (reverse). 4 GAPDH: GCACCGTCAAGGCTGAGAAC (forward); AGGGATCTCGCTCCTGGAA (reverse). NR2F1: AGAAGCTCAAGGCGCTACAC (forward); GGGTACTGGCTCCTCACGTA (reverse). NR2F2: GCAAGTGGAGAAGCTCAAGG (forward); GCTTTCCACATGGGCTACAT (reverse). TFAP2A: GCCTCTCGCTCCTCAGCTCC (forward); CGTTGGCAGCTTTACGTCTCCC (reverse). SOX9: AGTACCCGCACTTGCACAAC (forward); GTAATCCGGGTGGTCCTTCT (reverse). Library preparation for RNA sequencing was performed according to TruSeq Total RNA sample preparation protocol (Illumina), starting from 250 ng - 1 μg of total RNA. cDNA library quality was assessed at an Agilent 2100 Bioanalyzer, using the High sensitivity DNA kit. ENA-FIRST-PUBLIC 2020-02-29T04:05:15Z ENA-LAST-UPDATE 2019-10-21T16:33:18Z External Id SAMEA6104712 INSDC center name Department of Oncology and Hemato-Oncology, University of Milan, Italy INSDC first public 2020-02-29T04:05:15Z INSDC last update 2019-10-21T16:33:18Z INSDC status public Submitter Id E-MTAB-8455:7DupASD2.scr broker name ArrayExpress cell type neural stem cell common name human developmental stage adult disease 7q11.23 microduplication syndrome genotype wild type genotype individual 7DupASD2 organism part skin progenitor cell type induced pluripotent stem cell sample name E-MTAB-8455:7DupASD2.scr scientific_name Homo sapiens ERS3905393 SAMEA6104713 9606 Homo sapiens Protocols: Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). WBS1, WBS2, WBS3, WBS4, 7dupASD1, AtWBS1 and CTL2 fibroblasts were reprogrammed using the mRNA Reprogramming kit (Stemgent), while the 7dupASD2 and CTL1R lines were reprogrammed with the microRNA Booster kit (Stemgent). The CTL3 line was reprogrammed by transfection with the STEMCCA polycistronic lentiviral vector followed by Cre-mediated excision of the integrated polycistron. 7dupASD3 and CTL4R fibroblasts were reprogrammed using the SimpliconTM RNA Reprogramming kit (Millipore). Prior to differentiation, iPSC lines were cultured on hESC-qualified Matrigel (BD Biosciences) coated plates, diluted 1:40 in DMEM/F-12 and grown in mTeSR-1 medium (StemCell Technologies). They were passaged upon treatment with Accutase (Sigma) and then plated in mTeSR-1 medium supplemented with 5μM Y-27632 (Sigma). Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). RNA was extracted using the RNeasy Micro Plus kit (Qiagen) according to manufacturer's instructions. Retrotranscribed cDNA was obtained from 0.5-1 μg of total RNA using the SuperScript VILO Retrotranscription kit (Thermo Fisher Scientific). RT-qPCR was performed on a 7500 Fast Real-Time PCR system (Applied Biosystems) using SYBR Green Master Mix (Applied Biosystems) as detecting reagent. A total cDNA amount corresponding to 15 ng of starting RNA was used for each reaction. Each sample was analyzed in triplicate and normalized to GAPDH. Relative mRNA quantity was calculated by the comparative cycle threshold (Ct) method using the formula 2-deltaCt. BAZ1B: CCTCGCAGTAAGAAAGCAAAC (forward); ACTCATCCAGCTCCTTTTGAC (reverse). 4 GAPDH: GCACCGTCAAGGCTGAGAAC (forward); AGGGATCTCGCTCCTGGAA (reverse). NR2F1: AGAAGCTCAAGGCGCTACAC (forward); GGGTACTGGCTCCTCACGTA (reverse). NR2F2: GCAAGTGGAGAAGCTCAAGG (forward); GCTTTCCACATGGGCTACAT (reverse). TFAP2A: GCCTCTCGCTCCTCAGCTCC (forward); CGTTGGCAGCTTTACGTCTCCC (reverse). SOX9: AGTACCCGCACTTGCACAAC (forward); GTAATCCGGGTGGTCCTTCT (reverse). Library preparation for RNA sequencing was performed according to TruSeq Total RNA sample preparation protocol (Illumina), starting from 250 ng - 1 μg of total RNA. cDNA library quality was assessed at an Agilent 2100 Bioanalyzer, using the High sensitivity DNA kit. ENA-FIRST-PUBLIC 2020-02-29T04:05:15Z ENA-LAST-UPDATE 2019-10-21T16:33:18Z External Id SAMEA6104713 INSDC center name Department of Oncology and Hemato-Oncology, University of Milan, Italy INSDC first public 2020-02-29T04:05:15Z INSDC last update 2019-10-21T16:33:18Z INSDC status public Submitter Id E-MTAB-8455:7DupASD3.scr broker name ArrayExpress cell type neural stem cell common name human developmental stage adult disease 7q11.23 microduplication syndrome genotype wild type genotype individual 7DupASD3 organism part skin progenitor cell type induced pluripotent stem cell sample name E-MTAB-8455:7DupASD3.scr scientific_name Homo sapiens ERS3905394 SAMEA6104714 9606 Homo sapiens Protocols: Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). WBS1, WBS2, WBS3, WBS4, 7dupASD1, AtWBS1 and CTL2 fibroblasts were reprogrammed using the mRNA Reprogramming kit (Stemgent), while the 7dupASD2 and CTL1R lines were reprogrammed with the microRNA Booster kit (Stemgent). The CTL3 line was reprogrammed by transfection with the STEMCCA polycistronic lentiviral vector followed by Cre-mediated excision of the integrated polycistron. 7dupASD3 and CTL4R fibroblasts were reprogrammed using the SimpliconTM RNA Reprogramming kit (Millipore). Prior to differentiation, iPSC lines were cultured on hESC-qualified Matrigel (BD Biosciences) coated plates, diluted 1:40 in DMEM/F-12 and grown in mTeSR-1 medium (StemCell Technologies). They were passaged upon treatment with Accutase (Sigma) and then plated in mTeSR-1 medium supplemented with 5μM Y-27632 (Sigma). Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). RNA was extracted using the RNeasy Micro Plus kit (Qiagen) according to manufacturer's instructions. Retrotranscribed cDNA was obtained from 0.5-1 μg of total RNA using the SuperScript VILO Retrotranscription kit (Thermo Fisher Scientific). RT-qPCR was performed on a 7500 Fast Real-Time PCR system (Applied Biosystems) using SYBR Green Master Mix (Applied Biosystems) as detecting reagent. A total cDNA amount corresponding to 15 ng of starting RNA was used for each reaction. Each sample was analyzed in triplicate and normalized to GAPDH. Relative mRNA quantity was calculated by the comparative cycle threshold (Ct) method using the formula 2-deltaCt. BAZ1B: CCTCGCAGTAAGAAAGCAAAC (forward); ACTCATCCAGCTCCTTTTGAC (reverse). 4 GAPDH: GCACCGTCAAGGCTGAGAAC (forward); AGGGATCTCGCTCCTGGAA (reverse). NR2F1: AGAAGCTCAAGGCGCTACAC (forward); GGGTACTGGCTCCTCACGTA (reverse). NR2F2: GCAAGTGGAGAAGCTCAAGG (forward); GCTTTCCACATGGGCTACAT (reverse). TFAP2A: GCCTCTCGCTCCTCAGCTCC (forward); CGTTGGCAGCTTTACGTCTCCC (reverse). SOX9: AGTACCCGCACTTGCACAAC (forward); GTAATCCGGGTGGTCCTTCT (reverse). Library preparation for RNA sequencing was performed according to TruSeq Total RNA sample preparation protocol (Illumina), starting from 250 ng - 1 μg of total RNA. cDNA library quality was assessed at an Agilent 2100 Bioanalyzer, using the High sensitivity DNA kit. ENA-FIRST-PUBLIC 2020-02-29T04:05:15Z ENA-LAST-UPDATE 2019-10-21T16:33:18Z External Id SAMEA6104714 INSDC center name Department of Oncology and Hemato-Oncology, University of Milan, Italy INSDC first public 2020-02-29T04:05:15Z INSDC last update 2019-10-21T16:33:18Z INSDC status public Submitter Id E-MTAB-8455:AtWBS1.scr broker name ArrayExpress cell type neural stem cell common name human developmental stage adult disease Williams syndrome genotype wild type genotype individual AtWBS1 organism part skin progenitor cell type induced pluripotent stem cell sample name E-MTAB-8455:AtWBS1.scr scientific_name Homo sapiens ERS3905395 SAMEA6104715 9606 Homo sapiens Protocols: Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). WBS1, WBS2, WBS3, WBS4, 7dupASD1, AtWBS1 and CTL2 fibroblasts were reprogrammed using the mRNA Reprogramming kit (Stemgent), while the 7dupASD2 and CTL1R lines were reprogrammed with the microRNA Booster kit (Stemgent). The CTL3 line was reprogrammed by transfection with the STEMCCA polycistronic lentiviral vector followed by Cre-mediated excision of the integrated polycistron. 7dupASD3 and CTL4R fibroblasts were reprogrammed using the SimpliconTM RNA Reprogramming kit (Millipore). Prior to differentiation, iPSC lines were cultured on hESC-qualified Matrigel (BD Biosciences) coated plates, diluted 1:40 in DMEM/F-12 and grown in mTeSR-1 medium (StemCell Technologies). They were passaged upon treatment with Accutase (Sigma) and then plated in mTeSR-1 medium supplemented with 5μM Y-27632 (Sigma). Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). RNA was extracted using the RNeasy Micro Plus kit (Qiagen) according to manufacturer's instructions. Retrotranscribed cDNA was obtained from 0.5-1 μg of total RNA using the SuperScript VILO Retrotranscription kit (Thermo Fisher Scientific). RT-qPCR was performed on a 7500 Fast Real-Time PCR system (Applied Biosystems) using SYBR Green Master Mix (Applied Biosystems) as detecting reagent. A total cDNA amount corresponding to 15 ng of starting RNA was used for each reaction. Each sample was analyzed in triplicate and normalized to GAPDH. Relative mRNA quantity was calculated by the comparative cycle threshold (Ct) method using the formula 2-deltaCt. BAZ1B: CCTCGCAGTAAGAAAGCAAAC (forward); ACTCATCCAGCTCCTTTTGAC (reverse). 4 GAPDH: GCACCGTCAAGGCTGAGAAC (forward); AGGGATCTCGCTCCTGGAA (reverse). NR2F1: AGAAGCTCAAGGCGCTACAC (forward); GGGTACTGGCTCCTCACGTA (reverse). NR2F2: GCAAGTGGAGAAGCTCAAGG (forward); GCTTTCCACATGGGCTACAT (reverse). TFAP2A: GCCTCTCGCTCCTCAGCTCC (forward); CGTTGGCAGCTTTACGTCTCCC (reverse). SOX9: AGTACCCGCACTTGCACAAC (forward); GTAATCCGGGTGGTCCTTCT (reverse). Library preparation for RNA sequencing was performed according to TruSeq Total RNA sample preparation protocol (Illumina), starting from 250 ng - 1 μg of total RNA. cDNA library quality was assessed at an Agilent 2100 Bioanalyzer, using the High sensitivity DNA kit. ENA-FIRST-PUBLIC 2020-02-29T04:05:15Z ENA-LAST-UPDATE 2019-10-21T16:33:18Z External Id SAMEA6104715 INSDC center name Department of Oncology and Hemato-Oncology, University of Milan, Italy INSDC first public 2020-02-29T04:05:15Z INSDC last update 2019-10-21T16:33:18Z INSDC status public Submitter Id E-MTAB-8455:CTL1.scr broker name ArrayExpress cell type neural stem cell common name human developmental stage adult disease normal genotype wild type genotype individual CTL1 organism part skin progenitor cell type induced pluripotent stem cell sample name E-MTAB-8455:CTL1.scr scientific_name Homo sapiens ERS3905396 SAMEA6104716 9606 Homo sapiens Protocols: Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). WBS1, WBS2, WBS3, WBS4, 7dupASD1, AtWBS1 and CTL2 fibroblasts were reprogrammed using the mRNA Reprogramming kit (Stemgent), while the 7dupASD2 and CTL1R lines were reprogrammed with the microRNA Booster kit (Stemgent). The CTL3 line was reprogrammed by transfection with the STEMCCA polycistronic lentiviral vector followed by Cre-mediated excision of the integrated polycistron. 7dupASD3 and CTL4R fibroblasts were reprogrammed using the SimpliconTM RNA Reprogramming kit (Millipore). Prior to differentiation, iPSC lines were cultured on hESC-qualified Matrigel (BD Biosciences) coated plates, diluted 1:40 in DMEM/F-12 and grown in mTeSR-1 medium (StemCell Technologies). They were passaged upon treatment with Accutase (Sigma) and then plated in mTeSR-1 medium supplemented with 5μM Y-27632 (Sigma). Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). RNA was extracted using the RNeasy Micro Plus kit (Qiagen) according to manufacturer's instructions. Retrotranscribed cDNA was obtained from 0.5-1 μg of total RNA using the SuperScript VILO Retrotranscription kit (Thermo Fisher Scientific). RT-qPCR was performed on a 7500 Fast Real-Time PCR system (Applied Biosystems) using SYBR Green Master Mix (Applied Biosystems) as detecting reagent. A total cDNA amount corresponding to 15 ng of starting RNA was used for each reaction. Each sample was analyzed in triplicate and normalized to GAPDH. Relative mRNA quantity was calculated by the comparative cycle threshold (Ct) method using the formula 2-deltaCt. BAZ1B: CCTCGCAGTAAGAAAGCAAAC (forward); ACTCATCCAGCTCCTTTTGAC (reverse). 4 GAPDH: GCACCGTCAAGGCTGAGAAC (forward); AGGGATCTCGCTCCTGGAA (reverse). NR2F1: AGAAGCTCAAGGCGCTACAC (forward); GGGTACTGGCTCCTCACGTA (reverse). NR2F2: GCAAGTGGAGAAGCTCAAGG (forward); GCTTTCCACATGGGCTACAT (reverse). TFAP2A: GCCTCTCGCTCCTCAGCTCC (forward); CGTTGGCAGCTTTACGTCTCCC (reverse). SOX9: AGTACCCGCACTTGCACAAC (forward); GTAATCCGGGTGGTCCTTCT (reverse). Library preparation for RNA sequencing was performed according to TruSeq Total RNA sample preparation protocol (Illumina), starting from 250 ng - 1 μg of total RNA. cDNA library quality was assessed at an Agilent 2100 Bioanalyzer, using the High sensitivity DNA kit. ENA-FIRST-PUBLIC 2020-02-29T04:05:15Z ENA-LAST-UPDATE 2019-10-21T16:33:18Z External Id SAMEA6104716 INSDC center name Department of Oncology and Hemato-Oncology, University of Milan, Italy INSDC first public 2020-02-29T04:05:15Z INSDC last update 2019-10-21T16:33:18Z INSDC status public Submitter Id E-MTAB-8455:CTL2.scr broker name ArrayExpress cell type neural stem cell common name human developmental stage adult disease normal genotype wild type genotype individual CTL2 organism part skin progenitor cell type induced pluripotent stem cell sample name E-MTAB-8455:CTL2.scr scientific_name Homo sapiens ERS3905397 SAMEA6104717 9606 Homo sapiens Protocols: Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). WBS1, WBS2, WBS3, WBS4, 7dupASD1, AtWBS1 and CTL2 fibroblasts were reprogrammed using the mRNA Reprogramming kit (Stemgent), while the 7dupASD2 and CTL1R lines were reprogrammed with the microRNA Booster kit (Stemgent). The CTL3 line was reprogrammed by transfection with the STEMCCA polycistronic lentiviral vector followed by Cre-mediated excision of the integrated polycistron. 7dupASD3 and CTL4R fibroblasts were reprogrammed using the SimpliconTM RNA Reprogramming kit (Millipore). Prior to differentiation, iPSC lines were cultured on hESC-qualified Matrigel (BD Biosciences) coated plates, diluted 1:40 in DMEM/F-12 and grown in mTeSR-1 medium (StemCell Technologies). They were passaged upon treatment with Accutase (Sigma) and then plated in mTeSR-1 medium supplemented with 5μM Y-27632 (Sigma). Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). RNA was extracted using the RNeasy Micro Plus kit (Qiagen) according to manufacturer's instructions. Retrotranscribed cDNA was obtained from 0.5-1 μg of total RNA using the SuperScript VILO Retrotranscription kit (Thermo Fisher Scientific). RT-qPCR was performed on a 7500 Fast Real-Time PCR system (Applied Biosystems) using SYBR Green Master Mix (Applied Biosystems) as detecting reagent. A total cDNA amount corresponding to 15 ng of starting RNA was used for each reaction. Each sample was analyzed in triplicate and normalized to GAPDH. Relative mRNA quantity was calculated by the comparative cycle threshold (Ct) method using the formula 2-deltaCt. BAZ1B: CCTCGCAGTAAGAAAGCAAAC (forward); ACTCATCCAGCTCCTTTTGAC (reverse). 4 GAPDH: GCACCGTCAAGGCTGAGAAC (forward); AGGGATCTCGCTCCTGGAA (reverse). NR2F1: AGAAGCTCAAGGCGCTACAC (forward); GGGTACTGGCTCCTCACGTA (reverse). NR2F2: GCAAGTGGAGAAGCTCAAGG (forward); GCTTTCCACATGGGCTACAT (reverse). TFAP2A: GCCTCTCGCTCCTCAGCTCC (forward); CGTTGGCAGCTTTACGTCTCCC (reverse). SOX9: AGTACCCGCACTTGCACAAC (forward); GTAATCCGGGTGGTCCTTCT (reverse). Library preparation for RNA sequencing was performed according to TruSeq Total RNA sample preparation protocol (Illumina), starting from 250 ng - 1 μg of total RNA. cDNA library quality was assessed at an Agilent 2100 Bioanalyzer, using the High sensitivity DNA kit. ENA-FIRST-PUBLIC 2020-02-29T04:05:15Z ENA-LAST-UPDATE 2019-10-21T16:33:18Z External Id SAMEA6104717 INSDC center name Department of Oncology and Hemato-Oncology, University of Milan, Italy INSDC first public 2020-02-29T04:05:15Z INSDC last update 2019-10-21T16:33:18Z INSDC status public Submitter Id E-MTAB-8455:CTL3.scr broker name ArrayExpress cell type neural stem cell common name human developmental stage adult disease normal genotype wild type genotype individual CTL3 organism part skin progenitor cell type induced pluripotent stem cell sample name E-MTAB-8455:CTL3.scr scientific_name Homo sapiens ERS3905398 SAMEA6104718 9606 Homo sapiens Protocols: Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). WBS1, WBS2, WBS3, WBS4, 7dupASD1, AtWBS1 and CTL2 fibroblasts were reprogrammed using the mRNA Reprogramming kit (Stemgent), while the 7dupASD2 and CTL1R lines were reprogrammed with the microRNA Booster kit (Stemgent). The CTL3 line was reprogrammed by transfection with the STEMCCA polycistronic lentiviral vector followed by Cre-mediated excision of the integrated polycistron. 7dupASD3 and CTL4R fibroblasts were reprogrammed using the SimpliconTM RNA Reprogramming kit (Millipore). Prior to differentiation, iPSC lines were cultured on hESC-qualified Matrigel (BD Biosciences) coated plates, diluted 1:40 in DMEM/F-12 and grown in mTeSR-1 medium (StemCell Technologies). They were passaged upon treatment with Accutase (Sigma) and then plated in mTeSR-1 medium supplemented with 5μM Y-27632 (Sigma). Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). RNA was extracted using the RNeasy Micro Plus kit (Qiagen) according to manufacturer's instructions. Retrotranscribed cDNA was obtained from 0.5-1 μg of total RNA using the SuperScript VILO Retrotranscription kit (Thermo Fisher Scientific). RT-qPCR was performed on a 7500 Fast Real-Time PCR system (Applied Biosystems) using SYBR Green Master Mix (Applied Biosystems) as detecting reagent. A total cDNA amount corresponding to 15 ng of starting RNA was used for each reaction. Each sample was analyzed in triplicate and normalized to GAPDH. Relative mRNA quantity was calculated by the comparative cycle threshold (Ct) method using the formula 2-deltaCt. BAZ1B: CCTCGCAGTAAGAAAGCAAAC (forward); ACTCATCCAGCTCCTTTTGAC (reverse). 4 GAPDH: GCACCGTCAAGGCTGAGAAC (forward); AGGGATCTCGCTCCTGGAA (reverse). NR2F1: AGAAGCTCAAGGCGCTACAC (forward); GGGTACTGGCTCCTCACGTA (reverse). NR2F2: GCAAGTGGAGAAGCTCAAGG (forward); GCTTTCCACATGGGCTACAT (reverse). TFAP2A: GCCTCTCGCTCCTCAGCTCC (forward); CGTTGGCAGCTTTACGTCTCCC (reverse). SOX9: AGTACCCGCACTTGCACAAC (forward); GTAATCCGGGTGGTCCTTCT (reverse). Library preparation for RNA sequencing was performed according to TruSeq Total RNA sample preparation protocol (Illumina), starting from 250 ng - 1 μg of total RNA. cDNA library quality was assessed at an Agilent 2100 Bioanalyzer, using the High sensitivity DNA kit. ENA-FIRST-PUBLIC 2020-02-29T04:05:15Z ENA-LAST-UPDATE 2019-10-21T16:33:18Z External Id SAMEA6104718 INSDC center name Department of Oncology and Hemato-Oncology, University of Milan, Italy INSDC first public 2020-02-29T04:05:15Z INSDC last update 2019-10-21T16:33:18Z INSDC status public Submitter Id E-MTAB-8455:CTL4.scr broker name ArrayExpress cell type neural stem cell common name human developmental stage adult disease normal genotype wild type genotype individual CTL4 organism part skin progenitor cell type induced pluripotent stem cell sample name E-MTAB-8455:CTL4.scr scientific_name Homo sapiens ERS3905399 SAMEA6104719 9606 Homo sapiens Protocols: Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). WBS1, WBS2, WBS3, WBS4, 7dupASD1, AtWBS1 and CTL2 fibroblasts were reprogrammed using the mRNA Reprogramming kit (Stemgent), while the 7dupASD2 and CTL1R lines were reprogrammed with the microRNA Booster kit (Stemgent). The CTL3 line was reprogrammed by transfection with the STEMCCA polycistronic lentiviral vector followed by Cre-mediated excision of the integrated polycistron. 7dupASD3 and CTL4R fibroblasts were reprogrammed using the SimpliconTM RNA Reprogramming kit (Millipore). Prior to differentiation, iPSC lines were cultured on hESC-qualified Matrigel (BD Biosciences) coated plates, diluted 1:40 in DMEM/F-12 and grown in mTeSR-1 medium (StemCell Technologies). They were passaged upon treatment with Accutase (Sigma) and then plated in mTeSR-1 medium supplemented with 5μM Y-27632 (Sigma). Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). RNA was extracted using the RNeasy Micro Plus kit (Qiagen) according to manufacturer's instructions. Retrotranscribed cDNA was obtained from 0.5-1 μg of total RNA using the SuperScript VILO Retrotranscription kit (Thermo Fisher Scientific). RT-qPCR was performed on a 7500 Fast Real-Time PCR system (Applied Biosystems) using SYBR Green Master Mix (Applied Biosystems) as detecting reagent. A total cDNA amount corresponding to 15 ng of starting RNA was used for each reaction. Each sample was analyzed in triplicate and normalized to GAPDH. Relative mRNA quantity was calculated by the comparative cycle threshold (Ct) method using the formula 2-deltaCt. BAZ1B: CCTCGCAGTAAGAAAGCAAAC (forward); ACTCATCCAGCTCCTTTTGAC (reverse). 4 GAPDH: GCACCGTCAAGGCTGAGAAC (forward); AGGGATCTCGCTCCTGGAA (reverse). NR2F1: AGAAGCTCAAGGCGCTACAC (forward); GGGTACTGGCTCCTCACGTA (reverse). NR2F2: GCAAGTGGAGAAGCTCAAGG (forward); GCTTTCCACATGGGCTACAT (reverse). TFAP2A: GCCTCTCGCTCCTCAGCTCC (forward); CGTTGGCAGCTTTACGTCTCCC (reverse). SOX9: AGTACCCGCACTTGCACAAC (forward); GTAATCCGGGTGGTCCTTCT (reverse). Library preparation for RNA sequencing was performed according to TruSeq Total RNA sample preparation protocol (Illumina), starting from 250 ng - 1 μg of total RNA. cDNA library quality was assessed at an Agilent 2100 Bioanalyzer, using the High sensitivity DNA kit. ENA-FIRST-PUBLIC 2020-02-29T04:05:15Z ENA-LAST-UPDATE 2019-10-21T16:33:18Z External Id SAMEA6104719 INSDC center name Department of Oncology and Hemato-Oncology, University of Milan, Italy INSDC first public 2020-02-29T04:05:15Z INSDC last update 2019-10-21T16:33:18Z INSDC status public Submitter Id E-MTAB-8455:WBS1.scr broker name ArrayExpress cell type neural stem cell common name human developmental stage adult disease Williams syndrome genotype wild type genotype individual WBS1 organism part skin progenitor cell type induced pluripotent stem cell sample name E-MTAB-8455:WBS1.scr scientific_name Homo sapiens ERS3905400 SAMEA6104720 9606 Homo sapiens Protocols: Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). WBS1, WBS2, WBS3, WBS4, 7dupASD1, AtWBS1 and CTL2 fibroblasts were reprogrammed using the mRNA Reprogramming kit (Stemgent), while the 7dupASD2 and CTL1R lines were reprogrammed with the microRNA Booster kit (Stemgent). The CTL3 line was reprogrammed by transfection with the STEMCCA polycistronic lentiviral vector followed by Cre-mediated excision of the integrated polycistron. 7dupASD3 and CTL4R fibroblasts were reprogrammed using the SimpliconTM RNA Reprogramming kit (Millipore). Prior to differentiation, iPSC lines were cultured on hESC-qualified Matrigel (BD Biosciences) coated plates, diluted 1:40 in DMEM/F-12 and grown in mTeSR-1 medium (StemCell Technologies). They were passaged upon treatment with Accutase (Sigma) and then plated in mTeSR-1 medium supplemented with 5μM Y-27632 (Sigma). Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). RNA was extracted using the RNeasy Micro Plus kit (Qiagen) according to manufacturer's instructions. Retrotranscribed cDNA was obtained from 0.5-1 μg of total RNA using the SuperScript VILO Retrotranscription kit (Thermo Fisher Scientific). RT-qPCR was performed on a 7500 Fast Real-Time PCR system (Applied Biosystems) using SYBR Green Master Mix (Applied Biosystems) as detecting reagent. A total cDNA amount corresponding to 15 ng of starting RNA was used for each reaction. Each sample was analyzed in triplicate and normalized to GAPDH. Relative mRNA quantity was calculated by the comparative cycle threshold (Ct) method using the formula 2-deltaCt. BAZ1B: CCTCGCAGTAAGAAAGCAAAC (forward); ACTCATCCAGCTCCTTTTGAC (reverse). 4 GAPDH: GCACCGTCAAGGCTGAGAAC (forward); AGGGATCTCGCTCCTGGAA (reverse). NR2F1: AGAAGCTCAAGGCGCTACAC (forward); GGGTACTGGCTCCTCACGTA (reverse). NR2F2: GCAAGTGGAGAAGCTCAAGG (forward); GCTTTCCACATGGGCTACAT (reverse). TFAP2A: GCCTCTCGCTCCTCAGCTCC (forward); CGTTGGCAGCTTTACGTCTCCC (reverse). SOX9: AGTACCCGCACTTGCACAAC (forward); GTAATCCGGGTGGTCCTTCT (reverse). Library preparation for RNA sequencing was performed according to TruSeq Total RNA sample preparation protocol (Illumina), starting from 250 ng - 1 μg of total RNA. cDNA library quality was assessed at an Agilent 2100 Bioanalyzer, using the High sensitivity DNA kit. ENA-FIRST-PUBLIC 2020-02-29T04:05:15Z ENA-LAST-UPDATE 2019-10-21T16:33:18Z External Id SAMEA6104720 INSDC center name Department of Oncology and Hemato-Oncology, University of Milan, Italy INSDC first public 2020-02-29T04:05:15Z INSDC last update 2019-10-21T16:33:18Z INSDC status public Submitter Id E-MTAB-8455:WBS2.scr broker name ArrayExpress cell type neural stem cell common name human developmental stage adult disease Williams syndrome genotype wild type genotype individual WBS2 organism part skin progenitor cell type induced pluripotent stem cell sample name E-MTAB-8455:WBS2.scr scientific_name Homo sapiens ERS3905401 SAMEA6104721 9606 Homo sapiens Protocols: Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). WBS1, WBS2, WBS3, WBS4, 7dupASD1, AtWBS1 and CTL2 fibroblasts were reprogrammed using the mRNA Reprogramming kit (Stemgent), while the 7dupASD2 and CTL1R lines were reprogrammed with the microRNA Booster kit (Stemgent). The CTL3 line was reprogrammed by transfection with the STEMCCA polycistronic lentiviral vector followed by Cre-mediated excision of the integrated polycistron. 7dupASD3 and CTL4R fibroblasts were reprogrammed using the SimpliconTM RNA Reprogramming kit (Millipore). Prior to differentiation, iPSC lines were cultured on hESC-qualified Matrigel (BD Biosciences) coated plates, diluted 1:40 in DMEM/F-12 and grown in mTeSR-1 medium (StemCell Technologies). They were passaged upon treatment with Accutase (Sigma) and then plated in mTeSR-1 medium supplemented with 5μM Y-27632 (Sigma). Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). RNA was extracted using the RNeasy Micro Plus kit (Qiagen) according to manufacturer's instructions. Retrotranscribed cDNA was obtained from 0.5-1 μg of total RNA using the SuperScript VILO Retrotranscription kit (Thermo Fisher Scientific). RT-qPCR was performed on a 7500 Fast Real-Time PCR system (Applied Biosystems) using SYBR Green Master Mix (Applied Biosystems) as detecting reagent. A total cDNA amount corresponding to 15 ng of starting RNA was used for each reaction. Each sample was analyzed in triplicate and normalized to GAPDH. Relative mRNA quantity was calculated by the comparative cycle threshold (Ct) method using the formula 2-deltaCt. BAZ1B: CCTCGCAGTAAGAAAGCAAAC (forward); ACTCATCCAGCTCCTTTTGAC (reverse). 4 GAPDH: GCACCGTCAAGGCTGAGAAC (forward); AGGGATCTCGCTCCTGGAA (reverse). NR2F1: AGAAGCTCAAGGCGCTACAC (forward); GGGTACTGGCTCCTCACGTA (reverse). NR2F2: GCAAGTGGAGAAGCTCAAGG (forward); GCTTTCCACATGGGCTACAT (reverse). TFAP2A: GCCTCTCGCTCCTCAGCTCC (forward); CGTTGGCAGCTTTACGTCTCCC (reverse). SOX9: AGTACCCGCACTTGCACAAC (forward); GTAATCCGGGTGGTCCTTCT (reverse). Library preparation for RNA sequencing was performed according to TruSeq Total RNA sample preparation protocol (Illumina), starting from 250 ng - 1 μg of total RNA. cDNA library quality was assessed at an Agilent 2100 Bioanalyzer, using the High sensitivity DNA kit. ENA-FIRST-PUBLIC 2020-02-29T04:05:15Z ENA-LAST-UPDATE 2019-10-21T16:33:18Z External Id SAMEA6104721 INSDC center name Department of Oncology and Hemato-Oncology, University of Milan, Italy INSDC first public 2020-02-29T04:05:15Z INSDC last update 2019-10-21T16:33:18Z INSDC status public Submitter Id E-MTAB-8455:WBS4.scr broker name ArrayExpress cell type neural stem cell common name human developmental stage adult disease Williams syndrome genotype wild type genotype individual WBS4 organism part skin progenitor cell type induced pluripotent stem cell sample name E-MTAB-8455:WBS4.scr scientific_name Homo sapiens ERS3905402 SAMEA6104722 9606 Homo sapiens Protocols: Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). WBS1, WBS2, WBS3, WBS4, 7dupASD1, AtWBS1 and CTL2 fibroblasts were reprogrammed using the mRNA Reprogramming kit (Stemgent), while the 7dupASD2 and CTL1R lines were reprogrammed with the microRNA Booster kit (Stemgent). The CTL3 line was reprogrammed by transfection with the STEMCCA polycistronic lentiviral vector followed by Cre-mediated excision of the integrated polycistron. 7dupASD3 and CTL4R fibroblasts were reprogrammed using the SimpliconTM RNA Reprogramming kit (Millipore). Prior to differentiation, iPSC lines were cultured on hESC-qualified Matrigel (BD Biosciences) coated plates, diluted 1:40 in DMEM/F-12 and grown in mTeSR-1 medium (StemCell Technologies). They were passaged upon treatment with Accutase (Sigma) and then plated in mTeSR-1 medium supplemented with 5μM Y-27632 (Sigma). Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). RNA was extracted using the RNeasy Micro Plus kit (Qiagen) according to manufacturer's instructions. Retrotranscribed cDNA was obtained from 0.5-1 μg of total RNA using the SuperScript VILO Retrotranscription kit (Thermo Fisher Scientific). RT-qPCR was performed on a 7500 Fast Real-Time PCR system (Applied Biosystems) using SYBR Green Master Mix (Applied Biosystems) as detecting reagent. A total cDNA amount corresponding to 15 ng of starting RNA was used for each reaction. Each sample was analyzed in triplicate and normalized to GAPDH. Relative mRNA quantity was calculated by the comparative cycle threshold (Ct) method using the formula 2-deltaCt. BAZ1B: CCTCGCAGTAAGAAAGCAAAC (forward); ACTCATCCAGCTCCTTTTGAC (reverse). 4 GAPDH: GCACCGTCAAGGCTGAGAAC (forward); AGGGATCTCGCTCCTGGAA (reverse). NR2F1: AGAAGCTCAAGGCGCTACAC (forward); GGGTACTGGCTCCTCACGTA (reverse). NR2F2: GCAAGTGGAGAAGCTCAAGG (forward); GCTTTCCACATGGGCTACAT (reverse). TFAP2A: GCCTCTCGCTCCTCAGCTCC (forward); CGTTGGCAGCTTTACGTCTCCC (reverse). SOX9: AGTACCCGCACTTGCACAAC (forward); GTAATCCGGGTGGTCCTTCT (reverse). Library preparation for RNA sequencing was performed according to TruSeq Total RNA sample preparation protocol (Illumina), starting from 250 ng - 1 μg of total RNA. cDNA library quality was assessed at an Agilent 2100 Bioanalyzer, using the High sensitivity DNA kit. ENA-FIRST-PUBLIC 2020-02-29T04:05:15Z ENA-LAST-UPDATE 2019-10-21T16:33:18Z External Id SAMEA6104722 INSDC center name Department of Oncology and Hemato-Oncology, University of Milan, Italy INSDC first public 2020-02-29T04:05:15Z INSDC last update 2019-10-21T16:33:18Z INSDC status public Submitter Id E-MTAB-8455:7DupASD1.sh1 broker name ArrayExpress cell type neural stem cell common name human developmental stage adult disease 7q11.23 microduplication syndrome genotype wild type genotype individual 7DupASD1 organism part skin progenitor cell type induced pluripotent stem cell sample name E-MTAB-8455:7DupASD1.sh1 scientific_name Homo sapiens ERS3905403 SAMEA6104723 9606 Homo sapiens Protocols: Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). WBS1, WBS2, WBS3, WBS4, 7dupASD1, AtWBS1 and CTL2 fibroblasts were reprogrammed using the mRNA Reprogramming kit (Stemgent), while the 7dupASD2 and CTL1R lines were reprogrammed with the microRNA Booster kit (Stemgent). The CTL3 line was reprogrammed by transfection with the STEMCCA polycistronic lentiviral vector followed by Cre-mediated excision of the integrated polycistron. 7dupASD3 and CTL4R fibroblasts were reprogrammed using the SimpliconTM RNA Reprogramming kit (Millipore). Prior to differentiation, iPSC lines were cultured on hESC-qualified Matrigel (BD Biosciences) coated plates, diluted 1:40 in DMEM/F-12 and grown in mTeSR-1 medium (StemCell Technologies). They were passaged upon treatment with Accutase (Sigma) and then plated in mTeSR-1 medium supplemented with 5μM Y-27632 (Sigma). Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). RNA was extracted using the RNeasy Micro Plus kit (Qiagen) according to manufacturer's instructions. Retrotranscribed cDNA was obtained from 0.5-1 μg of total RNA using the SuperScript VILO Retrotranscription kit (Thermo Fisher Scientific). RT-qPCR was performed on a 7500 Fast Real-Time PCR system (Applied Biosystems) using SYBR Green Master Mix (Applied Biosystems) as detecting reagent. A total cDNA amount corresponding to 15 ng of starting RNA was used for each reaction. Each sample was analyzed in triplicate and normalized to GAPDH. Relative mRNA quantity was calculated by the comparative cycle threshold (Ct) method using the formula 2-deltaCt. BAZ1B: CCTCGCAGTAAGAAAGCAAAC (forward); ACTCATCCAGCTCCTTTTGAC (reverse). 4 GAPDH: GCACCGTCAAGGCTGAGAAC (forward); AGGGATCTCGCTCCTGGAA (reverse). NR2F1: AGAAGCTCAAGGCGCTACAC (forward); GGGTACTGGCTCCTCACGTA (reverse). NR2F2: GCAAGTGGAGAAGCTCAAGG (forward); GCTTTCCACATGGGCTACAT (reverse). TFAP2A: GCCTCTCGCTCCTCAGCTCC (forward); CGTTGGCAGCTTTACGTCTCCC (reverse). SOX9: AGTACCCGCACTTGCACAAC (forward); GTAATCCGGGTGGTCCTTCT (reverse). Library preparation for RNA sequencing was performed according to TruSeq Total RNA sample preparation protocol (Illumina), starting from 250 ng - 1 μg of total RNA. cDNA library quality was assessed at an Agilent 2100 Bioanalyzer, using the High sensitivity DNA kit. ENA-FIRST-PUBLIC 2020-02-29T04:05:15Z ENA-LAST-UPDATE 2019-10-21T16:33:18Z External Id SAMEA6104723 INSDC center name Department of Oncology and Hemato-Oncology, University of Milan, Italy INSDC first public 2020-02-29T04:05:15Z INSDC last update 2019-10-21T16:33:18Z INSDC status public Submitter Id E-MTAB-8455:7DupASD2.sh1 broker name ArrayExpress cell type neural stem cell common name human developmental stage adult disease 7q11.23 microduplication syndrome genotype wild type genotype individual 7DupASD2 organism part skin progenitor cell type induced pluripotent stem cell sample name E-MTAB-8455:7DupASD2.sh1 scientific_name Homo sapiens ERS3905404 SAMEA6104724 9606 Homo sapiens Protocols: Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). WBS1, WBS2, WBS3, WBS4, 7dupASD1, AtWBS1 and CTL2 fibroblasts were reprogrammed using the mRNA Reprogramming kit (Stemgent), while the 7dupASD2 and CTL1R lines were reprogrammed with the microRNA Booster kit (Stemgent). The CTL3 line was reprogrammed by transfection with the STEMCCA polycistronic lentiviral vector followed by Cre-mediated excision of the integrated polycistron. 7dupASD3 and CTL4R fibroblasts were reprogrammed using the SimpliconTM RNA Reprogramming kit (Millipore). Prior to differentiation, iPSC lines were cultured on hESC-qualified Matrigel (BD Biosciences) coated plates, diluted 1:40 in DMEM/F-12 and grown in mTeSR-1 medium (StemCell Technologies). They were passaged upon treatment with Accutase (Sigma) and then plated in mTeSR-1 medium supplemented with 5μM Y-27632 (Sigma). Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). RNA was extracted using the RNeasy Micro Plus kit (Qiagen) according to manufacturer's instructions. Retrotranscribed cDNA was obtained from 0.5-1 μg of total RNA using the SuperScript VILO Retrotranscription kit (Thermo Fisher Scientific). RT-qPCR was performed on a 7500 Fast Real-Time PCR system (Applied Biosystems) using SYBR Green Master Mix (Applied Biosystems) as detecting reagent. A total cDNA amount corresponding to 15 ng of starting RNA was used for each reaction. Each sample was analyzed in triplicate and normalized to GAPDH. Relative mRNA quantity was calculated by the comparative cycle threshold (Ct) method using the formula 2-deltaCt. BAZ1B: CCTCGCAGTAAGAAAGCAAAC (forward); ACTCATCCAGCTCCTTTTGAC (reverse). 4 GAPDH: GCACCGTCAAGGCTGAGAAC (forward); AGGGATCTCGCTCCTGGAA (reverse). NR2F1: AGAAGCTCAAGGCGCTACAC (forward); GGGTACTGGCTCCTCACGTA (reverse). NR2F2: GCAAGTGGAGAAGCTCAAGG (forward); GCTTTCCACATGGGCTACAT (reverse). TFAP2A: GCCTCTCGCTCCTCAGCTCC (forward); CGTTGGCAGCTTTACGTCTCCC (reverse). SOX9: AGTACCCGCACTTGCACAAC (forward); GTAATCCGGGTGGTCCTTCT (reverse). Library preparation for RNA sequencing was performed according to TruSeq Total RNA sample preparation protocol (Illumina), starting from 250 ng - 1 μg of total RNA. cDNA library quality was assessed at an Agilent 2100 Bioanalyzer, using the High sensitivity DNA kit. ENA-FIRST-PUBLIC 2020-02-29T04:05:15Z ENA-LAST-UPDATE 2019-10-21T16:33:18Z External Id SAMEA6104724 INSDC center name Department of Oncology and Hemato-Oncology, University of Milan, Italy INSDC first public 2020-02-29T04:05:15Z INSDC last update 2019-10-21T16:33:18Z INSDC status public Submitter Id E-MTAB-8455:7DupASD3.sh1 broker name ArrayExpress cell type neural stem cell common name human developmental stage adult disease 7q11.23 microduplication syndrome genotype wild type genotype individual 7DupASD3 organism part skin progenitor cell type induced pluripotent stem cell sample name E-MTAB-8455:7DupASD3.sh1 scientific_name Homo sapiens ERS3905405 SAMEA6104725 9606 Homo sapiens Protocols: Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). WBS1, WBS2, WBS3, WBS4, 7dupASD1, AtWBS1 and CTL2 fibroblasts were reprogrammed using the mRNA Reprogramming kit (Stemgent), while the 7dupASD2 and CTL1R lines were reprogrammed with the microRNA Booster kit (Stemgent). The CTL3 line was reprogrammed by transfection with the STEMCCA polycistronic lentiviral vector followed by Cre-mediated excision of the integrated polycistron. 7dupASD3 and CTL4R fibroblasts were reprogrammed using the SimpliconTM RNA Reprogramming kit (Millipore). Prior to differentiation, iPSC lines were cultured on hESC-qualified Matrigel (BD Biosciences) coated plates, diluted 1:40 in DMEM/F-12 and grown in mTeSR-1 medium (StemCell Technologies). They were passaged upon treatment with Accutase (Sigma) and then plated in mTeSR-1 medium supplemented with 5μM Y-27632 (Sigma). Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). RNA was extracted using the RNeasy Micro Plus kit (Qiagen) according to manufacturer's instructions. Retrotranscribed cDNA was obtained from 0.5-1 μg of total RNA using the SuperScript VILO Retrotranscription kit (Thermo Fisher Scientific). RT-qPCR was performed on a 7500 Fast Real-Time PCR system (Applied Biosystems) using SYBR Green Master Mix (Applied Biosystems) as detecting reagent. A total cDNA amount corresponding to 15 ng of starting RNA was used for each reaction. Each sample was analyzed in triplicate and normalized to GAPDH. Relative mRNA quantity was calculated by the comparative cycle threshold (Ct) method using the formula 2-deltaCt. BAZ1B: CCTCGCAGTAAGAAAGCAAAC (forward); ACTCATCCAGCTCCTTTTGAC (reverse). 4 GAPDH: GCACCGTCAAGGCTGAGAAC (forward); AGGGATCTCGCTCCTGGAA (reverse). NR2F1: AGAAGCTCAAGGCGCTACAC (forward); GGGTACTGGCTCCTCACGTA (reverse). NR2F2: GCAAGTGGAGAAGCTCAAGG (forward); GCTTTCCACATGGGCTACAT (reverse). TFAP2A: GCCTCTCGCTCCTCAGCTCC (forward); CGTTGGCAGCTTTACGTCTCCC (reverse). SOX9: AGTACCCGCACTTGCACAAC (forward); GTAATCCGGGTGGTCCTTCT (reverse). Library preparation for RNA sequencing was performed according to TruSeq Total RNA sample preparation protocol (Illumina), starting from 250 ng - 1 μg of total RNA. cDNA library quality was assessed at an Agilent 2100 Bioanalyzer, using the High sensitivity DNA kit. ENA-FIRST-PUBLIC 2020-02-29T04:05:15Z ENA-LAST-UPDATE 2019-10-21T16:33:18Z External Id SAMEA6104725 INSDC center name Department of Oncology and Hemato-Oncology, University of Milan, Italy INSDC first public 2020-02-29T04:05:15Z INSDC last update 2019-10-21T16:33:18Z INSDC status public Submitter Id E-MTAB-8455:AtWBS1.sh1 broker name ArrayExpress cell type neural stem cell common name human developmental stage adult disease Williams syndrome genotype wild type genotype individual AtWBS1 organism part skin progenitor cell type induced pluripotent stem cell sample name E-MTAB-8455:AtWBS1.sh1 scientific_name Homo sapiens ERS3905406 SAMEA6104726 9606 Homo sapiens Protocols: Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). WBS1, WBS2, WBS3, WBS4, 7dupASD1, AtWBS1 and CTL2 fibroblasts were reprogrammed using the mRNA Reprogramming kit (Stemgent), while the 7dupASD2 and CTL1R lines were reprogrammed with the microRNA Booster kit (Stemgent). The CTL3 line was reprogrammed by transfection with the STEMCCA polycistronic lentiviral vector followed by Cre-mediated excision of the integrated polycistron. 7dupASD3 and CTL4R fibroblasts were reprogrammed using the SimpliconTM RNA Reprogramming kit (Millipore). Prior to differentiation, iPSC lines were cultured on hESC-qualified Matrigel (BD Biosciences) coated plates, diluted 1:40 in DMEM/F-12 and grown in mTeSR-1 medium (StemCell Technologies). They were passaged upon treatment with Accutase (Sigma) and then plated in mTeSR-1 medium supplemented with 5μM Y-27632 (Sigma). Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). RNA was extracted using the RNeasy Micro Plus kit (Qiagen) according to manufacturer's instructions. Retrotranscribed cDNA was obtained from 0.5-1 μg of total RNA using the SuperScript VILO Retrotranscription kit (Thermo Fisher Scientific). RT-qPCR was performed on a 7500 Fast Real-Time PCR system (Applied Biosystems) using SYBR Green Master Mix (Applied Biosystems) as detecting reagent. A total cDNA amount corresponding to 15 ng of starting RNA was used for each reaction. Each sample was analyzed in triplicate and normalized to GAPDH. Relative mRNA quantity was calculated by the comparative cycle threshold (Ct) method using the formula 2-deltaCt. BAZ1B: CCTCGCAGTAAGAAAGCAAAC (forward); ACTCATCCAGCTCCTTTTGAC (reverse). 4 GAPDH: GCACCGTCAAGGCTGAGAAC (forward); AGGGATCTCGCTCCTGGAA (reverse). NR2F1: AGAAGCTCAAGGCGCTACAC (forward); GGGTACTGGCTCCTCACGTA (reverse). NR2F2: GCAAGTGGAGAAGCTCAAGG (forward); GCTTTCCACATGGGCTACAT (reverse). TFAP2A: GCCTCTCGCTCCTCAGCTCC (forward); CGTTGGCAGCTTTACGTCTCCC (reverse). SOX9: AGTACCCGCACTTGCACAAC (forward); GTAATCCGGGTGGTCCTTCT (reverse). Library preparation for RNA sequencing was performed according to TruSeq Total RNA sample preparation protocol (Illumina), starting from 250 ng - 1 μg of total RNA. cDNA library quality was assessed at an Agilent 2100 Bioanalyzer, using the High sensitivity DNA kit. ENA-FIRST-PUBLIC 2020-02-29T04:05:15Z ENA-LAST-UPDATE 2019-10-21T16:33:18Z External Id SAMEA6104726 INSDC center name Department of Oncology and Hemato-Oncology, University of Milan, Italy INSDC first public 2020-02-29T04:05:15Z INSDC last update 2019-10-21T16:33:18Z INSDC status public Submitter Id E-MTAB-8455:CTL1.sh1 broker name ArrayExpress cell type neural stem cell common name human developmental stage adult disease normal genotype wild type genotype individual CTL1 organism part skin progenitor cell type induced pluripotent stem cell sample name E-MTAB-8455:CTL1.sh1 scientific_name Homo sapiens ERS3905407 SAMEA6104727 9606 Homo sapiens Protocols: Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). WBS1, WBS2, WBS3, WBS4, 7dupASD1, AtWBS1 and CTL2 fibroblasts were reprogrammed using the mRNA Reprogramming kit (Stemgent), while the 7dupASD2 and CTL1R lines were reprogrammed with the microRNA Booster kit (Stemgent). The CTL3 line was reprogrammed by transfection with the STEMCCA polycistronic lentiviral vector followed by Cre-mediated excision of the integrated polycistron. 7dupASD3 and CTL4R fibroblasts were reprogrammed using the SimpliconTM RNA Reprogramming kit (Millipore). Prior to differentiation, iPSC lines were cultured on hESC-qualified Matrigel (BD Biosciences) coated plates, diluted 1:40 in DMEM/F-12 and grown in mTeSR-1 medium (StemCell Technologies). They were passaged upon treatment with Accutase (Sigma) and then plated in mTeSR-1 medium supplemented with 5μM Y-27632 (Sigma). Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). RNA was extracted using the RNeasy Micro Plus kit (Qiagen) according to manufacturer's instructions. Retrotranscribed cDNA was obtained from 0.5-1 μg of total RNA using the SuperScript VILO Retrotranscription kit (Thermo Fisher Scientific). RT-qPCR was performed on a 7500 Fast Real-Time PCR system (Applied Biosystems) using SYBR Green Master Mix (Applied Biosystems) as detecting reagent. A total cDNA amount corresponding to 15 ng of starting RNA was used for each reaction. Each sample was analyzed in triplicate and normalized to GAPDH. Relative mRNA quantity was calculated by the comparative cycle threshold (Ct) method using the formula 2-deltaCt. BAZ1B: CCTCGCAGTAAGAAAGCAAAC (forward); ACTCATCCAGCTCCTTTTGAC (reverse). 4 GAPDH: GCACCGTCAAGGCTGAGAAC (forward); AGGGATCTCGCTCCTGGAA (reverse). NR2F1: AGAAGCTCAAGGCGCTACAC (forward); GGGTACTGGCTCCTCACGTA (reverse). NR2F2: GCAAGTGGAGAAGCTCAAGG (forward); GCTTTCCACATGGGCTACAT (reverse). TFAP2A: GCCTCTCGCTCCTCAGCTCC (forward); CGTTGGCAGCTTTACGTCTCCC (reverse). SOX9: AGTACCCGCACTTGCACAAC (forward); GTAATCCGGGTGGTCCTTCT (reverse). Library preparation for RNA sequencing was performed according to TruSeq Total RNA sample preparation protocol (Illumina), starting from 250 ng - 1 μg of total RNA. cDNA library quality was assessed at an Agilent 2100 Bioanalyzer, using the High sensitivity DNA kit. ENA-FIRST-PUBLIC 2020-02-29T04:05:15Z ENA-LAST-UPDATE 2019-10-21T16:33:18Z External Id SAMEA6104727 INSDC center name Department of Oncology and Hemato-Oncology, University of Milan, Italy INSDC first public 2020-02-29T04:05:15Z INSDC last update 2019-10-21T16:33:18Z INSDC status public Submitter Id E-MTAB-8455:CTL2.sh1 broker name ArrayExpress cell type neural stem cell common name human developmental stage adult disease normal genotype wild type genotype individual CTL2 organism part skin progenitor cell type induced pluripotent stem cell sample name E-MTAB-8455:CTL2.sh1 scientific_name Homo sapiens ERS3905408 SAMEA6104728 9606 Homo sapiens Protocols: Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). WBS1, WBS2, WBS3, WBS4, 7dupASD1, AtWBS1 and CTL2 fibroblasts were reprogrammed using the mRNA Reprogramming kit (Stemgent), while the 7dupASD2 and CTL1R lines were reprogrammed with the microRNA Booster kit (Stemgent). The CTL3 line was reprogrammed by transfection with the STEMCCA polycistronic lentiviral vector followed by Cre-mediated excision of the integrated polycistron. 7dupASD3 and CTL4R fibroblasts were reprogrammed using the SimpliconTM RNA Reprogramming kit (Millipore). Prior to differentiation, iPSC lines were cultured on hESC-qualified Matrigel (BD Biosciences) coated plates, diluted 1:40 in DMEM/F-12 and grown in mTeSR-1 medium (StemCell Technologies). They were passaged upon treatment with Accutase (Sigma) and then plated in mTeSR-1 medium supplemented with 5μM Y-27632 (Sigma). Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). RNA was extracted using the RNeasy Micro Plus kit (Qiagen) according to manufacturer's instructions. Retrotranscribed cDNA was obtained from 0.5-1 μg of total RNA using the SuperScript VILO Retrotranscription kit (Thermo Fisher Scientific). RT-qPCR was performed on a 7500 Fast Real-Time PCR system (Applied Biosystems) using SYBR Green Master Mix (Applied Biosystems) as detecting reagent. A total cDNA amount corresponding to 15 ng of starting RNA was used for each reaction. Each sample was analyzed in triplicate and normalized to GAPDH. Relative mRNA quantity was calculated by the comparative cycle threshold (Ct) method using the formula 2-deltaCt. BAZ1B: CCTCGCAGTAAGAAAGCAAAC (forward); ACTCATCCAGCTCCTTTTGAC (reverse). 4 GAPDH: GCACCGTCAAGGCTGAGAAC (forward); AGGGATCTCGCTCCTGGAA (reverse). NR2F1: AGAAGCTCAAGGCGCTACAC (forward); GGGTACTGGCTCCTCACGTA (reverse). NR2F2: GCAAGTGGAGAAGCTCAAGG (forward); GCTTTCCACATGGGCTACAT (reverse). TFAP2A: GCCTCTCGCTCCTCAGCTCC (forward); CGTTGGCAGCTTTACGTCTCCC (reverse). SOX9: AGTACCCGCACTTGCACAAC (forward); GTAATCCGGGTGGTCCTTCT (reverse). Library preparation for RNA sequencing was performed according to TruSeq Total RNA sample preparation protocol (Illumina), starting from 250 ng - 1 μg of total RNA. cDNA library quality was assessed at an Agilent 2100 Bioanalyzer, using the High sensitivity DNA kit. ENA-FIRST-PUBLIC 2020-02-29T04:05:15Z ENA-LAST-UPDATE 2019-10-21T16:33:18Z External Id SAMEA6104728 INSDC center name Department of Oncology and Hemato-Oncology, University of Milan, Italy INSDC first public 2020-02-29T04:05:15Z INSDC last update 2019-10-21T16:33:18Z INSDC status public Submitter Id E-MTAB-8455:CTL4.sh1 broker name ArrayExpress cell type neural stem cell common name human developmental stage adult disease normal genotype wild type genotype individual CTL4 organism part skin progenitor cell type induced pluripotent stem cell sample name E-MTAB-8455:CTL4.sh1 scientific_name Homo sapiens ERS3905409 SAMEA6104729 9606 Homo sapiens Protocols: Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). WBS1, WBS2, WBS3, WBS4, 7dupASD1, AtWBS1 and CTL2 fibroblasts were reprogrammed using the mRNA Reprogramming kit (Stemgent), while the 7dupASD2 and CTL1R lines were reprogrammed with the microRNA Booster kit (Stemgent). The CTL3 line was reprogrammed by transfection with the STEMCCA polycistronic lentiviral vector followed by Cre-mediated excision of the integrated polycistron. 7dupASD3 and CTL4R fibroblasts were reprogrammed using the SimpliconTM RNA Reprogramming kit (Millipore). Prior to differentiation, iPSC lines were cultured on hESC-qualified Matrigel (BD Biosciences) coated plates, diluted 1:40 in DMEM/F-12 and grown in mTeSR-1 medium (StemCell Technologies). They were passaged upon treatment with Accutase (Sigma) and then plated in mTeSR-1 medium supplemented with 5μM Y-27632 (Sigma). Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). RNA was extracted using the RNeasy Micro Plus kit (Qiagen) according to manufacturer's instructions. Retrotranscribed cDNA was obtained from 0.5-1 μg of total RNA using the SuperScript VILO Retrotranscription kit (Thermo Fisher Scientific). RT-qPCR was performed on a 7500 Fast Real-Time PCR system (Applied Biosystems) using SYBR Green Master Mix (Applied Biosystems) as detecting reagent. A total cDNA amount corresponding to 15 ng of starting RNA was used for each reaction. Each sample was analyzed in triplicate and normalized to GAPDH. Relative mRNA quantity was calculated by the comparative cycle threshold (Ct) method using the formula 2-deltaCt. BAZ1B: CCTCGCAGTAAGAAAGCAAAC (forward); ACTCATCCAGCTCCTTTTGAC (reverse). 4 GAPDH: GCACCGTCAAGGCTGAGAAC (forward); AGGGATCTCGCTCCTGGAA (reverse). NR2F1: AGAAGCTCAAGGCGCTACAC (forward); GGGTACTGGCTCCTCACGTA (reverse). NR2F2: GCAAGTGGAGAAGCTCAAGG (forward); GCTTTCCACATGGGCTACAT (reverse). TFAP2A: GCCTCTCGCTCCTCAGCTCC (forward); CGTTGGCAGCTTTACGTCTCCC (reverse). SOX9: AGTACCCGCACTTGCACAAC (forward); GTAATCCGGGTGGTCCTTCT (reverse). Library preparation for RNA sequencing was performed according to TruSeq Total RNA sample preparation protocol (Illumina), starting from 250 ng - 1 μg of total RNA. cDNA library quality was assessed at an Agilent 2100 Bioanalyzer, using the High sensitivity DNA kit. ENA-FIRST-PUBLIC 2020-02-29T04:05:15Z ENA-LAST-UPDATE 2019-10-21T16:33:18Z External Id SAMEA6104729 INSDC center name Department of Oncology and Hemato-Oncology, University of Milan, Italy INSDC first public 2020-02-29T04:05:15Z INSDC last update 2019-10-21T16:33:18Z INSDC status public Submitter Id E-MTAB-8455:WBS1.sh1 broker name ArrayExpress cell type neural stem cell common name human developmental stage adult disease Williams syndrome genotype wild type genotype individual WBS1 organism part skin progenitor cell type induced pluripotent stem cell sample name E-MTAB-8455:WBS1.sh1 scientific_name Homo sapiens ERS3905410 SAMEA6104730 9606 Homo sapiens Protocols: Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). WBS1, WBS2, WBS3, WBS4, 7dupASD1, AtWBS1 and CTL2 fibroblasts were reprogrammed using the mRNA Reprogramming kit (Stemgent), while the 7dupASD2 and CTL1R lines were reprogrammed with the microRNA Booster kit (Stemgent). The CTL3 line was reprogrammed by transfection with the STEMCCA polycistronic lentiviral vector followed by Cre-mediated excision of the integrated polycistron. 7dupASD3 and CTL4R fibroblasts were reprogrammed using the SimpliconTM RNA Reprogramming kit (Millipore). Prior to differentiation, iPSC lines were cultured on hESC-qualified Matrigel (BD Biosciences) coated plates, diluted 1:40 in DMEM/F-12 and grown in mTeSR-1 medium (StemCell Technologies). They were passaged upon treatment with Accutase (Sigma) and then plated in mTeSR-1 medium supplemented with 5μM Y-27632 (Sigma). Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). RNA was extracted using the RNeasy Micro Plus kit (Qiagen) according to manufacturer's instructions. Retrotranscribed cDNA was obtained from 0.5-1 μg of total RNA using the SuperScript VILO Retrotranscription kit (Thermo Fisher Scientific). RT-qPCR was performed on a 7500 Fast Real-Time PCR system (Applied Biosystems) using SYBR Green Master Mix (Applied Biosystems) as detecting reagent. A total cDNA amount corresponding to 15 ng of starting RNA was used for each reaction. Each sample was analyzed in triplicate and normalized to GAPDH. Relative mRNA quantity was calculated by the comparative cycle threshold (Ct) method using the formula 2-deltaCt. BAZ1B: CCTCGCAGTAAGAAAGCAAAC (forward); ACTCATCCAGCTCCTTTTGAC (reverse). 4 GAPDH: GCACCGTCAAGGCTGAGAAC (forward); AGGGATCTCGCTCCTGGAA (reverse). NR2F1: AGAAGCTCAAGGCGCTACAC (forward); GGGTACTGGCTCCTCACGTA (reverse). NR2F2: GCAAGTGGAGAAGCTCAAGG (forward); GCTTTCCACATGGGCTACAT (reverse). TFAP2A: GCCTCTCGCTCCTCAGCTCC (forward); CGTTGGCAGCTTTACGTCTCCC (reverse). SOX9: AGTACCCGCACTTGCACAAC (forward); GTAATCCGGGTGGTCCTTCT (reverse). Library preparation for RNA sequencing was performed according to TruSeq Total RNA sample preparation protocol (Illumina), starting from 250 ng - 1 μg of total RNA. cDNA library quality was assessed at an Agilent 2100 Bioanalyzer, using the High sensitivity DNA kit. ENA-FIRST-PUBLIC 2020-02-29T04:05:15Z ENA-LAST-UPDATE 2019-10-21T16:33:18Z External Id SAMEA6104730 INSDC center name Department of Oncology and Hemato-Oncology, University of Milan, Italy INSDC first public 2020-02-29T04:05:15Z INSDC last update 2019-10-21T16:33:18Z INSDC status public Submitter Id E-MTAB-8455:WBS2.sh1 broker name ArrayExpress cell type neural stem cell common name human developmental stage adult disease Williams syndrome genotype wild type genotype individual WBS2 organism part skin progenitor cell type induced pluripotent stem cell sample name E-MTAB-8455:WBS2.sh1 scientific_name Homo sapiens ERS3905411 SAMEA6104731 9606 Homo sapiens Protocols: Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). WBS1, WBS2, WBS3, WBS4, 7dupASD1, AtWBS1 and CTL2 fibroblasts were reprogrammed using the mRNA Reprogramming kit (Stemgent), while the 7dupASD2 and CTL1R lines were reprogrammed with the microRNA Booster kit (Stemgent). The CTL3 line was reprogrammed by transfection with the STEMCCA polycistronic lentiviral vector followed by Cre-mediated excision of the integrated polycistron. 7dupASD3 and CTL4R fibroblasts were reprogrammed using the SimpliconTM RNA Reprogramming kit (Millipore). Prior to differentiation, iPSC lines were cultured on hESC-qualified Matrigel (BD Biosciences) coated plates, diluted 1:40 in DMEM/F-12 and grown in mTeSR-1 medium (StemCell Technologies). They were passaged upon treatment with Accutase (Sigma) and then plated in mTeSR-1 medium supplemented with 5μM Y-27632 (Sigma). Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). RNA was extracted using the RNeasy Micro Plus kit (Qiagen) according to manufacturer's instructions. Retrotranscribed cDNA was obtained from 0.5-1 μg of total RNA using the SuperScript VILO Retrotranscription kit (Thermo Fisher Scientific). RT-qPCR was performed on a 7500 Fast Real-Time PCR system (Applied Biosystems) using SYBR Green Master Mix (Applied Biosystems) as detecting reagent. A total cDNA amount corresponding to 15 ng of starting RNA was used for each reaction. Each sample was analyzed in triplicate and normalized to GAPDH. Relative mRNA quantity was calculated by the comparative cycle threshold (Ct) method using the formula 2-deltaCt. BAZ1B: CCTCGCAGTAAGAAAGCAAAC (forward); ACTCATCCAGCTCCTTTTGAC (reverse). 4 GAPDH: GCACCGTCAAGGCTGAGAAC (forward); AGGGATCTCGCTCCTGGAA (reverse). NR2F1: AGAAGCTCAAGGCGCTACAC (forward); GGGTACTGGCTCCTCACGTA (reverse). NR2F2: GCAAGTGGAGAAGCTCAAGG (forward); GCTTTCCACATGGGCTACAT (reverse). TFAP2A: GCCTCTCGCTCCTCAGCTCC (forward); CGTTGGCAGCTTTACGTCTCCC (reverse). SOX9: AGTACCCGCACTTGCACAAC (forward); GTAATCCGGGTGGTCCTTCT (reverse). Library preparation for RNA sequencing was performed according to TruSeq Total RNA sample preparation protocol (Illumina), starting from 250 ng - 1 μg of total RNA. cDNA library quality was assessed at an Agilent 2100 Bioanalyzer, using the High sensitivity DNA kit. ENA-FIRST-PUBLIC 2020-02-29T04:05:15Z ENA-LAST-UPDATE 2019-10-21T16:33:18Z External Id SAMEA6104731 INSDC center name Department of Oncology and Hemato-Oncology, University of Milan, Italy INSDC first public 2020-02-29T04:05:15Z INSDC last update 2019-10-21T16:33:18Z INSDC status public Submitter Id E-MTAB-8455:WBS4.sh1 broker name ArrayExpress cell type neural stem cell common name human developmental stage adult disease Williams syndrome genotype wild type genotype individual WBS4 organism part skin progenitor cell type induced pluripotent stem cell sample name E-MTAB-8455:WBS4.sh1 scientific_name Homo sapiens ERS3905412 SAMEA6104732 9606 Homo sapiens Protocols: Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). WBS1, WBS2, WBS3, WBS4, 7dupASD1, AtWBS1 and CTL2 fibroblasts were reprogrammed using the mRNA Reprogramming kit (Stemgent), while the 7dupASD2 and CTL1R lines were reprogrammed with the microRNA Booster kit (Stemgent). The CTL3 line was reprogrammed by transfection with the STEMCCA polycistronic lentiviral vector followed by Cre-mediated excision of the integrated polycistron. 7dupASD3 and CTL4R fibroblasts were reprogrammed using the SimpliconTM RNA Reprogramming kit (Millipore). Prior to differentiation, iPSC lines were cultured on hESC-qualified Matrigel (BD Biosciences) coated plates, diluted 1:40 in DMEM/F-12 and grown in mTeSR-1 medium (StemCell Technologies). They were passaged upon treatment with Accutase (Sigma) and then plated in mTeSR-1 medium supplemented with 5μM Y-27632 (Sigma). Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). RNA was extracted using the RNeasy Micro Plus kit (Qiagen) according to manufacturer's instructions. Retrotranscribed cDNA was obtained from 0.5-1 μg of total RNA using the SuperScript VILO Retrotranscription kit (Thermo Fisher Scientific). RT-qPCR was performed on a 7500 Fast Real-Time PCR system (Applied Biosystems) using SYBR Green Master Mix (Applied Biosystems) as detecting reagent. A total cDNA amount corresponding to 15 ng of starting RNA was used for each reaction. Each sample was analyzed in triplicate and normalized to GAPDH. Relative mRNA quantity was calculated by the comparative cycle threshold (Ct) method using the formula 2-deltaCt. BAZ1B: CCTCGCAGTAAGAAAGCAAAC (forward); ACTCATCCAGCTCCTTTTGAC (reverse). 4 GAPDH: GCACCGTCAAGGCTGAGAAC (forward); AGGGATCTCGCTCCTGGAA (reverse). NR2F1: AGAAGCTCAAGGCGCTACAC (forward); GGGTACTGGCTCCTCACGTA (reverse). NR2F2: GCAAGTGGAGAAGCTCAAGG (forward); GCTTTCCACATGGGCTACAT (reverse). TFAP2A: GCCTCTCGCTCCTCAGCTCC (forward); CGTTGGCAGCTTTACGTCTCCC (reverse). SOX9: AGTACCCGCACTTGCACAAC (forward); GTAATCCGGGTGGTCCTTCT (reverse). Library preparation for RNA sequencing was performed according to TruSeq Total RNA sample preparation protocol (Illumina), starting from 250 ng - 1 μg of total RNA. cDNA library quality was assessed at an Agilent 2100 Bioanalyzer, using the High sensitivity DNA kit. ENA-FIRST-PUBLIC 2020-02-29T04:05:15Z ENA-LAST-UPDATE 2019-10-21T16:33:18Z External Id SAMEA6104732 INSDC center name Department of Oncology and Hemato-Oncology, University of Milan, Italy INSDC first public 2020-02-29T04:05:15Z INSDC last update 2019-10-21T16:33:18Z INSDC status public Submitter Id E-MTAB-8455:7DupASD1.sh2 broker name ArrayExpress cell type neural stem cell common name human developmental stage adult disease 7q11.23 microduplication syndrome genotype wild type genotype individual 7DupASD1 organism part skin progenitor cell type induced pluripotent stem cell sample name E-MTAB-8455:7DupASD1.sh2 scientific_name Homo sapiens ERS3905413 SAMEA6104733 9606 Homo sapiens Protocols: Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). WBS1, WBS2, WBS3, WBS4, 7dupASD1, AtWBS1 and CTL2 fibroblasts were reprogrammed using the mRNA Reprogramming kit (Stemgent), while the 7dupASD2 and CTL1R lines were reprogrammed with the microRNA Booster kit (Stemgent). The CTL3 line was reprogrammed by transfection with the STEMCCA polycistronic lentiviral vector followed by Cre-mediated excision of the integrated polycistron. 7dupASD3 and CTL4R fibroblasts were reprogrammed using the SimpliconTM RNA Reprogramming kit (Millipore). Prior to differentiation, iPSC lines were cultured on hESC-qualified Matrigel (BD Biosciences) coated plates, diluted 1:40 in DMEM/F-12 and grown in mTeSR-1 medium (StemCell Technologies). They were passaged upon treatment with Accutase (Sigma) and then plated in mTeSR-1 medium supplemented with 5μM Y-27632 (Sigma). Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). RNA was extracted using the RNeasy Micro Plus kit (Qiagen) according to manufacturer's instructions. Retrotranscribed cDNA was obtained from 0.5-1 μg of total RNA using the SuperScript VILO Retrotranscription kit (Thermo Fisher Scientific). RT-qPCR was performed on a 7500 Fast Real-Time PCR system (Applied Biosystems) using SYBR Green Master Mix (Applied Biosystems) as detecting reagent. A total cDNA amount corresponding to 15 ng of starting RNA was used for each reaction. Each sample was analyzed in triplicate and normalized to GAPDH. Relative mRNA quantity was calculated by the comparative cycle threshold (Ct) method using the formula 2-deltaCt. BAZ1B: CCTCGCAGTAAGAAAGCAAAC (forward); ACTCATCCAGCTCCTTTTGAC (reverse). 4 GAPDH: GCACCGTCAAGGCTGAGAAC (forward); AGGGATCTCGCTCCTGGAA (reverse). NR2F1: AGAAGCTCAAGGCGCTACAC (forward); GGGTACTGGCTCCTCACGTA (reverse). NR2F2: GCAAGTGGAGAAGCTCAAGG (forward); GCTTTCCACATGGGCTACAT (reverse). TFAP2A: GCCTCTCGCTCCTCAGCTCC (forward); CGTTGGCAGCTTTACGTCTCCC (reverse). SOX9: AGTACCCGCACTTGCACAAC (forward); GTAATCCGGGTGGTCCTTCT (reverse). Library preparation for RNA sequencing was performed according to TruSeq Total RNA sample preparation protocol (Illumina), starting from 250 ng - 1 μg of total RNA. cDNA library quality was assessed at an Agilent 2100 Bioanalyzer, using the High sensitivity DNA kit. ENA-FIRST-PUBLIC 2020-02-29T04:05:15Z ENA-LAST-UPDATE 2019-10-21T16:33:18Z External Id SAMEA6104733 INSDC center name Department of Oncology and Hemato-Oncology, University of Milan, Italy INSDC first public 2020-02-29T04:05:15Z INSDC last update 2019-10-21T16:33:18Z INSDC status public Submitter Id E-MTAB-8455:7DupASD2.sh2 broker name ArrayExpress cell type neural stem cell common name human developmental stage adult disease 7q11.23 microduplication syndrome genotype wild type genotype individual 7DupASD2 organism part skin progenitor cell type induced pluripotent stem cell sample name E-MTAB-8455:7DupASD2.sh2 scientific_name Homo sapiens ERS3905414 SAMEA6104734 9606 Homo sapiens Protocols: Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). WBS1, WBS2, WBS3, WBS4, 7dupASD1, AtWBS1 and CTL2 fibroblasts were reprogrammed using the mRNA Reprogramming kit (Stemgent), while the 7dupASD2 and CTL1R lines were reprogrammed with the microRNA Booster kit (Stemgent). The CTL3 line was reprogrammed by transfection with the STEMCCA polycistronic lentiviral vector followed by Cre-mediated excision of the integrated polycistron. 7dupASD3 and CTL4R fibroblasts were reprogrammed using the SimpliconTM RNA Reprogramming kit (Millipore). Prior to differentiation, iPSC lines were cultured on hESC-qualified Matrigel (BD Biosciences) coated plates, diluted 1:40 in DMEM/F-12 and grown in mTeSR-1 medium (StemCell Technologies). They were passaged upon treatment with Accutase (Sigma) and then plated in mTeSR-1 medium supplemented with 5μM Y-27632 (Sigma). Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). RNA was extracted using the RNeasy Micro Plus kit (Qiagen) according to manufacturer's instructions. Retrotranscribed cDNA was obtained from 0.5-1 μg of total RNA using the SuperScript VILO Retrotranscription kit (Thermo Fisher Scientific). RT-qPCR was performed on a 7500 Fast Real-Time PCR system (Applied Biosystems) using SYBR Green Master Mix (Applied Biosystems) as detecting reagent. A total cDNA amount corresponding to 15 ng of starting RNA was used for each reaction. Each sample was analyzed in triplicate and normalized to GAPDH. Relative mRNA quantity was calculated by the comparative cycle threshold (Ct) method using the formula 2-deltaCt. BAZ1B: CCTCGCAGTAAGAAAGCAAAC (forward); ACTCATCCAGCTCCTTTTGAC (reverse). 4 GAPDH: GCACCGTCAAGGCTGAGAAC (forward); AGGGATCTCGCTCCTGGAA (reverse). NR2F1: AGAAGCTCAAGGCGCTACAC (forward); GGGTACTGGCTCCTCACGTA (reverse). NR2F2: GCAAGTGGAGAAGCTCAAGG (forward); GCTTTCCACATGGGCTACAT (reverse). TFAP2A: GCCTCTCGCTCCTCAGCTCC (forward); CGTTGGCAGCTTTACGTCTCCC (reverse). SOX9: AGTACCCGCACTTGCACAAC (forward); GTAATCCGGGTGGTCCTTCT (reverse). Library preparation for RNA sequencing was performed according to TruSeq Total RNA sample preparation protocol (Illumina), starting from 250 ng - 1 μg of total RNA. cDNA library quality was assessed at an Agilent 2100 Bioanalyzer, using the High sensitivity DNA kit. ENA-FIRST-PUBLIC 2020-02-29T04:05:15Z ENA-LAST-UPDATE 2019-10-21T16:33:18Z External Id SAMEA6104734 INSDC center name Department of Oncology and Hemato-Oncology, University of Milan, Italy INSDC first public 2020-02-29T04:05:15Z INSDC last update 2019-10-21T16:33:18Z INSDC status public Submitter Id E-MTAB-8455:7DupASD3.sh2 broker name ArrayExpress cell type neural stem cell common name human developmental stage adult disease 7q11.23 microduplication syndrome genotype wild type genotype individual 7DupASD3 organism part skin progenitor cell type induced pluripotent stem cell sample name E-MTAB-8455:7DupASD3.sh2 scientific_name Homo sapiens ERS3905415 SAMEA6104735 9606 Homo sapiens Protocols: Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). WBS1, WBS2, WBS3, WBS4, 7dupASD1, AtWBS1 and CTL2 fibroblasts were reprogrammed using the mRNA Reprogramming kit (Stemgent), while the 7dupASD2 and CTL1R lines were reprogrammed with the microRNA Booster kit (Stemgent). The CTL3 line was reprogrammed by transfection with the STEMCCA polycistronic lentiviral vector followed by Cre-mediated excision of the integrated polycistron. 7dupASD3 and CTL4R fibroblasts were reprogrammed using the SimpliconTM RNA Reprogramming kit (Millipore). Prior to differentiation, iPSC lines were cultured on hESC-qualified Matrigel (BD Biosciences) coated plates, diluted 1:40 in DMEM/F-12 and grown in mTeSR-1 medium (StemCell Technologies). They were passaged upon treatment with Accutase (Sigma) and then plated in mTeSR-1 medium supplemented with 5μM Y-27632 (Sigma). Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). RNA was extracted using the RNeasy Micro Plus kit (Qiagen) according to manufacturer's instructions. Retrotranscribed cDNA was obtained from 0.5-1 μg of total RNA using the SuperScript VILO Retrotranscription kit (Thermo Fisher Scientific). RT-qPCR was performed on a 7500 Fast Real-Time PCR system (Applied Biosystems) using SYBR Green Master Mix (Applied Biosystems) as detecting reagent. A total cDNA amount corresponding to 15 ng of starting RNA was used for each reaction. Each sample was analyzed in triplicate and normalized to GAPDH. Relative mRNA quantity was calculated by the comparative cycle threshold (Ct) method using the formula 2-deltaCt. BAZ1B: CCTCGCAGTAAGAAAGCAAAC (forward); ACTCATCCAGCTCCTTTTGAC (reverse). 4 GAPDH: GCACCGTCAAGGCTGAGAAC (forward); AGGGATCTCGCTCCTGGAA (reverse). NR2F1: AGAAGCTCAAGGCGCTACAC (forward); GGGTACTGGCTCCTCACGTA (reverse). NR2F2: GCAAGTGGAGAAGCTCAAGG (forward); GCTTTCCACATGGGCTACAT (reverse). TFAP2A: GCCTCTCGCTCCTCAGCTCC (forward); CGTTGGCAGCTTTACGTCTCCC (reverse). SOX9: AGTACCCGCACTTGCACAAC (forward); GTAATCCGGGTGGTCCTTCT (reverse). Library preparation for RNA sequencing was performed according to TruSeq Total RNA sample preparation protocol (Illumina), starting from 250 ng - 1 μg of total RNA. cDNA library quality was assessed at an Agilent 2100 Bioanalyzer, using the High sensitivity DNA kit. ENA-FIRST-PUBLIC 2020-02-29T04:05:15Z ENA-LAST-UPDATE 2019-10-21T16:33:18Z External Id SAMEA6104735 INSDC center name Department of Oncology and Hemato-Oncology, University of Milan, Italy INSDC first public 2020-02-29T04:05:15Z INSDC last update 2019-10-21T16:33:18Z INSDC status public Submitter Id E-MTAB-8455:AtWBS1.sh2 broker name ArrayExpress cell type neural stem cell common name human developmental stage adult disease Williams syndrome genotype wild type genotype individual AtWBS1 organism part skin progenitor cell type induced pluripotent stem cell sample name E-MTAB-8455:AtWBS1.sh2 scientific_name Homo sapiens ERS3905416 SAMEA6104736 9606 Homo sapiens Protocols: Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). WBS1, WBS2, WBS3, WBS4, 7dupASD1, AtWBS1 and CTL2 fibroblasts were reprogrammed using the mRNA Reprogramming kit (Stemgent), while the 7dupASD2 and CTL1R lines were reprogrammed with the microRNA Booster kit (Stemgent). The CTL3 line was reprogrammed by transfection with the STEMCCA polycistronic lentiviral vector followed by Cre-mediated excision of the integrated polycistron. 7dupASD3 and CTL4R fibroblasts were reprogrammed using the SimpliconTM RNA Reprogramming kit (Millipore). Prior to differentiation, iPSC lines were cultured on hESC-qualified Matrigel (BD Biosciences) coated plates, diluted 1:40 in DMEM/F-12 and grown in mTeSR-1 medium (StemCell Technologies). They were passaged upon treatment with Accutase (Sigma) and then plated in mTeSR-1 medium supplemented with 5μM Y-27632 (Sigma). Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). RNA was extracted using the RNeasy Micro Plus kit (Qiagen) according to manufacturer's instructions. Retrotranscribed cDNA was obtained from 0.5-1 μg of total RNA using the SuperScript VILO Retrotranscription kit (Thermo Fisher Scientific). RT-qPCR was performed on a 7500 Fast Real-Time PCR system (Applied Biosystems) using SYBR Green Master Mix (Applied Biosystems) as detecting reagent. A total cDNA amount corresponding to 15 ng of starting RNA was used for each reaction. Each sample was analyzed in triplicate and normalized to GAPDH. Relative mRNA quantity was calculated by the comparative cycle threshold (Ct) method using the formula 2-deltaCt. BAZ1B: CCTCGCAGTAAGAAAGCAAAC (forward); ACTCATCCAGCTCCTTTTGAC (reverse). 4 GAPDH: GCACCGTCAAGGCTGAGAAC (forward); AGGGATCTCGCTCCTGGAA (reverse). NR2F1: AGAAGCTCAAGGCGCTACAC (forward); GGGTACTGGCTCCTCACGTA (reverse). NR2F2: GCAAGTGGAGAAGCTCAAGG (forward); GCTTTCCACATGGGCTACAT (reverse). TFAP2A: GCCTCTCGCTCCTCAGCTCC (forward); CGTTGGCAGCTTTACGTCTCCC (reverse). SOX9: AGTACCCGCACTTGCACAAC (forward); GTAATCCGGGTGGTCCTTCT (reverse). Library preparation for RNA sequencing was performed according to TruSeq Total RNA sample preparation protocol (Illumina), starting from 250 ng - 1 μg of total RNA. cDNA library quality was assessed at an Agilent 2100 Bioanalyzer, using the High sensitivity DNA kit. ENA-FIRST-PUBLIC 2020-02-29T04:05:15Z ENA-LAST-UPDATE 2019-10-21T16:33:18Z External Id SAMEA6104736 INSDC center name Department of Oncology and Hemato-Oncology, University of Milan, Italy INSDC first public 2020-02-29T04:05:15Z INSDC last update 2019-10-21T16:33:18Z INSDC status public Submitter Id E-MTAB-8455:CTL1.sh2 broker name ArrayExpress cell type neural stem cell common name human developmental stage adult disease normal genotype wild type genotype individual CTL1 organism part skin progenitor cell type induced pluripotent stem cell sample name E-MTAB-8455:CTL1.sh2 scientific_name Homo sapiens ERS3905417 SAMEA6104737 9606 Homo sapiens Protocols: Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). WBS1, WBS2, WBS3, WBS4, 7dupASD1, AtWBS1 and CTL2 fibroblasts were reprogrammed using the mRNA Reprogramming kit (Stemgent), while the 7dupASD2 and CTL1R lines were reprogrammed with the microRNA Booster kit (Stemgent). The CTL3 line was reprogrammed by transfection with the STEMCCA polycistronic lentiviral vector followed by Cre-mediated excision of the integrated polycistron. 7dupASD3 and CTL4R fibroblasts were reprogrammed using the SimpliconTM RNA Reprogramming kit (Millipore). Prior to differentiation, iPSC lines were cultured on hESC-qualified Matrigel (BD Biosciences) coated plates, diluted 1:40 in DMEM/F-12 and grown in mTeSR-1 medium (StemCell Technologies). They were passaged upon treatment with Accutase (Sigma) and then plated in mTeSR-1 medium supplemented with 5μM Y-27632 (Sigma). Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). RNA was extracted using the RNeasy Micro Plus kit (Qiagen) according to manufacturer's instructions. Retrotranscribed cDNA was obtained from 0.5-1 μg of total RNA using the SuperScript VILO Retrotranscription kit (Thermo Fisher Scientific). RT-qPCR was performed on a 7500 Fast Real-Time PCR system (Applied Biosystems) using SYBR Green Master Mix (Applied Biosystems) as detecting reagent. A total cDNA amount corresponding to 15 ng of starting RNA was used for each reaction. Each sample was analyzed in triplicate and normalized to GAPDH. Relative mRNA quantity was calculated by the comparative cycle threshold (Ct) method using the formula 2-deltaCt. BAZ1B: CCTCGCAGTAAGAAAGCAAAC (forward); ACTCATCCAGCTCCTTTTGAC (reverse). 4 GAPDH: GCACCGTCAAGGCTGAGAAC (forward); AGGGATCTCGCTCCTGGAA (reverse). NR2F1: AGAAGCTCAAGGCGCTACAC (forward); GGGTACTGGCTCCTCACGTA (reverse). NR2F2: GCAAGTGGAGAAGCTCAAGG (forward); GCTTTCCACATGGGCTACAT (reverse). TFAP2A: GCCTCTCGCTCCTCAGCTCC (forward); CGTTGGCAGCTTTACGTCTCCC (reverse). SOX9: AGTACCCGCACTTGCACAAC (forward); GTAATCCGGGTGGTCCTTCT (reverse). Library preparation for RNA sequencing was performed according to TruSeq Total RNA sample preparation protocol (Illumina), starting from 250 ng - 1 μg of total RNA. cDNA library quality was assessed at an Agilent 2100 Bioanalyzer, using the High sensitivity DNA kit. ENA-FIRST-PUBLIC 2020-02-29T04:05:15Z ENA-LAST-UPDATE 2019-10-21T16:33:18Z External Id SAMEA6104737 INSDC center name Department of Oncology and Hemato-Oncology, University of Milan, Italy INSDC first public 2020-02-29T04:05:15Z INSDC last update 2019-10-21T16:33:18Z INSDC status public Submitter Id E-MTAB-8455:CTL2.sh2 broker name ArrayExpress cell type neural stem cell common name human developmental stage adult disease normal genotype wild type genotype individual CTL2 organism part skin progenitor cell type induced pluripotent stem cell sample name E-MTAB-8455:CTL2.sh2 scientific_name Homo sapiens ERS3905418 SAMEA6104738 9606 Homo sapiens Protocols: Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). WBS1, WBS2, WBS3, WBS4, 7dupASD1, AtWBS1 and CTL2 fibroblasts were reprogrammed using the mRNA Reprogramming kit (Stemgent), while the 7dupASD2 and CTL1R lines were reprogrammed with the microRNA Booster kit (Stemgent). The CTL3 line was reprogrammed by transfection with the STEMCCA polycistronic lentiviral vector followed by Cre-mediated excision of the integrated polycistron. 7dupASD3 and CTL4R fibroblasts were reprogrammed using the SimpliconTM RNA Reprogramming kit (Millipore). Prior to differentiation, iPSC lines were cultured on hESC-qualified Matrigel (BD Biosciences) coated plates, diluted 1:40 in DMEM/F-12 and grown in mTeSR-1 medium (StemCell Technologies). They were passaged upon treatment with Accutase (Sigma) and then plated in mTeSR-1 medium supplemented with 5μM Y-27632 (Sigma). Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). RNA was extracted using the RNeasy Micro Plus kit (Qiagen) according to manufacturer's instructions. Retrotranscribed cDNA was obtained from 0.5-1 μg of total RNA using the SuperScript VILO Retrotranscription kit (Thermo Fisher Scientific). RT-qPCR was performed on a 7500 Fast Real-Time PCR system (Applied Biosystems) using SYBR Green Master Mix (Applied Biosystems) as detecting reagent. A total cDNA amount corresponding to 15 ng of starting RNA was used for each reaction. Each sample was analyzed in triplicate and normalized to GAPDH. Relative mRNA quantity was calculated by the comparative cycle threshold (Ct) method using the formula 2-deltaCt. BAZ1B: CCTCGCAGTAAGAAAGCAAAC (forward); ACTCATCCAGCTCCTTTTGAC (reverse). 4 GAPDH: GCACCGTCAAGGCTGAGAAC (forward); AGGGATCTCGCTCCTGGAA (reverse). NR2F1: AGAAGCTCAAGGCGCTACAC (forward); GGGTACTGGCTCCTCACGTA (reverse). NR2F2: GCAAGTGGAGAAGCTCAAGG (forward); GCTTTCCACATGGGCTACAT (reverse). TFAP2A: GCCTCTCGCTCCTCAGCTCC (forward); CGTTGGCAGCTTTACGTCTCCC (reverse). SOX9: AGTACCCGCACTTGCACAAC (forward); GTAATCCGGGTGGTCCTTCT (reverse). Library preparation for RNA sequencing was performed according to TruSeq Total RNA sample preparation protocol (Illumina), starting from 250 ng - 1 μg of total RNA. cDNA library quality was assessed at an Agilent 2100 Bioanalyzer, using the High sensitivity DNA kit. ENA-FIRST-PUBLIC 2020-02-29T04:05:15Z ENA-LAST-UPDATE 2019-10-21T16:33:18Z External Id SAMEA6104738 INSDC center name Department of Oncology and Hemato-Oncology, University of Milan, Italy INSDC first public 2020-02-29T04:05:15Z INSDC last update 2019-10-21T16:33:18Z INSDC status public Submitter Id E-MTAB-8455:CTL3.sh2 broker name ArrayExpress cell type neural stem cell common name human developmental stage adult disease normal genotype wild type genotype individual CTL3 organism part skin progenitor cell type induced pluripotent stem cell sample name E-MTAB-8455:CTL3.sh2 scientific_name Homo sapiens ERS3905419 SAMEA6104739 9606 Homo sapiens Protocols: Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). WBS1, WBS2, WBS3, WBS4, 7dupASD1, AtWBS1 and CTL2 fibroblasts were reprogrammed using the mRNA Reprogramming kit (Stemgent), while the 7dupASD2 and CTL1R lines were reprogrammed with the microRNA Booster kit (Stemgent). The CTL3 line was reprogrammed by transfection with the STEMCCA polycistronic lentiviral vector followed by Cre-mediated excision of the integrated polycistron. 7dupASD3 and CTL4R fibroblasts were reprogrammed using the SimpliconTM RNA Reprogramming kit (Millipore). Prior to differentiation, iPSC lines were cultured on hESC-qualified Matrigel (BD Biosciences) coated plates, diluted 1:40 in DMEM/F-12 and grown in mTeSR-1 medium (StemCell Technologies). They were passaged upon treatment with Accutase (Sigma) and then plated in mTeSR-1 medium supplemented with 5μM Y-27632 (Sigma). Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). RNA was extracted using the RNeasy Micro Plus kit (Qiagen) according to manufacturer's instructions. Retrotranscribed cDNA was obtained from 0.5-1 μg of total RNA using the SuperScript VILO Retrotranscription kit (Thermo Fisher Scientific). RT-qPCR was performed on a 7500 Fast Real-Time PCR system (Applied Biosystems) using SYBR Green Master Mix (Applied Biosystems) as detecting reagent. A total cDNA amount corresponding to 15 ng of starting RNA was used for each reaction. Each sample was analyzed in triplicate and normalized to GAPDH. Relative mRNA quantity was calculated by the comparative cycle threshold (Ct) method using the formula 2-deltaCt. BAZ1B: CCTCGCAGTAAGAAAGCAAAC (forward); ACTCATCCAGCTCCTTTTGAC (reverse). 4 GAPDH: GCACCGTCAAGGCTGAGAAC (forward); AGGGATCTCGCTCCTGGAA (reverse). NR2F1: AGAAGCTCAAGGCGCTACAC (forward); GGGTACTGGCTCCTCACGTA (reverse). NR2F2: GCAAGTGGAGAAGCTCAAGG (forward); GCTTTCCACATGGGCTACAT (reverse). TFAP2A: GCCTCTCGCTCCTCAGCTCC (forward); CGTTGGCAGCTTTACGTCTCCC (reverse). SOX9: AGTACCCGCACTTGCACAAC (forward); GTAATCCGGGTGGTCCTTCT (reverse). Library preparation for RNA sequencing was performed according to TruSeq Total RNA sample preparation protocol (Illumina), starting from 250 ng - 1 μg of total RNA. cDNA library quality was assessed at an Agilent 2100 Bioanalyzer, using the High sensitivity DNA kit. ENA-FIRST-PUBLIC 2020-02-29T04:05:15Z ENA-LAST-UPDATE 2019-10-21T16:33:19Z External Id SAMEA6104739 INSDC center name Department of Oncology and Hemato-Oncology, University of Milan, Italy INSDC first public 2020-02-29T04:05:15Z INSDC last update 2019-10-21T16:33:19Z INSDC status public Submitter Id E-MTAB-8455:CTL4.sh2 broker name ArrayExpress cell type neural stem cell common name human developmental stage adult disease normal genotype wild type genotype individual CTL4 organism part skin progenitor cell type induced pluripotent stem cell sample name E-MTAB-8455:CTL4.sh2 scientific_name Homo sapiens ERS3905420 SAMEA6104740 9606 Homo sapiens Protocols: Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). WBS1, WBS2, WBS3, WBS4, 7dupASD1, AtWBS1 and CTL2 fibroblasts were reprogrammed using the mRNA Reprogramming kit (Stemgent), while the 7dupASD2 and CTL1R lines were reprogrammed with the microRNA Booster kit (Stemgent). The CTL3 line was reprogrammed by transfection with the STEMCCA polycistronic lentiviral vector followed by Cre-mediated excision of the integrated polycistron. 7dupASD3 and CTL4R fibroblasts were reprogrammed using the SimpliconTM RNA Reprogramming kit (Millipore). Prior to differentiation, iPSC lines were cultured on hESC-qualified Matrigel (BD Biosciences) coated plates, diluted 1:40 in DMEM/F-12 and grown in mTeSR-1 medium (StemCell Technologies). They were passaged upon treatment with Accutase (Sigma) and then plated in mTeSR-1 medium supplemented with 5μM Y-27632 (Sigma). Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). RNA was extracted using the RNeasy Micro Plus kit (Qiagen) according to manufacturer's instructions. Retrotranscribed cDNA was obtained from 0.5-1 μg of total RNA using the SuperScript VILO Retrotranscription kit (Thermo Fisher Scientific). RT-qPCR was performed on a 7500 Fast Real-Time PCR system (Applied Biosystems) using SYBR Green Master Mix (Applied Biosystems) as detecting reagent. A total cDNA amount corresponding to 15 ng of starting RNA was used for each reaction. Each sample was analyzed in triplicate and normalized to GAPDH. Relative mRNA quantity was calculated by the comparative cycle threshold (Ct) method using the formula 2-deltaCt. BAZ1B: CCTCGCAGTAAGAAAGCAAAC (forward); ACTCATCCAGCTCCTTTTGAC (reverse). 4 GAPDH: GCACCGTCAAGGCTGAGAAC (forward); AGGGATCTCGCTCCTGGAA (reverse). NR2F1: AGAAGCTCAAGGCGCTACAC (forward); GGGTACTGGCTCCTCACGTA (reverse). NR2F2: GCAAGTGGAGAAGCTCAAGG (forward); GCTTTCCACATGGGCTACAT (reverse). TFAP2A: GCCTCTCGCTCCTCAGCTCC (forward); CGTTGGCAGCTTTACGTCTCCC (reverse). SOX9: AGTACCCGCACTTGCACAAC (forward); GTAATCCGGGTGGTCCTTCT (reverse). Library preparation for RNA sequencing was performed according to TruSeq Total RNA sample preparation protocol (Illumina), starting from 250 ng - 1 μg of total RNA. cDNA library quality was assessed at an Agilent 2100 Bioanalyzer, using the High sensitivity DNA kit. ENA-FIRST-PUBLIC 2020-02-29T04:05:15Z ENA-LAST-UPDATE 2019-10-21T16:33:19Z External Id SAMEA6104740 INSDC center name Department of Oncology and Hemato-Oncology, University of Milan, Italy INSDC first public 2020-02-29T04:05:15Z INSDC last update 2019-10-21T16:33:19Z INSDC status public Submitter Id E-MTAB-8455:WBS1.sh2 broker name ArrayExpress cell type neural stem cell common name human developmental stage adult disease Williams syndrome genotype wild type genotype individual WBS1 organism part skin progenitor cell type induced pluripotent stem cell sample name E-MTAB-8455:WBS1.sh2 scientific_name Homo sapiens ERS3905421 SAMEA6104741 9606 Homo sapiens Protocols: Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). WBS1, WBS2, WBS3, WBS4, 7dupASD1, AtWBS1 and CTL2 fibroblasts were reprogrammed using the mRNA Reprogramming kit (Stemgent), while the 7dupASD2 and CTL1R lines were reprogrammed with the microRNA Booster kit (Stemgent). The CTL3 line was reprogrammed by transfection with the STEMCCA polycistronic lentiviral vector followed by Cre-mediated excision of the integrated polycistron. 7dupASD3 and CTL4R fibroblasts were reprogrammed using the SimpliconTM RNA Reprogramming kit (Millipore). Prior to differentiation, iPSC lines were cultured on hESC-qualified Matrigel (BD Biosciences) coated plates, diluted 1:40 in DMEM/F-12 and grown in mTeSR-1 medium (StemCell Technologies). They were passaged upon treatment with Accutase (Sigma) and then plated in mTeSR-1 medium supplemented with 5μM Y-27632 (Sigma). Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). RNA was extracted using the RNeasy Micro Plus kit (Qiagen) according to manufacturer's instructions. Retrotranscribed cDNA was obtained from 0.5-1 μg of total RNA using the SuperScript VILO Retrotranscription kit (Thermo Fisher Scientific). RT-qPCR was performed on a 7500 Fast Real-Time PCR system (Applied Biosystems) using SYBR Green Master Mix (Applied Biosystems) as detecting reagent. A total cDNA amount corresponding to 15 ng of starting RNA was used for each reaction. Each sample was analyzed in triplicate and normalized to GAPDH. Relative mRNA quantity was calculated by the comparative cycle threshold (Ct) method using the formula 2-deltaCt. BAZ1B: CCTCGCAGTAAGAAAGCAAAC (forward); ACTCATCCAGCTCCTTTTGAC (reverse). 4 GAPDH: GCACCGTCAAGGCTGAGAAC (forward); AGGGATCTCGCTCCTGGAA (reverse). NR2F1: AGAAGCTCAAGGCGCTACAC (forward); GGGTACTGGCTCCTCACGTA (reverse). NR2F2: GCAAGTGGAGAAGCTCAAGG (forward); GCTTTCCACATGGGCTACAT (reverse). TFAP2A: GCCTCTCGCTCCTCAGCTCC (forward); CGTTGGCAGCTTTACGTCTCCC (reverse). SOX9: AGTACCCGCACTTGCACAAC (forward); GTAATCCGGGTGGTCCTTCT (reverse). Library preparation for RNA sequencing was performed according to TruSeq Total RNA sample preparation protocol (Illumina), starting from 250 ng - 1 μg of total RNA. cDNA library quality was assessed at an Agilent 2100 Bioanalyzer, using the High sensitivity DNA kit. ENA-FIRST-PUBLIC 2020-02-29T04:05:15Z ENA-LAST-UPDATE 2019-10-21T16:33:19Z External Id SAMEA6104741 INSDC center name Department of Oncology and Hemato-Oncology, University of Milan, Italy INSDC first public 2020-02-29T04:05:15Z INSDC last update 2019-10-21T16:33:19Z INSDC status public Submitter Id E-MTAB-8455:WBS2.sh2 broker name ArrayExpress cell type neural stem cell common name human developmental stage adult disease Williams syndrome genotype wild type genotype individual WBS2 organism part skin progenitor cell type induced pluripotent stem cell sample name E-MTAB-8455:WBS2.sh2 scientific_name Homo sapiens ERS3905422 SAMEA6104742 9606 Homo sapiens Protocols: Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). WBS1, WBS2, WBS3, WBS4, 7dupASD1, AtWBS1 and CTL2 fibroblasts were reprogrammed using the mRNA Reprogramming kit (Stemgent), while the 7dupASD2 and CTL1R lines were reprogrammed with the microRNA Booster kit (Stemgent). The CTL3 line was reprogrammed by transfection with the STEMCCA polycistronic lentiviral vector followed by Cre-mediated excision of the integrated polycistron. 7dupASD3 and CTL4R fibroblasts were reprogrammed using the SimpliconTM RNA Reprogramming kit (Millipore). Prior to differentiation, iPSC lines were cultured on hESC-qualified Matrigel (BD Biosciences) coated plates, diluted 1:40 in DMEM/F-12 and grown in mTeSR-1 medium (StemCell Technologies). They were passaged upon treatment with Accutase (Sigma) and then plated in mTeSR-1 medium supplemented with 5μM Y-27632 (Sigma). Differentiation into NCSCs was performed as previously described (67), with the exception of NCSCs used in the experiment reported in Fig. 1D-F (16). RNA was extracted using the RNeasy Micro Plus kit (Qiagen) according to manufacturer's instructions. Retrotranscribed cDNA was obtained from 0.5-1 μg of total RNA using the SuperScript VILO Retrotranscription kit (Thermo Fisher Scientific). RT-qPCR was performed on a 7500 Fast Real-Time PCR system (Applied Biosystems) using SYBR Green Master Mix (Applied Biosystems) as detecting reagent. A total cDNA amount corresponding to 15 ng of starting RNA was used for each reaction. Each sample was analyzed in triplicate and normalized to GAPDH. Relative mRNA quantity was calculated by the comparative cycle threshold (Ct) method using the formula 2-deltaCt. BAZ1B: CCTCGCAGTAAGAAAGCAAAC (forward); ACTCATCCAGCTCCTTTTGAC (reverse). 4 GAPDH: GCACCGTCAAGGCTGAGAAC (forward); AGGGATCTCGCTCCTGGAA (reverse). NR2F1: AGAAGCTCAAGGCGCTACAC (forward); GGGTACTGGCTCCTCACGTA (reverse). NR2F2: GCAAGTGGAGAAGCTCAAGG (forward); GCTTTCCACATGGGCTACAT (reverse). TFAP2A: GCCTCTCGCTCCTCAGCTCC (forward); CGTTGGCAGCTTTACGTCTCCC (reverse). SOX9: AGTACCCGCACTTGCACAAC (forward); GTAATCCGGGTGGTCCTTCT (reverse). Library preparation for RNA sequencing was performed according to TruSeq Total RNA sample preparation protocol (Illumina), starting from 250 ng - 1 μg of total RNA. cDNA library quality was assessed at an Agilent 2100 Bioanalyzer, using the High sensitivity DNA kit. ENA-FIRST-PUBLIC 2020-02-29T04:05:15Z ENA-LAST-UPDATE 2019-10-21T16:33:19Z External Id SAMEA6104742 INSDC center name Department of Oncology and Hemato-Oncology, University of Milan, Italy INSDC first public 2020-02-29T04:05:15Z INSDC last update 2019-10-21T16:33:19Z INSDC status public Submitter Id E-MTAB-8455:WBS4.sh2 broker name ArrayExpress cell type neural stem cell common name human developmental stage adult disease Williams syndrome genotype wild type genotype individual WBS4 organism part skin progenitor cell type induced pluripotent stem cell sample name E-MTAB-8455:WBS4.sh2 scientific_name Homo sapiens