4C-Seq on viewpoints attributed to the genes EVI1 and GATA2 within AML patients and cell lines with a inv(3)(q21q26) or t(3;3)(q21;q26) aberration

ERS398521 SAMEA2340850 4C-Seq on viewpoints attributed to the genes EVI1 and GATA2 within AML patients and cell lines with a inv(3)(q21q26) or t(3;3)(q21;q26) aberration 9606 Homo sapiens Using 4C-sequencing we determined which genomic elements interact with the EVI1 and GATA2 promoter. We determined a native GATA2 enhancer that interacts with the EVI1 promoter after repositioning mediated by a inv(3)(q21q26) or t(3;3)(q21;q26) aberration 1st_restriction_enzyme DpnII 2nd_restriction_enzyme Csp6I ENA-FIRST-PUBLIC 2014-04-03 ENA-LAST-UPDATE 2014-01-29 External Id SAMEA2340850 INSDC center alias ERASMUSMC_HEMA INSDC center name Erasmus Medical Center INSDC first public 2014-04-03T17:00:38Z INSDC last update 2014-01-29T00:08:58Z INSDC status public Submitter Id 4C_Seq_935_EVI1 bait_sequence ATTATTTAGAAGACCTGATC common name human sample name 4C_Seq_935_EVI1 sample_type Acute Myeloid Leukemia type_of_aberration inv(3)(q21q26) viewpoint_name EVI1 promoter viewpoint_position chr3:168867985 ERS398524 SAMEA2340853 4C-Seq on viewpoints attributed to the genes EVI1 and GATA2 within AML patients and cell lines with a inv(3)(q21q26) or t(3;3)(q21;q26) aberration 9606 Homo sapiens Using 4C-sequencing we determined which genomic elements interact with the EVI1 and GATA2 promoter. We determined a native GATA2 enhancer that interacts with the EVI1 promoter after repositioning mediated by a inv(3)(q21q26) or t(3;3)(q21;q26) aberration 1st_restriction_enzyme DpnII 2nd_restriction_enzyme Csp6I ENA-FIRST-PUBLIC 2014-04-03 ENA-LAST-UPDATE 2014-01-29 External Id SAMEA2340853 INSDC center alias ERASMUSMC_HEMA INSDC center name Erasmus Medical Center INSDC first public 2014-04-03T17:00:38Z INSDC last update 2014-01-29T00:08:58Z INSDC status public Submitter Id 4C_Seq_MOLM1_EVI1 bait_sequence ATTATTTAGAAGACCTGATC common name human sample name 4C_Seq_MOLM1_EVI1 sample_type cell line type_of_aberration inv(3)(q21q26) viewpoint_name EVI1 promoter viewpoint_position chr3:168867985 ERS398527 SAMEA2340856 4C-Seq on viewpoints attributed to the genes EVI1 and GATA2 within AML patients and cell lines with a inv(3)(q21q26) or t(3;3)(q21;q26) aberration 9606 Homo sapiens Using 4C-sequencing we determined which genomic elements interact with the EVI1 and GATA2 promoter. We determined a native GATA2 enhancer that interacts with the EVI1 promoter after repositioning mediated by a inv(3)(q21q26) or t(3;3)(q21;q26) aberration 1st_restriction_enzyme NlaIII 2nd_restriction_enzyme BfaI ENA-FIRST-PUBLIC 2014-04-03 ENA-LAST-UPDATE 2014-01-29 External Id SAMEA2340856 INSDC center alias ERASMUSMC_HEMA INSDC center name Erasmus Medical Center INSDC first public 2014-04-03T17:00:38Z INSDC last update 2014-01-29T00:08:58Z INSDC status public Submitter Id 4C_Seq_MOLM1_EVI1_NLAIII_BFAI bait_sequence CGCCGGGTTTCTATTTCATG common name human sample name 4C_Seq_MOLM1_EVI1_NLAIII_BFAI sample_type cell line type_of_aberration inv(3)(q21q26) viewpoint_name EVI1 promoter viewpoint_position chr3:168865148 ERS398529 SAMEA2340858 4C-Seq on viewpoints attributed to the genes EVI1 and GATA2 within AML patients and cell lines with a inv(3)(q21q26) or t(3;3)(q21;q26) aberration 9606 Homo sapiens Using 4C-sequencing we determined which genomic elements interact with the EVI1 and GATA2 promoter. We determined a native GATA2 enhancer that interacts with the EVI1 promoter after repositioning mediated by a inv(3)(q21q26) or t(3;3)(q21;q26) aberration 1st_restriction_enzyme DpnII 2nd_restriction_enzyme Csp6I ENA-FIRST-PUBLIC 2014-04-03 ENA-LAST-UPDATE 2014-01-29 External Id SAMEA2340858 INSDC center alias ERASMUSMC_HEMA INSDC center name Erasmus Medical Center INSDC first public 2014-04-03T17:00:38Z INSDC last update 2014-01-29T00:08:59Z INSDC status public Submitter Id 4C_Seq_HL60_GATA2 bait_sequence TCAACTCGTAAAATGAGATC common name human sample name 4C_Seq_HL60_GATA2 sample_type cell line type_of_aberration Control viewpoint_name GATA2 short isoform (NM_01145662) promoter viewpoint_position chr3:128208636 ERS398532 SAMEA2340861 4C-Seq on viewpoints attributed to the genes EVI1 and GATA2 within AML patients and cell lines with a inv(3)(q21q26) or t(3;3)(q21;q26) aberration 9606 Homo sapiens Using 4C-sequencing we determined which genomic elements interact with the EVI1 and GATA2 promoter. We determined a native GATA2 enhancer that interacts with the EVI1 promoter after repositioning mediated by a inv(3)(q21q26) or t(3;3)(q21;q26) aberration 1st_restriction_enzyme NlaIII 2nd_restriction_enzyme BfaI ENA-FIRST-PUBLIC 2014-04-03 ENA-LAST-UPDATE 2014-01-29 External Id SAMEA2340861 INSDC center alias ERASMUSMC_HEMA INSDC center name Erasmus Medical Center INSDC first public 2014-04-03T17:00:38Z INSDC last update 2014-01-29T00:08:59Z INSDC status public Submitter Id 4C_Seq_U937_GATA2_NLAIII_BFAI bait_sequence CCCATTAGGCCGAAGACATG common name human sample name 4C_Seq_U937_GATA2_NLAIII_BFAI sample_type cell line type_of_aberration Control viewpoint_name GATA2 short isoform (NM_01145662) promoter viewpoint_position chr3:128209540 ERS398520 SAMEA2340849 4C-Seq on viewpoints attributed to the genes EVI1 and GATA2 within AML patients and cell lines with a inv(3)(q21q26) or t(3;3)(q21;q26) aberration 9606 Homo sapiens Using 4C-sequencing we determined which genomic elements interact with the EVI1 and GATA2 promoter. We determined a native GATA2 enhancer that interacts with the EVI1 promoter after repositioning mediated by a inv(3)(q21q26) or t(3;3)(q21;q26) aberration 1st_restriction_enzyme DpnII 2nd_restriction_enzyme Csp6I ENA-FIRST-PUBLIC 2014-04-03 ENA-LAST-UPDATE 2014-01-29 External Id SAMEA2340849 INSDC center alias ERASMUSMC_HEMA INSDC center name Erasmus Medical Center INSDC first public 2014-04-03T17:00:38Z INSDC last update 2014-01-29T00:08:58Z INSDC status public Submitter Id 4C_Seq_15445_EVI1 bait_sequence ATTATTTAGAAGACCTGATC common name human sample name 4C_Seq_15445_EVI1 sample_type Myelodysplastic syndrome type_of_aberration t(3;3)(q21;q26) viewpoint_name EVI1 promoter viewpoint_position chr3:168867985 ERS398522 SAMEA2340851 4C-Seq on viewpoints attributed to the genes EVI1 and GATA2 within AML patients and cell lines with a inv(3)(q21q26) or t(3;3)(q21;q26) aberration 9606 Homo sapiens Using 4C-sequencing we determined which genomic elements interact with the EVI1 and GATA2 promoter. We determined a native GATA2 enhancer that interacts with the EVI1 promoter after repositioning mediated by a inv(3)(q21q26) or t(3;3)(q21;q26) aberration 1st_restriction_enzyme DpnII 2nd_restriction_enzyme Csp6I ENA-FIRST-PUBLIC 2014-04-03 ENA-LAST-UPDATE 2014-01-29 External Id SAMEA2340851 INSDC center alias ERASMUSMC_HEMA INSDC center name Erasmus Medical Center INSDC first public 2014-04-03T17:00:38Z INSDC last update 2014-01-29T00:08:58Z INSDC status public Submitter Id 4C_Seq_K562_EVI1 bait_sequence ATTATTTAGAAGACCTGATC common name human sample name 4C_Seq_K562_EVI1 sample_type cell line type_of_aberration Control viewpoint_name EVI1 promoter viewpoint_position chr3:168867985 ERS398523 SAMEA2340852 4C-Seq on viewpoints attributed to the genes EVI1 and GATA2 within AML patients and cell lines with a inv(3)(q21q26) or t(3;3)(q21;q26) aberration 9606 Homo sapiens Using 4C-sequencing we determined which genomic elements interact with the EVI1 and GATA2 promoter. We determined a native GATA2 enhancer that interacts with the EVI1 promoter after repositioning mediated by a inv(3)(q21q26) or t(3;3)(q21;q26) aberration 1st_restriction_enzyme DpnII 2nd_restriction_enzyme Csp6I ENA-FIRST-PUBLIC 2014-04-03 ENA-LAST-UPDATE 2014-01-29 External Id SAMEA2340852 INSDC center alias ERASMUSMC_HEMA INSDC center name Erasmus Medical Center INSDC first public 2014-04-03T17:00:38Z INSDC last update 2014-01-29T00:08:58Z INSDC status public Submitter Id 4C_Seq_830_EVI1 bait_sequence ATTATTTAGAAGACCTGATC common name human sample name 4C_Seq_830_EVI1 sample_type Acute Myeloid Leukemia type_of_aberration t(3;3)(q21;q26) viewpoint_name EVI1 promoter viewpoint_position chr3:168867985 ERS398525 SAMEA2340854 4C-Seq on viewpoints attributed to the genes EVI1 and GATA2 within AML patients and cell lines with a inv(3)(q21q26) or t(3;3)(q21;q26) aberration 9606 Homo sapiens Using 4C-sequencing we determined which genomic elements interact with the EVI1 and GATA2 promoter. We determined a native GATA2 enhancer that interacts with the EVI1 promoter after repositioning mediated by a inv(3)(q21q26) or t(3;3)(q21;q26) aberration 1st_restriction_enzyme NlaIII 2nd_restriction_enzyme BfaI ENA-FIRST-PUBLIC 2014-04-03 ENA-LAST-UPDATE 2014-01-29 External Id SAMEA2340854 INSDC center alias ERASMUSMC_HEMA INSDC center name Erasmus Medical Center INSDC first public 2014-04-03T17:00:38Z INSDC last update 2014-01-29T00:08:58Z INSDC status public Submitter Id 4C_Seq_MUTZ3_EVI1_NLAIII_BFAI bait_sequence CGCCGGGTTTCTATTTCATG common name human sample name 4C_Seq_MUTZ3_EVI1_NLAIII_BFAI sample_type cell line type_of_aberration inv(3)(q21q26) viewpoint_name EVI1 promoter viewpoint_position chr3:168865148 ERS398526 SAMEA2340855 4C-Seq on viewpoints attributed to the genes EVI1 and GATA2 within AML patients and cell lines with a inv(3)(q21q26) or t(3;3)(q21;q26) aberration 9606 Homo sapiens Using 4C-sequencing we determined which genomic elements interact with the EVI1 and GATA2 promoter. We determined a native GATA2 enhancer that interacts with the EVI1 promoter after repositioning mediated by a inv(3)(q21q26) or t(3;3)(q21;q26) aberration 1st_restriction_enzyme NlaIII 2nd_restriction_enzyme BfaI ENA-FIRST-PUBLIC 2014-04-03 ENA-LAST-UPDATE 2014-01-29 External Id SAMEA2340855 INSDC center alias ERASMUSMC_HEMA INSDC center name Erasmus Medical Center INSDC first public 2014-04-03T17:00:38Z INSDC last update 2014-01-29T00:08:58Z INSDC status public Submitter Id 4C_Seq_2190_EVI1_NLAIII_BFAI bait_sequence CGCCGGGTTTCTATTTCATG common name human sample name 4C_Seq_2190_EVI1_NLAIII_BFAI sample_type Acute Myeloid Leukemia type_of_aberration inv(3)(q21q26) viewpoint_name EVI1 promoter viewpoint_position chr3:168865148 ERS398528 SAMEA2340857 4C-Seq on viewpoints attributed to the genes EVI1 and GATA2 within AML patients and cell lines with a inv(3)(q21q26) or t(3;3)(q21;q26) aberration 9606 Homo sapiens Using 4C-sequencing we determined which genomic elements interact with the EVI1 and GATA2 promoter. We determined a native GATA2 enhancer that interacts with the EVI1 promoter after repositioning mediated by a inv(3)(q21q26) or t(3;3)(q21;q26) aberration 1st_restriction_enzyme DpnII 2nd_restriction_enzyme Csp6I ENA-FIRST-PUBLIC 2014-04-03 ENA-LAST-UPDATE 2014-01-29 External Id SAMEA2340857 INSDC center alias ERASMUSMC_HEMA INSDC center name Erasmus Medical Center INSDC first public 2014-04-03T17:00:38Z INSDC last update 2014-01-29T00:08:58Z INSDC status public Submitter Id 4C_Seq_22382_GATA2 bait_sequence TCAACTCGTAAAATGAGATC common name human sample name 4C_Seq_22382_GATA2 sample_type Acute Myeloid Leukemia type_of_aberration t(3;3)(q21;q26) viewpoint_name GATA2 short isoform (NM_01145662) promoter viewpoint_position chr3:128208636 ERS398530 SAMEA2340859 4C-Seq on viewpoints attributed to the genes EVI1 and GATA2 within AML patients and cell lines with a inv(3)(q21q26) or t(3;3)(q21;q26) aberration 9606 Homo sapiens Using 4C-sequencing we determined which genomic elements interact with the EVI1 and GATA2 promoter. We determined a native GATA2 enhancer that interacts with the EVI1 promoter after repositioning mediated by a inv(3)(q21q26) or t(3;3)(q21;q26) aberration 1st_restriction_enzyme NlaIII 2nd_restriction_enzyme BfaI ENA-FIRST-PUBLIC 2014-04-03 ENA-LAST-UPDATE 2014-01-29 External Id SAMEA2340859 INSDC center alias ERASMUSMC_HEMA INSDC center name Erasmus Medical Center INSDC first public 2014-04-03T17:00:38Z INSDC last update 2014-01-29T00:08:59Z INSDC status public Submitter Id 4C_Seq_MOLM1_GATA2_NLAIII_BFAI bait_sequence CCCATTAGGCCGAAGACATG common name human sample name 4C_Seq_MOLM1_GATA2_NLAIII_BFAI sample_type cell line type_of_aberration inv(3)(q21q26) viewpoint_name GATA2 short isoform (NM_01145662) promoter viewpoint_position chr3:128209540 ERS398531 SAMEA2340860 4C-Seq on viewpoints attributed to the genes EVI1 and GATA2 within AML patients and cell lines with a inv(3)(q21q26) or t(3;3)(q21;q26) aberration 9606 Homo sapiens Using 4C-sequencing we determined which genomic elements interact with the EVI1 and GATA2 promoter. We determined a native GATA2 enhancer that interacts with the EVI1 promoter after repositioning mediated by a inv(3)(q21q26) or t(3;3)(q21;q26) aberration 1st_restriction_enzyme DpnII 2nd_restriction_enzyme Csp6I ENA-FIRST-PUBLIC 2014-04-03 ENA-LAST-UPDATE 2014-01-29 External Id SAMEA2340860 INSDC center alias ERASMUSMC_HEMA INSDC center name Erasmus Medical Center INSDC first public 2014-04-03T17:00:38Z INSDC last update 2014-01-29T00:08:59Z INSDC status public Submitter Id 4C_Seq_15445_RPN1 bait_sequence ATTCAATTAGGCAAAAGATC common name human sample name 4C_Seq_15445_RPN1 sample_type Acute Myeloid Leukemia type_of_aberration t(3;3)(q21;q26) viewpoint_name RPN1 intron viewpoint_position chr3:128339818 ERS398533 SAMEA2340862 4C-Seq on viewpoints attributed to the genes EVI1 and GATA2 within AML patients and cell lines with a inv(3)(q21q26) or t(3;3)(q21;q26) aberration 9606 Homo sapiens Using 4C-sequencing we determined which genomic elements interact with the EVI1 and GATA2 promoter. We determined a native GATA2 enhancer that interacts with the EVI1 promoter after repositioning mediated by a inv(3)(q21q26) or t(3;3)(q21;q26) aberration 1st_restriction_enzyme DpnII 2nd_restriction_enzyme Csp6I ENA-FIRST-PUBLIC 2014-04-03 ENA-LAST-UPDATE 2014-01-29 External Id SAMEA2340862 INSDC center alias ERASMUSMC_HEMA INSDC center name Erasmus Medical Center INSDC first public 2014-04-03T17:00:38Z INSDC last update 2014-01-29T00:08:59Z INSDC status public Submitter Id 4C_Seq_HL60_CTCF bait_sequence TTACATCAAATAAAGTGATC common name human sample name 4C_Seq_HL60_CTCF sample_type cell line type_of_aberration Control viewpoint_name CTCF binding site viewpoint_position chr3:128328794 ERS398534 SAMEA2340863 4C-Seq on viewpoints attributed to the genes EVI1 and GATA2 within AML patients and cell lines with a inv(3)(q21q26) or t(3;3)(q21;q26) aberration 9606 Homo sapiens Using 4C-sequencing we determined which genomic elements interact with the EVI1 and GATA2 promoter. We determined a native GATA2 enhancer that interacts with the EVI1 promoter after repositioning mediated by a inv(3)(q21q26) or t(3;3)(q21;q26) aberration 1st_restriction_enzyme DpnII 2nd_restriction_enzyme Csp6I ENA-FIRST-PUBLIC 2014-04-03 ENA-LAST-UPDATE 2014-01-29 External Id SAMEA2340863 INSDC center alias ERASMUSMC_HEMA INSDC center name Erasmus Medical Center INSDC first public 2014-04-03T17:00:38Z INSDC last update 2014-01-29T00:08:59Z INSDC status public Submitter Id 4C_Seq_MOLM1_CTCF bait_sequence TTACATCAAATAAAGTGATC common name human sample name 4C_Seq_MOLM1_CTCF sample_type cell line type_of_aberration inv(3)(q21q26) viewpoint_name CTCF binding site viewpoint_position chr3:128328794 ERS398519 SAMEA2340848 4C-Seq on viewpoints attributed to the genes EVI1 and GATA2 within AML patients and cell lines with a inv(3)(q21q26) or t(3;3)(q21;q26) aberration 9606 Homo sapiens Using 4C-sequencing we determined which genomic elements interact with the EVI1 and GATA2 promoter. We determined a native GATA2 enhancer that interacts with the EVI1 promoter after repositioning mediated by a inv(3)(q21q26) or t(3;3)(q21;q26) aberration 1st_restriction_enzyme DpnII 2nd_restriction_enzyme Csp6I ENA-FIRST-PUBLIC 2014-04-03 ENA-LAST-UPDATE 2014-01-29 External Id SAMEA2340848 INSDC center alias ERASMUSMC_HEMA INSDC center name Erasmus Medical Center INSDC first public 2014-04-03T17:00:38Z INSDC last update 2014-01-29T00:08:58Z INSDC status public Submitter Id 4C_Seq_U937_EVI1 bait_sequence ATTATTTAGAAGACCTGATC common name human sample name 4C_Seq_U937_EVI1 sample_type cell line type_of_aberration Control viewpoint_name EVI1 promoter viewpoint_position chr3:168867985