ERS18352798 SAMEA115346814 9606 Homo sapiens human Protocols: Blood into Lithium Heparin tubes, PBMC prep by Ficoll Paque. Cells frozen in 10% DMSO RPMI complete medium and defrosted when required. CD19 Miltenyi isolation of B cells. 10X genomics 5' V1, in drop lysis and oligo(d)T reverse transcription with template switch oligos. as per manufacturer's instructions 10X genomics 5' V1, single index as manufacturer's instructions IL-10 was specifically amplified cDNA for the CpGC samples using primers forward 5'GCCTAACATGCTTCGAGATC3' and reverse 5'TGATGTCTGGGTCTTGGTTC3'. Stardard i7 indexing was then used to produce the library. disease normal individual 203 organism Homo sapiens organism Homo sapiens collection date not collected sex male scientific_name Homo sapiens common name human organism part blood developmental stage adult isolate not applicable cell_type B cell age 26 year geographic location (country and/or sea) not collected ERS18352801 SAMEA115346817 9606 Homo sapiens human Protocols: Blood into Lithium Heparin, PBMC prep by Ficoll Paque, B Cell isolation by EasySep B cell Negative Selection Kit. 1uM CpGC stimulation for 72h. Blood into Lithium Heparin tubes, PBMC prep by Ficoll Paque. Cells frozen in 10% DMSO RPMI complete medium and defrosted when required. CD19 Miltenyi isolation of B cells. 10X genomics 5' V1, in drop lysis and oligo(d)T reverse transcription with template switch oligos. as per manufacturer's instructions 10X genomics 5' V1, single index as manufacturer's instructions IL-10 was specifically amplified cDNA for the CpGC samples using primers forward 5'GCCTAACATGCTTCGAGATC3' and reverse 5'TGATGTCTGGGTCTTGGTTC3'. Stardard i7 indexing was then used to produce the library. disease normal individual Breg2 organism Homo sapiens organism Homo sapiens collection date not collected sex female scientific_name Homo sapiens common name human organism part blood developmental stage adult isolate not applicable cell_type B cell age 24 year geographic location (country and/or sea) not collected ERS18352800 SAMEA115346816 9606 Homo sapiens human Protocols: Blood into Lithium Heparin, PBMC prep by Ficoll Paque, B Cell isolation by EasySep B cell Negative Selection Kit. 1uM CpGC stimulation for 72h. Blood into Lithium Heparin tubes, PBMC prep by Ficoll Paque. Cells frozen in 10% DMSO RPMI complete medium and defrosted when required. CD19 Miltenyi isolation of B cells. 10X genomics 5' V1, in drop lysis and oligo(d)T reverse transcription with template switch oligos. as per manufacturer's instructions 10X genomics 5' V1, single index as manufacturer's instructions IL-10 was specifically amplified cDNA for the CpGC samples using primers forward 5'GCCTAACATGCTTCGAGATC3' and reverse 5'TGATGTCTGGGTCTTGGTTC3'. Stardard i7 indexing was then used to produce the library. disease normal individual Breg1 organism Homo sapiens organism Homo sapiens collection date not collected sex female scientific_name Homo sapiens common name human organism part blood developmental stage adult isolate not applicable cell_type B cell age 28 year geographic location (country and/or sea) not collected ERS18352804 SAMEA115346820 9606 Homo sapiens human Protocols: Blood into Lithium Heparin, PBMC prep by Ficoll Paque, B Cell isolation by EasySep B cell Negative Selection Kit. 1uM CpGC stimulation for 72h. Blood into Lithium Heparin tubes, PBMC prep by Ficoll Paque. Cells frozen in 10% DMSO RPMI complete medium and defrosted when required. CD19 Miltenyi isolation of B cells. 10X genomics 5' V1, in drop lysis and oligo(d)T reverse transcription with template switch oligos. as per manufacturer's instructions 10X genomics 5' V1, single index as manufacturer's instructions IL-10 was specifically amplified cDNA for the CpGC samples using primers forward 5'GCCTAACATGCTTCGAGATC3' and reverse 5'TGATGTCTGGGTCTTGGTTC3'. Stardard i7 indexing was then used to produce the library. disease normal individual Breg3 organism Homo sapiens organism Homo sapiens collection date not collected sex female scientific_name Homo sapiens common name human organism part blood developmental stage adult isolate not applicable cell_type B cell age 26 year geographic location (country and/or sea) not collected ERS18352795 SAMEA115346811 9606 Homo sapiens human Protocols: Blood into Lithium Heparin tubes, PBMC prep by Ficoll Paque. Cells frozen in 10% DMSO RPMI complete medium and defrosted when required. CD19 Miltenyi isolation of B cells. 10X genomics 5' V1, in drop lysis and oligo(d)T reverse transcription with template switch oligos. as per manufacturer's instructions 10X genomics 5' V1, single index as manufacturer's instructions IL-10 was specifically amplified cDNA for the CpGC samples using primers forward 5'GCCTAACATGCTTCGAGATC3' and reverse 5'TGATGTCTGGGTCTTGGTTC3'. Stardard i7 indexing was then used to produce the library. disease normal individual 200 organism Homo sapiens organism Homo sapiens collection date not collected sex female scientific_name Homo sapiens common name human organism part blood developmental stage adult isolate not applicable cell_type B cell age 24 year geographic location (country and/or sea) not collected ERS18352796 SAMEA115346812 9606 Homo sapiens human Protocols: Blood into Lithium Heparin tubes, PBMC prep by Ficoll Paque. Cells frozen in 10% DMSO RPMI complete medium and defrosted when required. CD19 Miltenyi isolation of B cells. 10X genomics 5' V1, in drop lysis and oligo(d)T reverse transcription with template switch oligos. as per manufacturer's instructions 10X genomics 5' V1, single index as manufacturer's instructions IL-10 was specifically amplified cDNA for the CpGC samples using primers forward 5'GCCTAACATGCTTCGAGATC3' and reverse 5'TGATGTCTGGGTCTTGGTTC3'. Stardard i7 indexing was then used to produce the library. disease normal individual 200 organism Homo sapiens organism Homo sapiens collection date not collected sex female scientific_name Homo sapiens common name human organism part blood developmental stage adult isolate not applicable cell_type B cell age 24 year geographic location (country and/or sea) not collected ERS18352802 SAMEA115346818 9606 Homo sapiens human Protocols: Blood into Lithium Heparin, PBMC prep by Ficoll Paque, B Cell isolation by EasySep B cell Negative Selection Kit. 1uM CpGC stimulation for 72h. Blood into Lithium Heparin tubes, PBMC prep by Ficoll Paque. Cells frozen in 10% DMSO RPMI complete medium and defrosted when required. CD19 Miltenyi isolation of B cells. 10X genomics 5' V1, in drop lysis and oligo(d)T reverse transcription with template switch oligos. as per manufacturer's instructions 10X genomics 5' V1, single index as manufacturer's instructions IL-10 was specifically amplified cDNA for the CpGC samples using primers forward 5'GCCTAACATGCTTCGAGATC3' and reverse 5'TGATGTCTGGGTCTTGGTTC3'. Stardard i7 indexing was then used to produce the library. disease normal individual Breg2 organism Homo sapiens organism Homo sapiens collection date not collected sex female scientific_name Homo sapiens common name human organism part blood developmental stage adult isolate not applicable cell_type B cell age 24 year geographic location (country and/or sea) not collected ERS18352794 SAMEA115346810 9606 Homo sapiens human Protocols: Blood into Lithium Heparin tubes, PBMC prep by Ficoll Paque. Cells frozen in 10% DMSO RPMI complete medium and defrosted when required. CD19 Miltenyi isolation of B cells. 10X genomics 5' V1, in drop lysis and oligo(d)T reverse transcription with template switch oligos. as per manufacturer's instructions 10X genomics 5' V1, single index as manufacturer's instructions IL-10 was specifically amplified cDNA for the CpGC samples using primers forward 5'GCCTAACATGCTTCGAGATC3' and reverse 5'TGATGTCTGGGTCTTGGTTC3'. Stardard i7 indexing was then used to produce the library. disease normal individual 192 organism Homo sapiens organism Homo sapiens collection date not collected sex male scientific_name Homo sapiens common name human organism part blood developmental stage adult isolate not applicable cell_type B cell age 55 year geographic location (country and/or sea) not collected ERS18352799 SAMEA115346815 9606 Homo sapiens human Protocols: Blood into Lithium Heparin, PBMC prep by Ficoll Paque, B Cell isolation by EasySep B cell Negative Selection Kit. 1uM CpGC stimulation for 72h. Blood into Lithium Heparin tubes, PBMC prep by Ficoll Paque. Cells frozen in 10% DMSO RPMI complete medium and defrosted when required. CD19 Miltenyi isolation of B cells. 10X genomics 5' V1, in drop lysis and oligo(d)T reverse transcription with template switch oligos. as per manufacturer's instructions 10X genomics 5' V1, single index as manufacturer's instructions IL-10 was specifically amplified cDNA for the CpGC samples using primers forward 5'GCCTAACATGCTTCGAGATC3' and reverse 5'TGATGTCTGGGTCTTGGTTC3'. Stardard i7 indexing was then used to produce the library. disease normal individual Breg1 organism Homo sapiens organism Homo sapiens collection date not collected sex female scientific_name Homo sapiens common name human organism part blood developmental stage adult isolate not applicable cell_type B cell age 28 year geographic location (country and/or sea) not collected ERS18352803 SAMEA115346819 9606 Homo sapiens human Protocols: Blood into Lithium Heparin, PBMC prep by Ficoll Paque, B Cell isolation by EasySep B cell Negative Selection Kit. 1uM CpGC stimulation for 72h. Blood into Lithium Heparin tubes, PBMC prep by Ficoll Paque. Cells frozen in 10% DMSO RPMI complete medium and defrosted when required. CD19 Miltenyi isolation of B cells. 10X genomics 5' V1, in drop lysis and oligo(d)T reverse transcription with template switch oligos. as per manufacturer's instructions 10X genomics 5' V1, single index as manufacturer's instructions IL-10 was specifically amplified cDNA for the CpGC samples using primers forward 5'GCCTAACATGCTTCGAGATC3' and reverse 5'TGATGTCTGGGTCTTGGTTC3'. Stardard i7 indexing was then used to produce the library. disease normal individual Breg3 organism Homo sapiens organism Homo sapiens collection date not collected sex female scientific_name Homo sapiens common name human organism part blood developmental stage adult isolate not applicable cell_type B cell age 26 year geographic location (country and/or sea) not collected ERS18352797 SAMEA115346813 9606 Homo sapiens human Protocols: Blood into Lithium Heparin tubes, PBMC prep by Ficoll Paque. Cells frozen in 10% DMSO RPMI complete medium and defrosted when required. CD19 Miltenyi isolation of B cells. 10X genomics 5' V1, in drop lysis and oligo(d)T reverse transcription with template switch oligos. as per manufacturer's instructions 10X genomics 5' V1, single index as manufacturer's instructions IL-10 was specifically amplified cDNA for the CpGC samples using primers forward 5'GCCTAACATGCTTCGAGATC3' and reverse 5'TGATGTCTGGGTCTTGGTTC3'. Stardard i7 indexing was then used to produce the library. disease normal individual 203 organism Homo sapiens organism Homo sapiens collection date not collected sex male scientific_name Homo sapiens common name human organism part blood developmental stage adult isolate not applicable cell_type B cell age 26 year geographic location (country and/or sea) not collected ERS18352793 SAMEA115346809 9606 Homo sapiens human Protocols: Blood into Lithium Heparin tubes, PBMC prep by Ficoll Paque. Cells frozen in 10% DMSO RPMI complete medium and defrosted when required. CD19 Miltenyi isolation of B cells. 10X genomics 5' V1, in drop lysis and oligo(d)T reverse transcription with template switch oligos. as per manufacturer's instructions 10X genomics 5' V1, single index as manufacturer's instructions IL-10 was specifically amplified cDNA for the CpGC samples using primers forward 5'GCCTAACATGCTTCGAGATC3' and reverse 5'TGATGTCTGGGTCTTGGTTC3'. Stardard i7 indexing was then used to produce the library. disease normal individual 192 organism Homo sapiens organism Homo sapiens collection date not collected sex male scientific_name Homo sapiens common name human organism part blood developmental stage adult isolate not applicable cell_type B cell age 55 year geographic location (country and/or sea) not collected