ERS17936078 SAMEA115161804 410658 soil metagenome Norway grazed mineral sample volume or weight for DNA extraction 0.5188 g broad-scale environmental context sub-arctic boreal forest collection date 2015-08-15 target gene 16S geographic location (longitude) 27.98596 DD sample collection device soil corer 3 cm diameter sample material processing humus and mineral soil samples separated in the field, stored at outdoor temperature during sampling, stored at -20 degrees C after sampling storage conditions (fresh/frozen/other) frozen -20 degrees C pH 4,7 geographic location (country and/or sea) Norway elevation 122 m mean annual and seasonal precipitation annual 450 mm mm organism soil metagenome current land use winter reindeer grazing environmental medium soil geographic location (latitude) 70.03136 DD scientific_name soil metagenome target subfragment V4-V5 geographic location (region and locality) Polmak pcr primers forward primer:CAGCMGCCGCGGTAATWC;reverse primer:CCGTCAATTCCTTTRAGTTT mean annual and seasonal temperature seasonal 12C and -12C in the warmest (July) and coldest (January) months respectively ºC pcr conditions initial denaturation:98degC_1min; (denaturation:98degC_10sec; annealing:64degC_30sec; elongation:72degC_30sec)cycles=26; final elongation:72degC_7min local environmental context mountain birch forest depth 0.03-0.06 m current vegetation mountain birch with an understory layer dominated by dwarf shrubs (Empetrum nigrum ssp. hermaphroditum, Vaccinium myrtillus, V. vitis-idaea) project name Polmak soil 2015 sequencing method Ion Torrent PGM history/extreme events severe moth outbreaks 2002-2008 composite design/sieving (if any) five soil cores pooled together soil horizon B horizon ERS17936062 SAMEA115161788 410658 soil metagenome Norway grazed mineral sample volume or weight for DNA extraction 0.5485 g broad-scale environmental context sub-arctic boreal forest collection date 2015-08-15 target gene ITS geographic location (longitude) 27.98389 DD sample collection device soil corer 3 cm diameter sample material processing humus and mineral soil samples separated in the field, stored at outdoor temperature during sampling, stored at -20 degrees C after sampling storage conditions (fresh/frozen/other) frozen -20 degrees C pH 4,7 geographic location (country and/or sea) Norway elevation 115 m mean annual and seasonal precipitation annual 450 mm mm organism soil metagenome current land use winter reindeer grazing environmental medium soil geographic location (latitude) 70.02703 DD scientific_name soil metagenome target subfragment ITS2 geographic location (region and locality) Polmak pcr primers forward primer:GTGARTCATCGAATCTTTG;reverse primer:TCCTCCGCTTATTGATATGC mean annual and seasonal temperature seasonal 12C and -12C in the warmest (July) and coldest (January) months respectively ºC pcr conditions initial denaturation:98degC_1min: (denaturation:98degC_10sec; annealing:57degC_20sec; elongation:72degC_30sec)cycles=27; final elongation:72degC_7min local environmental context mountain birch forest depth 0.02-0.05 m current vegetation mountain birch with an understory layer dominated by dwarf shrubs (Empetrum nigrum ssp. hermaphroditum, Vaccinium myrtillus, V. vitis-idaea) project name Polmak soil 2015 sequencing method Ion Torrent PGM history/extreme events severe moth outbreaks 2002-2008 composite design/sieving (if any) five soil cores pooled together soil horizon A horizon ERS17936084 SAMEA115161810 410658 soil metagenome Norway grazed mineral sample volume or weight for DNA extraction 0.5242 g broad-scale environmental context sub-arctic boreal forest collection date 2015-08-15 target gene 16S geographic location (longitude) 27.98458 DD sample collection device soil corer 3 cm diameter sample material processing humus and mineral soil samples separated in the field, stored at outdoor temperature during sampling, stored at -20 degrees C after sampling storage conditions (fresh/frozen/other) frozen -20 degrees C pH 4,6 geographic location (country and/or sea) Norway elevation 114 m mean annual and seasonal precipitation annual 450 mm mm organism soil metagenome current land use winter reindeer grazing environmental medium soil geographic location (latitude) 70.03714 DD scientific_name soil metagenome target subfragment V4-V5 geographic location (region and locality) Polmak pcr primers forward primer:CAGCMGCCGCGGTAATWC;reverse primer:CCGTCAATTCCTTTRAGTTT mean annual and seasonal temperature seasonal 12C and -12C in the warmest (July) and coldest (January) months respectively ºC pcr conditions initial denaturation:98degC_1min; (denaturation:98degC_10sec; annealing:64degC_30sec; elongation:72degC_30sec)cycles=26; final elongation:72degC_7min local environmental context mountain birch forest depth 0.02-0.05 m current vegetation mountain birch with an understory layer dominated by dwarf shrubs (Empetrum nigrum ssp. hermaphroditum, Vaccinium myrtillus, V. vitis-idaea) project name Polmak soil 2015 sequencing method Ion Torrent PGM history/extreme events severe moth outbreaks 2002-2008 composite design/sieving (if any) five soil cores pooled together soil horizon B horizon ERS17936082 SAMEA115161808 410658 soil metagenome Norway grazed mineral sample volume or weight for DNA extraction 0.5066 g broad-scale environmental context sub-arctic boreal forest collection date 2015-08-15 target gene 16S geographic location (longitude) 27.98225 DD sample collection device soil corer 3 cm diameter sample material processing humus and mineral soil samples separated in the field, stored at outdoor temperature during sampling, stored at -20 degrees C after sampling storage conditions (fresh/frozen/other) frozen -20 degrees C pH 4,5 geographic location (country and/or sea) Norway elevation 113 m mean annual and seasonal precipitation annual 450 mm mm organism soil metagenome current land use winter reindeer grazing environmental medium soil geographic location (latitude) 70.03569 DD scientific_name soil metagenome target subfragment V4-V5 geographic location (region and locality) Polmak pcr primers forward primer:CAGCMGCCGCGGTAATWC;reverse primer:CCGTCAATTCCTTTRAGTTT mean annual and seasonal temperature seasonal 12C and -12C in the warmest (July) and coldest (January) months respectively ºC pcr conditions initial denaturation:98degC_1min; (denaturation:98degC_10sec; annealing:64degC_30sec; elongation:72degC_30sec)cycles=26; final elongation:72degC_7min local environmental context mountain birch forest depth 0.03-0.05 m current vegetation mountain birch with an understory layer dominated by dwarf shrubs (Empetrum nigrum ssp. hermaphroditum, Vaccinium myrtillus, V. vitis-idaea) project name Polmak soil 2015 sequencing method Ion Torrent PGM history/extreme events severe moth outbreaks 2002-2008 composite design/sieving (if any) five soil cores pooled together soil horizon B horizon ERS17936076 SAMEA115161802 410658 soil metagenome Norway grazed mineral sample volume or weight for DNA extraction 0.5263 g broad-scale environmental context sub-arctic boreal forest collection date 2015-08-15 target gene 16S geographic location (longitude) 27.98673 DD sample collection device soil corer 3 cm diameter sample material processing humus and mineral soil samples separated in the field, stored at outdoor temperature during sampling, stored at -20 degrees C after sampling storage conditions (fresh/frozen/other) frozen -20 degrees C pH 4,7 geographic location (country and/or sea) Norway elevation 123 m mean annual and seasonal precipitation annual 450 mm mm organism soil metagenome current land use winter reindeer grazing environmental medium soil geographic location (latitude) 70.02968 DD scientific_name soil metagenome target subfragment V4-V5 geographic location (region and locality) Polmak pcr primers forward primer:CAGCMGCCGCGGTAATWC;reverse primer:CCGTCAATTCCTTTRAGTTT mean annual and seasonal temperature seasonal 12C and -12C in the warmest (July) and coldest (January) months respectively ºC pcr conditions initial denaturation:98degC_1min; (denaturation:98degC_10sec; annealing:64degC_30sec; elongation:72degC_30sec)cycles=26; final elongation:72degC_7min local environmental context mountain birch forest depth 0.03-0.05 m current vegetation mountain birch with an understory layer dominated by dwarf shrubs (Empetrum nigrum ssp. hermaphroditum, Vaccinium myrtillus, V. vitis-idaea) project name Polmak soil 2015 sequencing method Ion Torrent PGM history/extreme events severe moth outbreaks 2002-2008 composite design/sieving (if any) five soil cores pooled together soil horizon B horizon ERS17936079 SAMEA115161805 410658 soil metagenome Norway ungrazed mineral sample volume or weight for DNA extraction 0.5325 g broad-scale environmental context sub-arctic boreal forest collection date 2015-08-15 target gene 16S geographic location (longitude) 27.9857 DD sample collection device soil corer 3 cm diameter sample material processing humus and mineral soil samples separated in the field, stored at outdoor temperature during sampling, stored at -20 degrees C after sampling storage conditions (fresh/frozen/other) frozen -20 degrees C pH 4,8 geographic location (country and/or sea) Norway elevation 123 m mean annual and seasonal precipitation annual 450 mm mm organism soil metagenome current land use winter reindeer grazing environmental medium soil geographic location (latitude) 70.03162 DD scientific_name soil metagenome target subfragment V4-V5 geographic location (region and locality) Polmak pcr primers forward primer:CAGCMGCCGCGGTAATWC;reverse primer:CCGTCAATTCCTTTRAGTTT mean annual and seasonal temperature seasonal 12C and -12C in the warmest (July) and coldest (January) months respectively ºC pcr conditions initial denaturation:98degC_1min; (denaturation:98degC_10sec; annealing:64degC_30sec; elongation:72degC_30sec)cycles=26; final elongation:72degC_7min local environmental context mountain birch forest depth 0.02-0.05 m current vegetation mountain birch with an understory layer dominated by dwarf shrubs (Empetrum nigrum ssp. hermaphroditum, Vaccinium myrtillus, V. vitis-idaea) project name Polmak soil 2015 sequencing method Ion Torrent PGM history/extreme events severe moth outbreaks 2002-2008 composite design/sieving (if any) five soil cores pooled together soil horizon B horizon ERS17936075 SAMEA115161801 410658 soil metagenome Norway ungrazed mineral sample volume or weight for DNA extraction 0.5192 g broad-scale environmental context sub-arctic boreal forest collection date 2015-08-15 target gene 16S geographic location (longitude) 27.98387 DD sample collection device soil corer 3 cm diameter sample material processing humus and mineral soil samples separated in the field, stored at outdoor temperature during sampling, stored at -20 degrees C after sampling storage conditions (fresh/frozen/other) frozen -20 degrees C pH 4,8 geographic location (country and/or sea) Norway elevation 111 m mean annual and seasonal precipitation annual 450 mm mm organism soil metagenome current land use winter reindeer grazing environmental medium soil geographic location (latitude) 70.02672 DD scientific_name soil metagenome target subfragment V4-V5 geographic location (region and locality) Polmak pcr primers forward primer:CAGCMGCCGCGGTAATWC;reverse primer:CCGTCAATTCCTTTRAGTTT mean annual and seasonal temperature seasonal 12C and -12C in the warmest (July) and coldest (January) months respectively ºC pcr conditions initial denaturation:98degC_1min; (denaturation:98degC_10sec; annealing:64degC_30sec; elongation:72degC_30sec)cycles=26; final elongation:72degC_7min local environmental context mountain birch forest depth 0.04-0.07 m current vegetation mountain birch with an understory layer dominated by dwarf shrubs (Empetrum nigrum ssp. hermaphroditum, Vaccinium myrtillus, V. vitis-idaea) project name Polmak soil 2015 sequencing method Ion Torrent PGM history/extreme events severe moth outbreaks 2002-2008 composite design/sieving (if any) five soil cores pooled together soil horizon B horizon ERS17936065 SAMEA115161791 410658 soil metagenome Norway ungrazed mineral sample volume or weight for DNA extraction 0.53 g broad-scale environmental context sub-arctic boreal forest collection date 2015-08-15 target gene ITS geographic location (longitude) 27.98585 DD sample collection device soil corer 3 cm diameter sample material processing humus and mineral soil samples separated in the field, stored at outdoor temperature during sampling, stored at -20 degrees C after sampling storage conditions (fresh/frozen/other) frozen -20 degrees C pH 4,9 geographic location (country and/or sea) Norway elevation 124 m mean annual and seasonal precipitation annual 450 mm mm organism soil metagenome current land use winter reindeer grazing environmental medium soil geographic location (latitude) 70.02957 DD scientific_name soil metagenome target subfragment ITS2 geographic location (region and locality) Polmak pcr primers forward primer:GTGARTCATCGAATCTTTG;reverse primer:TCCTCCGCTTATTGATATGC mean annual and seasonal temperature seasonal 12C and -12C in the warmest (July) and coldest (January) months respectively ºC pcr conditions initial denaturation:98degC_1min: (denaturation:98degC_10sec; annealing:57degC_20sec; elongation:72degC_30sec)cycles=27; final elongation:72degC_7min local environmental context mountain birch forest depth 0.02-0.05 m current vegetation mountain birch with an understory layer dominated by dwarf shrubs (Empetrum nigrum ssp. hermaphroditum, Vaccinium myrtillus, V. vitis-idaea) project name Polmak soil 2015 sequencing method Ion Torrent PGM history/extreme events severe moth outbreaks 2002-2008 composite design/sieving (if any) five soil cores pooled together soil horizon A horizon ERS17936077 SAMEA115161803 410658 soil metagenome Norway ungrazed mineral sample volume or weight for DNA extraction 0.53 g broad-scale environmental context sub-arctic boreal forest collection date 2015-08-15 target gene 16S geographic location (longitude) 27.98585 DD sample collection device soil corer 3 cm diameter sample material processing humus and mineral soil samples separated in the field, stored at outdoor temperature during sampling, stored at -20 degrees C after sampling storage conditions (fresh/frozen/other) frozen -20 degrees C pH 4,9 geographic location (country and/or sea) Norway elevation 124 m mean annual and seasonal precipitation annual 450 mm mm organism soil metagenome current land use winter reindeer grazing environmental medium soil geographic location (latitude) 70.02957 DD scientific_name soil metagenome target subfragment V4-V5 geographic location (region and locality) Polmak pcr primers forward primer:CAGCMGCCGCGGTAATWC;reverse primer:CCGTCAATTCCTTTRAGTTT mean annual and seasonal temperature seasonal 12C and -12C in the warmest (July) and coldest (January) months respectively ºC pcr conditions initial denaturation:98degC_1min; (denaturation:98degC_10sec; annealing:64degC_30sec; elongation:72degC_30sec)cycles=26; final elongation:72degC_7min local environmental context mountain birch forest depth 0.02-0.05 m current vegetation mountain birch with an understory layer dominated by dwarf shrubs (Empetrum nigrum ssp. hermaphroditum, Vaccinium myrtillus, V. vitis-idaea) project name Polmak soil 2015 sequencing method Ion Torrent PGM history/extreme events severe moth outbreaks 2002-2008 composite design/sieving (if any) five soil cores pooled together soil horizon B horizon ERS17936073 SAMEA115161799 410658 soil metagenome Norway ungrazed mineral sample volume or weight for DNA extraction 0.5017 g broad-scale environmental context sub-arctic boreal forest collection date 2015-08-15 target gene ITS geographic location (longitude) 27.98416 DD sample collection device soil corer 3 cm diameter sample material processing humus and mineral soil samples separated in the field, stored at outdoor temperature during sampling, stored at -20 degrees C after sampling storage conditions (fresh/frozen/other) frozen -20 degrees C pH 5,1 geographic location (country and/or sea) Norway elevation 111 m mean annual and seasonal precipitation annual 450 mm mm organism soil metagenome current land use winter reindeer grazing environmental medium soil geographic location (latitude) 70.0368 DD scientific_name soil metagenome target subfragment ITS2 geographic location (region and locality) Polmak pcr primers forward primer:GTGARTCATCGAATCTTTG;reverse primer:TCCTCCGCTTATTGATATGC mean annual and seasonal temperature seasonal 12C and -12C in the warmest (July) and coldest (January) months respectively ºC pcr conditions initial denaturation:98degC_1min: (denaturation:98degC_10sec; annealing:57degC_20sec; elongation:72degC_30sec)cycles=27; final elongation:72degC_7min local environmental context mountain birch forest depth 0.03-0.06 m current vegetation mountain birch with an understory layer dominated by dwarf shrubs (Empetrum nigrum ssp. hermaphroditum, Vaccinium myrtillus, V. vitis-idaea) project name Polmak soil 2015 sequencing method Ion Torrent PGM history/extreme events severe moth outbreaks 2002-2008 composite design/sieving (if any) five soil cores pooled together soil horizon A horizon ERS17936066 SAMEA115161792 410658 soil metagenome Norway grazed mineral sample volume or weight for DNA extraction 0.5188 g broad-scale environmental context sub-arctic boreal forest collection date 2015-08-15 target gene ITS geographic location (longitude) 27.98596 DD sample collection device soil corer 3 cm diameter sample material processing humus and mineral soil samples separated in the field, stored at outdoor temperature during sampling, stored at -20 degrees C after sampling storage conditions (fresh/frozen/other) frozen -20 degrees C pH 4,7 geographic location (country and/or sea) Norway elevation 122 m mean annual and seasonal precipitation annual 450 mm mm organism soil metagenome current land use winter reindeer grazing environmental medium soil geographic location (latitude) 70.03136 DD scientific_name soil metagenome target subfragment ITS2 geographic location (region and locality) Polmak pcr primers forward primer:GTGARTCATCGAATCTTTG;reverse primer:TCCTCCGCTTATTGATATGC mean annual and seasonal temperature seasonal 12C and -12C in the warmest (July) and coldest (January) months respectively ºC pcr conditions initial denaturation:98degC_1min: (denaturation:98degC_10sec; annealing:57degC_20sec; elongation:72degC_30sec)cycles=27; final elongation:72degC_7min local environmental context mountain birch forest depth 0.03-0.06 m current vegetation mountain birch with an understory layer dominated by dwarf shrubs (Empetrum nigrum ssp. hermaphroditum, Vaccinium myrtillus, V. vitis-idaea) project name Polmak soil 2015 sequencing method Ion Torrent PGM history/extreme events severe moth outbreaks 2002-2008 composite design/sieving (if any) five soil cores pooled together soil horizon A horizon ERS17936071 SAMEA115161797 410658 soil metagenome Norway ungrazed mineral sample volume or weight for DNA extraction 0.5548 g broad-scale environmental context sub-arctic boreal forest collection date 2015-08-15 target gene ITS geographic location (longitude) 27.98238 DD sample collection device soil corer 3 cm diameter sample material processing humus and mineral soil samples separated in the field, stored at outdoor temperature during sampling, stored at -20 degrees C after sampling storage conditions (fresh/frozen/other) frozen -20 degrees C pH 4,6 geographic location (country and/or sea) Norway elevation 115 m mean annual and seasonal precipitation annual 450 mm mm organism soil metagenome current land use winter reindeer grazing environmental medium soil geographic location (latitude) 70.036 DD scientific_name soil metagenome target subfragment ITS2 geographic location (region and locality) Polmak pcr primers forward primer:GTGARTCATCGAATCTTTG;reverse primer:TCCTCCGCTTATTGATATGC mean annual and seasonal temperature seasonal 12C and -12C in the warmest (July) and coldest (January) months respectively ºC pcr conditions initial denaturation:98degC_1min: (denaturation:98degC_10sec; annealing:57degC_20sec; elongation:72degC_30sec)cycles=27; final elongation:72degC_7min local environmental context mountain birch forest depth 0.02-0.05 m current vegetation mountain birch with an understory layer dominated by dwarf shrubs (Empetrum nigrum ssp. hermaphroditum, Vaccinium myrtillus, V. vitis-idaea) project name Polmak soil 2015 sequencing method Ion Torrent PGM history/extreme events severe moth outbreaks 2002-2008 composite design/sieving (if any) five soil cores pooled together soil horizon A horizon ERS17936063 SAMEA115161789 410658 soil metagenome Norway ungrazed mineral sample volume or weight for DNA extraction 0.5192 g broad-scale environmental context sub-arctic boreal forest collection date 2015-08-15 target gene ITS geographic location (longitude) 27.98387 DD sample collection device soil corer 3 cm diameter sample material processing humus and mineral soil samples separated in the field, stored at outdoor temperature during sampling, stored at -20 degrees C after sampling storage conditions (fresh/frozen/other) frozen -20 degrees C pH 4,8 geographic location (country and/or sea) Norway elevation 111 m mean annual and seasonal precipitation annual 450 mm mm organism soil metagenome current land use winter reindeer grazing environmental medium soil geographic location (latitude) 70.02672 DD scientific_name soil metagenome target subfragment ITS2 geographic location (region and locality) Polmak pcr primers forward primer:GTGARTCATCGAATCTTTG;reverse primer:TCCTCCGCTTATTGATATGC mean annual and seasonal temperature seasonal 12C and -12C in the warmest (July) and coldest (January) months respectively ºC pcr conditions initial denaturation:98degC_1min: (denaturation:98degC_10sec; annealing:57degC_20sec; elongation:72degC_30sec)cycles=27; final elongation:72degC_7min local environmental context mountain birch forest depth 0.04-0.07 m current vegetation mountain birch with an understory layer dominated by dwarf shrubs (Empetrum nigrum ssp. hermaphroditum, Vaccinium myrtillus, V. vitis-idaea) project name Polmak soil 2015 sequencing method Ion Torrent PGM history/extreme events severe moth outbreaks 2002-2008 composite design/sieving (if any) five soil cores pooled together soil horizon A horizon ERS17936085 SAMEA115161811 410658 soil metagenome Norway ungrazed mineral sample volume or weight for DNA extraction 0.5017 g broad-scale environmental context sub-arctic boreal forest collection date 2015-08-15 target gene 16S geographic location (longitude) 27.98416 DD sample collection device soil corer 3 cm diameter sample material processing humus and mineral soil samples separated in the field, stored at outdoor temperature during sampling, stored at -20 degrees C after sampling storage conditions (fresh/frozen/other) frozen -20 degrees C pH 5,1 geographic location (country and/or sea) Norway elevation 111 m mean annual and seasonal precipitation annual 450 mm mm organism soil metagenome current land use winter reindeer grazing environmental medium soil geographic location (latitude) 70.0368 DD scientific_name soil metagenome target subfragment V4-V5 geographic location (region and locality) Polmak pcr primers forward primer:CAGCMGCCGCGGTAATWC;reverse primer:CCGTCAATTCCTTTRAGTTT mean annual and seasonal temperature seasonal 12C and -12C in the warmest (July) and coldest (January) months respectively ºC pcr conditions initial denaturation:98degC_1min; (denaturation:98degC_10sec; annealing:64degC_30sec; elongation:72degC_30sec)cycles=26; final elongation:72degC_7min local environmental context mountain birch forest depth 0.03-0.06 m current vegetation mountain birch with an understory layer dominated by dwarf shrubs (Empetrum nigrum ssp. hermaphroditum, Vaccinium myrtillus, V. vitis-idaea) project name Polmak soil 2015 sequencing method Ion Torrent PGM history/extreme events severe moth outbreaks 2002-2008 composite design/sieving (if any) five soil cores pooled together soil horizon B horizon ERS17936070 SAMEA115161796 410658 soil metagenome Norway grazed mineral sample volume or weight for DNA extraction 0.5066 g broad-scale environmental context sub-arctic boreal forest collection date 2015-08-15 target gene ITS geographic location (longitude) 27.98225 DD sample collection device soil corer 3 cm diameter sample material processing humus and mineral soil samples separated in the field, stored at outdoor temperature during sampling, stored at -20 degrees C after sampling storage conditions (fresh/frozen/other) frozen -20 degrees C pH 4,5 geographic location (country and/or sea) Norway elevation 113 m mean annual and seasonal precipitation annual 450 mm mm organism soil metagenome current land use winter reindeer grazing environmental medium soil geographic location (latitude) 70.03569 DD scientific_name soil metagenome target subfragment ITS2 geographic location (region and locality) Polmak pcr primers forward primer:GTGARTCATCGAATCTTTG;reverse primer:TCCTCCGCTTATTGATATGC mean annual and seasonal temperature seasonal 12C and -12C in the warmest (July) and coldest (January) months respectively ºC pcr conditions initial denaturation:98degC_1min: (denaturation:98degC_10sec; annealing:57degC_20sec; elongation:72degC_30sec)cycles=27; final elongation:72degC_7min local environmental context mountain birch forest depth 0.03-0.05 m current vegetation mountain birch with an understory layer dominated by dwarf shrubs (Empetrum nigrum ssp. hermaphroditum, Vaccinium myrtillus, V. vitis-idaea) project name Polmak soil 2015 sequencing method Ion Torrent PGM history/extreme events severe moth outbreaks 2002-2008 composite design/sieving (if any) five soil cores pooled together soil horizon A horizon ERS17936083 SAMEA115161809 410658 soil metagenome Norway ungrazed mineral sample volume or weight for DNA extraction 0.5548 g broad-scale environmental context sub-arctic boreal forest collection date 2015-08-15 target gene 16S geographic location (longitude) 27.98238 DD sample collection device soil corer 3 cm diameter sample material processing humus and mineral soil samples separated in the field, stored at outdoor temperature during sampling, stored at -20 degrees C after sampling storage conditions (fresh/frozen/other) frozen -20 degrees C pH 4,6 geographic location (country and/or sea) Norway elevation 115 m mean annual and seasonal precipitation annual 450 mm mm organism soil metagenome current land use winter reindeer grazing environmental medium soil geographic location (latitude) 70.036 DD scientific_name soil metagenome target subfragment V4-V5 geographic location (region and locality) Polmak pcr primers forward primer:CAGCMGCCGCGGTAATWC;reverse primer:CCGTCAATTCCTTTRAGTTT mean annual and seasonal temperature seasonal 12C and -12C in the warmest (July) and coldest (January) months respectively ºC pcr conditions initial denaturation:98degC_1min; (denaturation:98degC_10sec; annealing:64degC_30sec; elongation:72degC_30sec)cycles=26; final elongation:72degC_7min local environmental context mountain birch forest depth 0.02-0.05 m current vegetation mountain birch with an understory layer dominated by dwarf shrubs (Empetrum nigrum ssp. hermaphroditum, Vaccinium myrtillus, V. vitis-idaea) project name Polmak soil 2015 sequencing method Ion Torrent PGM history/extreme events severe moth outbreaks 2002-2008 composite design/sieving (if any) five soil cores pooled together soil horizon B horizon ERS17936081 SAMEA115161807 410658 soil metagenome Norway ungrazed mineral sample volume or weight for DNA extraction 0.5444 g broad-scale environmental context sub-arctic boreal forest collection date 2015-08-15 target gene 16S geographic location (longitude) 27.98455 DD sample collection device soil corer 3 cm diameter sample material processing humus and mineral soil samples separated in the field, stored at outdoor temperature during sampling, stored at -20 degrees C after sampling storage conditions (fresh/frozen/other) frozen -20 degrees C pH 4,7 geographic location (country and/or sea) Norway elevation 117 m mean annual and seasonal precipitation annual 450 mm mm organism soil metagenome current land use winter reindeer grazing environmental medium soil geographic location (latitude) 70.03243 DD scientific_name soil metagenome target subfragment V4-V5 geographic location (region and locality) Polmak pcr primers forward primer:CAGCMGCCGCGGTAATWC;reverse primer:CCGTCAATTCCTTTRAGTTT mean annual and seasonal temperature seasonal 12C and -12C in the warmest (July) and coldest (January) months respectively ºC pcr conditions initial denaturation:98degC_1min; (denaturation:98degC_10sec; annealing:64degC_30sec; elongation:72degC_30sec)cycles=26; final elongation:72degC_7min local environmental context mountain birch forest depth 0.03-0.06 m current vegetation mountain birch with an understory layer dominated by dwarf shrubs (Empetrum nigrum ssp. hermaphroditum, Vaccinium myrtillus, V. vitis-idaea) project name Polmak soil 2015 sequencing method Ion Torrent PGM history/extreme events severe moth outbreaks 2002-2008 composite design/sieving (if any) five soil cores pooled together soil horizon B horizon ERS17936072 SAMEA115161798 410658 soil metagenome Norway grazed mineral sample volume or weight for DNA extraction 0.5242 g broad-scale environmental context sub-arctic boreal forest collection date 2015-08-15 target gene ITS geographic location (longitude) 27.98458 DD sample collection device soil corer 3 cm diameter sample material processing humus and mineral soil samples separated in the field, stored at outdoor temperature during sampling, stored at -20 degrees C after sampling storage conditions (fresh/frozen/other) frozen -20 degrees C pH 4,6 geographic location (country and/or sea) Norway elevation 114 m mean annual and seasonal precipitation annual 450 mm mm organism soil metagenome current land use winter reindeer grazing environmental medium soil geographic location (latitude) 70.03714 DD scientific_name soil metagenome target subfragment ITS2 geographic location (region and locality) Polmak pcr primers forward primer:GTGARTCATCGAATCTTTG;reverse primer:TCCTCCGCTTATTGATATGC mean annual and seasonal temperature seasonal 12C and -12C in the warmest (July) and coldest (January) months respectively ºC pcr conditions initial denaturation:98degC_1min: (denaturation:98degC_10sec; annealing:57degC_20sec; elongation:72degC_30sec)cycles=27; final elongation:72degC_7min local environmental context mountain birch forest depth 0.02-0.05 m current vegetation mountain birch with an understory layer dominated by dwarf shrubs (Empetrum nigrum ssp. hermaphroditum, Vaccinium myrtillus, V. vitis-idaea) project name Polmak soil 2015 sequencing method Ion Torrent PGM history/extreme events severe moth outbreaks 2002-2008 composite design/sieving (if any) five soil cores pooled together soil horizon A horizon ERS17936080 SAMEA115161806 410658 soil metagenome Norway grazed mineral sample volume or weight for DNA extraction 0.3616 g broad-scale environmental context sub-arctic boreal forest collection date 2015-08-15 target gene 16S geographic location (longitude) 27.98474 DD sample collection device soil corer 3 cm diameter sample material processing humus and mineral soil samples separated in the field, stored at outdoor temperature during sampling, stored at -20 degrees C after sampling storage conditions (fresh/frozen/other) frozen -20 degrees C pH 4,8 geographic location (country and/or sea) Norway elevation 120 m mean annual and seasonal precipitation annual 450 mm mm organism soil metagenome current land use winter reindeer grazing environmental medium soil geographic location (latitude) 70.03211 DD scientific_name soil metagenome target subfragment V4-V5 geographic location (region and locality) Polmak pcr primers forward primer:CAGCMGCCGCGGTAATWC;reverse primer:CCGTCAATTCCTTTRAGTTT mean annual and seasonal temperature seasonal 12C and -12C in the warmest (July) and coldest (January) months respectively ºC pcr conditions initial denaturation:98degC_1min; (denaturation:98degC_10sec; annealing:64degC_30sec; elongation:72degC_30sec)cycles=26; final elongation:72degC_7min local environmental context mountain birch forest depth 0.03-0.06 m current vegetation mountain birch with an understory layer dominated by dwarf shrubs (Empetrum nigrum ssp. hermaphroditum, Vaccinium myrtillus, V. vitis-idaea) project name Polmak soil 2015 sequencing method Ion Torrent PGM history/extreme events severe moth outbreaks 2002-2008 composite design/sieving (if any) five soil cores pooled together soil horizon B horizon ERS17936068 SAMEA115161794 410658 soil metagenome Norway grazed mineral sample volume or weight for DNA extraction 0.3616 g broad-scale environmental context sub-arctic boreal forest collection date 2015-08-15 target gene ITS geographic location (longitude) 27.98474 DD sample collection device soil corer 3 cm diameter sample material processing humus and mineral soil samples separated in the field, stored at outdoor temperature during sampling, stored at -20 degrees C after sampling storage conditions (fresh/frozen/other) frozen -20 degrees C pH 4,8 geographic location (country and/or sea) Norway elevation 120 m mean annual and seasonal precipitation annual 450 mm mm organism soil metagenome current land use winter reindeer grazing environmental medium soil geographic location (latitude) 70.03211 DD scientific_name soil metagenome target subfragment ITS2 geographic location (region and locality) Polmak pcr primers forward primer:GTGARTCATCGAATCTTTG;reverse primer:TCCTCCGCTTATTGATATGC mean annual and seasonal temperature seasonal 12C and -12C in the warmest (July) and coldest (January) months respectively ºC pcr conditions initial denaturation:98degC_1min: (denaturation:98degC_10sec; annealing:57degC_20sec; elongation:72degC_30sec)cycles=27; final elongation:72degC_7min local environmental context mountain birch forest depth 0.03-0.06 m current vegetation mountain birch with an understory layer dominated by dwarf shrubs (Empetrum nigrum ssp. hermaphroditum, Vaccinium myrtillus, V. vitis-idaea) project name Polmak soil 2015 sequencing method Ion Torrent PGM history/extreme events severe moth outbreaks 2002-2008 composite design/sieving (if any) five soil cores pooled together soil horizon A horizon ERS17936074 SAMEA115161800 410658 soil metagenome Norway grazed mineral sample volume or weight for DNA extraction 0.5485 g broad-scale environmental context sub-arctic boreal forest collection date 2015-08-15 target gene 16S geographic location (longitude) 27.98389 DD sample collection device soil corer 3 cm diameter sample material processing humus and mineral soil samples separated in the field, stored at outdoor temperature during sampling, stored at -20 degrees C after sampling storage conditions (fresh/frozen/other) frozen -20 degrees C pH 4,7 geographic location (country and/or sea) Norway elevation 115 m mean annual and seasonal precipitation annual 450 mm mm organism soil metagenome current land use winter reindeer grazing environmental medium soil geographic location (latitude) 70.02703 DD scientific_name soil metagenome target subfragment V4-V5 geographic location (region and locality) Polmak pcr primers forward primer:CAGCMGCCGCGGTAATWC;reverse primer:CCGTCAATTCCTTTRAGTTT mean annual and seasonal temperature seasonal 12C and -12C in the warmest (July) and coldest (January) months respectively ºC pcr conditions initial denaturation:98degC_1min; (denaturation:98degC_10sec; annealing:64degC_30sec; elongation:72degC_30sec)cycles=26; final elongation:72degC_7min local environmental context mountain birch forest depth 0.02-0.05 m current vegetation mountain birch with an understory layer dominated by dwarf shrubs (Empetrum nigrum ssp. hermaphroditum, Vaccinium myrtillus, V. vitis-idaea) project name Polmak soil 2015 sequencing method Ion Torrent PGM history/extreme events severe moth outbreaks 2002-2008 composite design/sieving (if any) five soil cores pooled together soil horizon B horizon ERS17936064 SAMEA115161790 410658 soil metagenome Norway grazed mineral sample volume or weight for DNA extraction 0.5263 g broad-scale environmental context sub-arctic boreal forest collection date 2015-08-15 target gene ITS geographic location (longitude) 27.98673 DD sample collection device soil corer 3 cm diameter sample material processing humus and mineral soil samples separated in the field, stored at outdoor temperature during sampling, stored at -20 degrees C after sampling storage conditions (fresh/frozen/other) frozen -20 degrees C pH 4,7 geographic location (country and/or sea) Norway elevation 123 m mean annual and seasonal precipitation annual 450 mm mm organism soil metagenome current land use winter reindeer grazing environmental medium soil geographic location (latitude) 70.02968 DD scientific_name soil metagenome target subfragment ITS2 geographic location (region and locality) Polmak pcr primers forward primer:GTGARTCATCGAATCTTTG;reverse primer:TCCTCCGCTTATTGATATGC mean annual and seasonal temperature seasonal 12C and -12C in the warmest (July) and coldest (January) months respectively ºC pcr conditions initial denaturation:98degC_1min: (denaturation:98degC_10sec; annealing:57degC_20sec; elongation:72degC_30sec)cycles=27; final elongation:72degC_7min local environmental context mountain birch forest depth 0.03-0.05 m current vegetation mountain birch with an understory layer dominated by dwarf shrubs (Empetrum nigrum ssp. hermaphroditum, Vaccinium myrtillus, V. vitis-idaea) project name Polmak soil 2015 sequencing method Ion Torrent PGM history/extreme events severe moth outbreaks 2002-2008 composite design/sieving (if any) five soil cores pooled together soil horizon A horizon ERS17936069 SAMEA115161795 410658 soil metagenome Norway ungrazed mineral sample volume or weight for DNA extraction 0.5444 g broad-scale environmental context sub-arctic boreal forest collection date 2015-08-15 target gene ITS geographic location (longitude) 27.98455 DD sample collection device soil corer 3 cm diameter sample material processing humus and mineral soil samples separated in the field, stored at outdoor temperature during sampling, stored at -20 degrees C after sampling storage conditions (fresh/frozen/other) frozen -20 degrees C pH 4,7 geographic location (country and/or sea) Norway elevation 117 m mean annual and seasonal precipitation annual 450 mm mm organism soil metagenome current land use winter reindeer grazing environmental medium soil geographic location (latitude) 70.03243 DD scientific_name soil metagenome target subfragment ITS2 geographic location (region and locality) Polmak pcr primers forward primer:GTGARTCATCGAATCTTTG;reverse primer:TCCTCCGCTTATTGATATGC mean annual and seasonal temperature seasonal 12C and -12C in the warmest (July) and coldest (January) months respectively ºC pcr conditions initial denaturation:98degC_1min: (denaturation:98degC_10sec; annealing:57degC_20sec; elongation:72degC_30sec)cycles=27; final elongation:72degC_7min local environmental context mountain birch forest depth 0.03-0.06 m current vegetation mountain birch with an understory layer dominated by dwarf shrubs (Empetrum nigrum ssp. hermaphroditum, Vaccinium myrtillus, V. vitis-idaea) project name Polmak soil 2015 sequencing method Ion Torrent PGM history/extreme events severe moth outbreaks 2002-2008 composite design/sieving (if any) five soil cores pooled together soil horizon A horizon ERS17936067 SAMEA115161793 410658 soil metagenome Norway ungrazed mineral sample volume or weight for DNA extraction 0.5325 g broad-scale environmental context sub-arctic boreal forest collection date 2015-08-15 target gene ITS geographic location (longitude) 27.9857 DD sample collection device soil corer 3 cm diameter sample material processing humus and mineral soil samples separated in the field, stored at outdoor temperature during sampling, stored at -20 degrees C after sampling storage conditions (fresh/frozen/other) frozen -20 degrees C pH 4,8 geographic location (country and/or sea) Norway elevation 123 m mean annual and seasonal precipitation annual 450 mm mm organism soil metagenome current land use winter reindeer grazing environmental medium soil geographic location (latitude) 70.03162 DD scientific_name soil metagenome target subfragment ITS2 geographic location (region and locality) Polmak pcr primers forward primer:GTGARTCATCGAATCTTTG;reverse primer:TCCTCCGCTTATTGATATGC mean annual and seasonal temperature seasonal 12C and -12C in the warmest (July) and coldest (January) months respectively ºC pcr conditions initial denaturation:98degC_1min: (denaturation:98degC_10sec; annealing:57degC_20sec; elongation:72degC_30sec)cycles=27; final elongation:72degC_7min local environmental context mountain birch forest depth 0.02-0.05 m current vegetation mountain birch with an understory layer dominated by dwarf shrubs (Empetrum nigrum ssp. hermaphroditum, Vaccinium myrtillus, V. vitis-idaea) project name Polmak soil 2015 sequencing method Ion Torrent PGM history/extreme events severe moth outbreaks 2002-2008 composite design/sieving (if any) five soil cores pooled together soil horizon A horizon