ERX448755 qiime_experiment_2223:1240449:7 qiime_experiment_2223:1240449:7 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441184 SAMEA2471721 qiime_study_2223:338R.BC0009 338R.BC0009:7 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 3339 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 7 target_gene 16S rRNA study_center CCME ERX448756 qiime_experiment_2223:1240450:18 qiime_experiment_2223:1240450:18 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441185 SAMEA2471722 qiime_study_2223:338R.BC0020 338R.BC0020:18 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 2168 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 18 target_gene 16S rRNA study_center CCME ERX448757 qiime_experiment_2223:1240451:62 qiime_experiment_2223:1240451:62 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441186 SAMEA2471723 qiime_study_2223:338R.BC0067 338R.BC0067:62 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 4385 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 62 target_gene 16S rRNA study_center CCME ERX448758 qiime_experiment_2223:1240452:63 qiime_experiment_2223:1240452:63 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441187 SAMEA2471724 qiime_study_2223:338R.BC0068 338R.BC0068:63 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 1640 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 63 target_gene 16S rRNA study_center CCME ERX448759 qiime_experiment_2223:1240453:36 qiime_experiment_2223:1240453:36 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441188 SAMEA2471725 qiime_study_2223:338R.BC0039 338R.BC0039:36 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 3445 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 36 target_gene 16S rRNA study_center CCME ERX448760 qiime_experiment_2223:1240454:6 qiime_experiment_2223:1240454:6 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441189 SAMEA2471726 qiime_study_2223:338R.BC0008 338R.BC0008:6 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 3546 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 6 target_gene 16S rRNA study_center CCME ERX448761 qiime_experiment_2223:1240455:50 qiime_experiment_2223:1240455:50 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441190 SAMEA2471727 qiime_study_2223:338R.BC0055 338R.BC0055:50 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 3186 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 50 target_gene 16S rRNA study_center CCME ERX448762 qiime_experiment_2223:1240456:26 qiime_experiment_2223:1240456:26 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441191 SAMEA2471728 qiime_study_2223:338R.BC0028 338R.BC0028:26 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 2690 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 26 target_gene 16S rRNA study_center CCME ERX448763 qiime_experiment_2223:1240457:75 qiime_experiment_2223:1240457:75 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441192 SAMEA2471729 qiime_study_2223:338R.BC0084 338R.BC0084:75 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 2717 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 75 target_gene 16S rRNA study_center CCME ERX448764 qiime_experiment_2223:1240458:77 qiime_experiment_2223:1240458:77 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441193 SAMEA2471730 qiime_study_2223:338R.BC0087 338R.BC0087:77 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 2310 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 77 target_gene 16S rRNA study_center CCME ERX448765 qiime_experiment_2223:1240459:29 qiime_experiment_2223:1240459:29 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441194 SAMEA2471731 qiime_study_2223:338R.BC0032 338R.BC0032:29 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 4908 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 29 target_gene 16S rRNA study_center CCME ERX448766 qiime_experiment_2223:1240460:21 qiime_experiment_2223:1240460:21 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441195 SAMEA2471732 qiime_study_2223:338R.BC0023 338R.BC0023:21 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 5184 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 21 target_gene 16S rRNA study_center CCME ERX448767 qiime_experiment_2223:1240461:61 qiime_experiment_2223:1240461:61 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441196 SAMEA2471733 qiime_study_2223:338R.BC0066 338R.BC0066:61 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 1315 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 61 target_gene 16S rRNA study_center CCME ERX448768 qiime_experiment_2223:1240462:64 qiime_experiment_2223:1240462:64 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441197 SAMEA2471734 qiime_study_2223:338R.BC0069 338R.BC0069:64 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 3591 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 64 target_gene 16S rRNA study_center CCME ERX448769 qiime_experiment_2223:1240463:84 qiime_experiment_2223:1240463:84 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441198 SAMEA2471735 qiime_study_2223:338R.BC0095 338R.BC0095:84 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 2884 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 84 target_gene 16S rRNA study_center CCME ERX448770 qiime_experiment_2223:1240464:22 qiime_experiment_2223:1240464:22 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441199 SAMEA2471736 qiime_study_2223:338R.BC0024 338R.BC0024:22 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 3263 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 22 target_gene 16S rRNA study_center CCME ERX448771 qiime_experiment_2223:1240465:58 qiime_experiment_2223:1240465:58 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441200 SAMEA2471737 qiime_study_2223:338R.BC0063 338R.BC0063:58 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 5042 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 58 target_gene 16S rRNA study_center CCME ERX448772 qiime_experiment_2223:1240466:83 qiime_experiment_2223:1240466:83 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441201 SAMEA2471738 qiime_study_2223:338R.BC0094 338R.BC0094:83 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 2594 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 83 target_gene 16S rRNA study_center CCME ERX448773 qiime_experiment_2223:1240467:4 qiime_experiment_2223:1240467:4 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441202 SAMEA2471739 qiime_study_2223:338R.BC0006 338R.BC0006:4 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 2976 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 4 target_gene 16S rRNA study_center CCME ERX448774 qiime_experiment_2223:1240468:72 qiime_experiment_2223:1240468:72 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441203 SAMEA2471740 qiime_study_2223:338R.BC0080 338R.BC0080:72 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 6203 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 72 target_gene 16S rRNA study_center CCME ERX448775 qiime_experiment_2223:1240469:1 qiime_experiment_2223:1240469:1 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441204 SAMEA2471741 qiime_study_2223:338R.BC0002 338R.BC0002:1 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 3039 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 1 target_gene 16S rRNA study_center CCME ERX448776 qiime_experiment_2223:1240470:20 qiime_experiment_2223:1240470:20 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441205 SAMEA2471742 qiime_study_2223:338R.BC0022 338R.BC0022:20 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 3306 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 20 target_gene 16S rRNA study_center CCME ERX448777 qiime_experiment_2223:1240471:32 qiime_experiment_2223:1240471:32 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441206 SAMEA2471743 qiime_study_2223:338R.BC0035 338R.BC0035:32 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 3673 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 32 target_gene 16S rRNA study_center CCME ERX448778 qiime_experiment_2223:1240472:82 qiime_experiment_2223:1240472:82 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441207 SAMEA2471744 qiime_study_2223:338R.BC0093 338R.BC0093:82 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 3456 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 82 target_gene 16S rRNA study_center CCME ERX448779 qiime_experiment_2223:1240473:54 qiime_experiment_2223:1240473:54 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441208 SAMEA2471745 qiime_study_2223:338R.BC0059 338R.BC0059:54 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 1661 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 54 target_gene 16S rRNA study_center CCME ERX448780 qiime_experiment_2223:1240474:10 qiime_experiment_2223:1240474:10 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441209 SAMEA2471746 qiime_study_2223:338R.BC0012 338R.BC0012:10 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 2358 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 10 target_gene 16S rRNA study_center CCME ERX448781 qiime_experiment_2223:1240475:52 qiime_experiment_2223:1240475:52 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441210 SAMEA2471747 qiime_study_2223:338R.BC0057 338R.BC0057:52 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 4717 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 52 target_gene 16S rRNA study_center CCME ERX448782 qiime_experiment_2223:1240476:39 qiime_experiment_2223:1240476:39 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441211 SAMEA2471748 qiime_study_2223:338R.BC0043 338R.BC0043:39 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 3979 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 39 target_gene 16S rRNA study_center CCME ERX448783 qiime_experiment_2223:1240477:47 qiime_experiment_2223:1240477:47 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441212 SAMEA2471749 qiime_study_2223:338R.BC0051 338R.BC0051:47 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 6142 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 47 target_gene 16S rRNA study_center CCME ERX448784 qiime_experiment_2223:1240478:65 qiime_experiment_2223:1240478:65 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441213 SAMEA2471750 qiime_study_2223:338R.BC0072 338R.BC0072:65 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 4297 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 65 target_gene 16S rRNA study_center CCME ERX448785 qiime_experiment_2223:1240479:0 qiime_experiment_2223:1240479:0 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441214 SAMEA2471751 qiime_study_2223:338R.BC0001 338R.BC0001:0 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 3380 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 0 target_gene 16S rRNA study_center CCME ERX448786 qiime_experiment_2223:1240480:78 qiime_experiment_2223:1240480:78 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441215 SAMEA2471752 qiime_study_2223:338R.BC0088 338R.BC0088:78 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 2411 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 78 target_gene 16S rRNA study_center CCME ERX448787 qiime_experiment_2223:1240481:56 qiime_experiment_2223:1240481:56 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441216 SAMEA2471753 qiime_study_2223:338R.BC0061 338R.BC0061:56 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 2613 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 56 target_gene 16S rRNA study_center CCME ERX448788 qiime_experiment_2223:1240482:27 qiime_experiment_2223:1240482:27 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441217 SAMEA2471754 qiime_study_2223:338R.BC0030 338R.BC0030:27 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 3643 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 27 target_gene 16S rRNA study_center CCME ERX448789 qiime_experiment_2223:1240483:66 qiime_experiment_2223:1240483:66 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441218 SAMEA2471755 qiime_study_2223:338R.BC0073 338R.BC0073:66 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 3778 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 66 target_gene 16S rRNA study_center CCME ERX448790 qiime_experiment_2223:1240484:11 qiime_experiment_2223:1240484:11 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441219 SAMEA2471756 qiime_study_2223:338R.BC0013 338R.BC0013:11 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 4481 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 11 target_gene 16S rRNA study_center CCME ERX448791 qiime_experiment_2223:1240485:34 qiime_experiment_2223:1240485:34 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441220 SAMEA2471757 qiime_study_2223:338R.BC0037 338R.BC0037:34 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 2923 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 34 target_gene 16S rRNA study_center CCME ERX448792 qiime_experiment_2223:1240486:69 qiime_experiment_2223:1240486:69 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441221 SAMEA2471758 qiime_study_2223:338R.BC0076 338R.BC0076:69 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 1629 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 69 target_gene 16S rRNA study_center CCME ERX448793 qiime_experiment_2223:1240487:25 qiime_experiment_2223:1240487:25 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441222 SAMEA2471759 qiime_study_2223:338R.BC0027 338R.BC0027:25 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 4635 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 25 target_gene 16S rRNA study_center CCME ERX448794 qiime_experiment_2223:1240488:76 qiime_experiment_2223:1240488:76 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441223 SAMEA2471760 qiime_study_2223:338R.BC0086 338R.BC0086:76 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 1670 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 76 target_gene 16S rRNA study_center CCME ERX448795 qiime_experiment_2223:1240489:31 qiime_experiment_2223:1240489:31 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441224 SAMEA2471761 qiime_study_2223:338R.BC0034 338R.BC0034:31 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 3065 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 31 target_gene 16S rRNA study_center CCME ERX448796 qiime_experiment_2223:1240490:19 qiime_experiment_2223:1240490:19 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441225 SAMEA2471762 qiime_study_2223:338R.BC0021 338R.BC0021:19 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 5233 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 19 target_gene 16S rRNA study_center CCME ERX448797 qiime_experiment_2223:1240491:23 qiime_experiment_2223:1240491:23 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441226 SAMEA2471763 qiime_study_2223:338R.BC0025 338R.BC0025:23 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 4089 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 23 target_gene 16S rRNA study_center CCME ERX448798 qiime_experiment_2223:1240492:8 qiime_experiment_2223:1240492:8 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441227 SAMEA2471764 qiime_study_2223:338R.BC0010 338R.BC0010:8 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 3109 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 8 target_gene 16S rRNA study_center CCME ERX448799 qiime_experiment_2223:1240493:12 qiime_experiment_2223:1240493:12 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441228 SAMEA2471765 qiime_study_2223:338R.BC0014 338R.BC0014:12 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 5320 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 12 target_gene 16S rRNA study_center CCME ERX448800 qiime_experiment_2223:1240494:44 qiime_experiment_2223:1240494:44 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441229 SAMEA2471766 qiime_study_2223:338R.BC0048 338R.BC0048:44 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 5172 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 44 target_gene 16S rRNA study_center CCME ERX448801 qiime_experiment_2223:1240495:42 qiime_experiment_2223:1240495:42 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441230 SAMEA2471767 qiime_study_2223:338R.BC0046 338R.BC0046:42 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 4769 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 42 target_gene 16S rRNA study_center CCME ERX448802 qiime_experiment_2223:1240496:35 qiime_experiment_2223:1240496:35 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441231 SAMEA2471768 qiime_study_2223:338R.BC0038 338R.BC0038:35 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 4406 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 35 target_gene 16S rRNA study_center CCME ERX448803 qiime_experiment_2223:1240497:9 qiime_experiment_2223:1240497:9 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441232 SAMEA2471769 qiime_study_2223:338R.BC0011 338R.BC0011:9 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 3208 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 9 target_gene 16S rRNA study_center CCME ERX448804 qiime_experiment_2223:1240498:17 qiime_experiment_2223:1240498:17 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441233 SAMEA2471770 qiime_study_2223:338R.BC0019 338R.BC0019:17 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 3067 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 17 target_gene 16S rRNA study_center CCME ERX448805 qiime_experiment_2223:1240499:15 qiime_experiment_2223:1240499:15 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441234 SAMEA2471771 qiime_study_2223:338R.BC0017 338R.BC0017:15 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 3004 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 15 target_gene 16S rRNA study_center CCME ERX448806 qiime_experiment_2223:1240500:33 qiime_experiment_2223:1240500:33 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441235 SAMEA2471772 qiime_study_2223:338R.BC0036 338R.BC0036:33 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 2827 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 33 target_gene 16S rRNA study_center CCME ERX448807 qiime_experiment_2223:1240501:5 qiime_experiment_2223:1240501:5 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441236 SAMEA2471773 qiime_study_2223:338R.BC0007 338R.BC0007:5 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 2977 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 5 target_gene 16S rRNA study_center CCME ERX448808 qiime_experiment_2223:1240502:43 qiime_experiment_2223:1240502:43 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441237 SAMEA2471774 qiime_study_2223:338R.BC0047 338R.BC0047:43 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 4671 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 43 target_gene 16S rRNA study_center CCME ERX448809 qiime_experiment_2223:1240503:38 qiime_experiment_2223:1240503:38 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441238 SAMEA2471775 qiime_study_2223:338R.BC0042 338R.BC0042:38 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 5062 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 38 target_gene 16S rRNA study_center CCME ERX448810 qiime_experiment_2223:1240504:3 qiime_experiment_2223:1240504:3 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441239 SAMEA2471776 qiime_study_2223:338R.BC0004 338R.BC0004:3 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 6089 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 3 target_gene 16S rRNA study_center CCME ERX448811 qiime_experiment_2223:1240505:53 qiime_experiment_2223:1240505:53 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441240 SAMEA2471777 qiime_study_2223:338R.BC0058 338R.BC0058:53 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 6949 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 53 target_gene 16S rRNA study_center CCME ERX448812 qiime_experiment_2223:1240506:73 qiime_experiment_2223:1240506:73 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441241 SAMEA2471778 qiime_study_2223:338R.BC0081 338R.BC0081:73 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 3824 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 73 target_gene 16S rRNA study_center CCME ERX448813 qiime_experiment_2223:1240507:60 qiime_experiment_2223:1240507:60 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441242 SAMEA2471779 qiime_study_2223:338R.BC0065 338R.BC0065:60 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 2326 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 60 target_gene 16S rRNA study_center CCME ERX448814 qiime_experiment_2223:1240508:55 qiime_experiment_2223:1240508:55 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441243 SAMEA2471780 qiime_study_2223:338R.BC0060 338R.BC0060:55 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 2613 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 55 target_gene 16S rRNA study_center CCME ERX448815 qiime_experiment_2223:1240509:80 qiime_experiment_2223:1240509:80 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441244 SAMEA2471781 qiime_study_2223:338R.BC0091 338R.BC0091:80 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 3541 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 80 target_gene 16S rRNA study_center CCME ERX448816 qiime_experiment_2223:1240510:45 qiime_experiment_2223:1240510:45 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441245 SAMEA2471782 qiime_study_2223:338R.BC0049 338R.BC0049:45 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 1939 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 45 target_gene 16S rRNA study_center CCME ERX448817 qiime_experiment_2223:1240511:46 qiime_experiment_2223:1240511:46 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441246 SAMEA2471783 qiime_study_2223:338R.BC0050 338R.BC0050:46 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 5184 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 46 target_gene 16S rRNA study_center CCME ERX448818 qiime_experiment_2223:1240512:71 qiime_experiment_2223:1240512:71 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441247 SAMEA2471784 qiime_study_2223:338R.BC0079 338R.BC0079:71 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 4298 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 71 target_gene 16S rRNA study_center CCME ERX448819 qiime_experiment_2223:1240513:41 qiime_experiment_2223:1240513:41 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441248 SAMEA2471785 qiime_study_2223:338R.BC0045 338R.BC0045:41 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 5386 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 41 target_gene 16S rRNA study_center CCME ERX448820 qiime_experiment_2223:1240514:37 qiime_experiment_2223:1240514:37 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441249 SAMEA2471786 qiime_study_2223:338R.BC0041 338R.BC0041:37 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 4406 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 37 target_gene 16S rRNA study_center CCME ERX448821 qiime_experiment_2223:1240515:51 qiime_experiment_2223:1240515:51 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441250 SAMEA2471787 qiime_study_2223:338R.BC0056 338R.BC0056:51 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 4622 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 51 target_gene 16S rRNA study_center CCME ERX448822 qiime_experiment_2223:1240516:79 qiime_experiment_2223:1240516:79 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441251 SAMEA2471788 qiime_study_2223:338R.BC0090 338R.BC0090:79 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 4337 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 79 target_gene 16S rRNA study_center CCME ERX448823 qiime_experiment_2223:1240517:59 qiime_experiment_2223:1240517:59 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441252 SAMEA2471789 qiime_study_2223:338R.BC0064 338R.BC0064:59 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 1959 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 59 target_gene 16S rRNA study_center CCME ERX448824 qiime_experiment_2223:1240518:40 qiime_experiment_2223:1240518:40 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441253 SAMEA2471790 qiime_study_2223:338R.BC0044 338R.BC0044:40 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 4156 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 40 target_gene 16S rRNA study_center CCME ERX448825 qiime_experiment_2223:1240519:28 qiime_experiment_2223:1240519:28 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441254 SAMEA2471791 qiime_study_2223:338R.BC0031 338R.BC0031:28 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 4338 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 28 target_gene 16S rRNA study_center CCME ERX448826 qiime_experiment_2223:1240520:74 qiime_experiment_2223:1240520:74 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441255 SAMEA2471792 qiime_study_2223:338R.BC0083 338R.BC0083:74 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 3234 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 74 target_gene 16S rRNA study_center CCME ERX448827 qiime_experiment_2223:1240521:24 qiime_experiment_2223:1240521:24 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441256 SAMEA2471793 qiime_study_2223:338R.BC0026 338R.BC0026:24 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 1898 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 24 target_gene 16S rRNA study_center CCME ERX448828 qiime_experiment_2223:1240522:57 qiime_experiment_2223:1240522:57 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441257 SAMEA2471794 qiime_study_2223:338R.BC0062 338R.BC0062:57 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 4205 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 57 target_gene 16S rRNA study_center CCME ERX448829 qiime_experiment_2223:1240523:70 qiime_experiment_2223:1240523:70 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441258 SAMEA2471795 qiime_study_2223:338R.BC0077 338R.BC0077:70 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 1997 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 70 target_gene 16S rRNA study_center CCME ERX448830 qiime_experiment_2223:1240524:49 qiime_experiment_2223:1240524:49 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441259 SAMEA2471796 qiime_study_2223:338R.BC0054 338R.BC0054:49 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 3568 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 49 target_gene 16S rRNA study_center CCME ERX448831 qiime_experiment_2223:1240525:2 qiime_experiment_2223:1240525:2 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441260 SAMEA2471797 qiime_study_2223:338R.BC0003 338R.BC0003:2 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 4645 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 2 target_gene 16S rRNA study_center CCME ERX448832 qiime_experiment_2223:1240526:67 qiime_experiment_2223:1240526:67 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441261 SAMEA2471798 qiime_study_2223:338R.BC0074 338R.BC0074:67 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 4319 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 67 target_gene 16S rRNA study_center CCME ERX448833 qiime_experiment_2223:1240527:30 qiime_experiment_2223:1240527:30 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441262 SAMEA2471799 qiime_study_2223:338R.BC0033 338R.BC0033:30 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 3667 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 30 target_gene 16S rRNA study_center CCME ERX448834 qiime_experiment_2223:1240528:14 qiime_experiment_2223:1240528:14 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441263 SAMEA2471800 qiime_study_2223:338R.BC0016 338R.BC0016:14 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 2685 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 14 target_gene 16S rRNA study_center CCME ERX448835 qiime_experiment_2223:1240529:48 qiime_experiment_2223:1240529:48 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441264 SAMEA2471801 qiime_study_2223:338R.BC0053 338R.BC0053:48 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 2834 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 48 target_gene 16S rRNA study_center CCME ERX448836 qiime_experiment_2223:1240530:81 qiime_experiment_2223:1240530:81 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441265 SAMEA2471802 qiime_study_2223:338R.BC0092 338R.BC0092:81 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 1962 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 81 target_gene 16S rRNA study_center CCME ERX448837 qiime_experiment_2223:1240531:13 qiime_experiment_2223:1240531:13 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441266 SAMEA2471803 qiime_study_2223:338R.BC0015 338R.BC0015:13 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 4013 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 13 target_gene 16S rRNA study_center CCME ERX448838 qiime_experiment_2223:1240532:68 qiime_experiment_2223:1240532:68 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441267 SAMEA2471804 qiime_study_2223:338R.BC0075 338R.BC0075:68 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 4512 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 68 target_gene 16S rRNA study_center CCME ERX448839 qiime_experiment_2223:1240533:16 qiime_experiment_2223:1240533:16 ERP005617 qiime_study_2223 A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. ERS441268 SAMEA2471805 qiime_study_2223:338R.BC0018 338R.BC0018:16 AMPLICON METAGENOMIC PCR A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. 0 Application Read Forward 1 unspecified experiment_title Nemergut_wildfire_soils target_subfragment V2 sample_center CCME sequencing_meth pyrosequencing experiment_center CCME pcr_primers FWD:TGCTGCCTCCCGTAGGAGT; REV:TCAGAGTTTGATCCTGGCTCAG run_center Engencore num_sequences 1317 platform Titanium library_construction_protocol A fragment of the 16S rRNA gene encoding the V1-V2 region was amplified using modified primers of 27F and 338R adapted for Titanium chemistry (454 Life Sciences, Bradford, CT, USA). PCR reactions were performed in triplicate with 10????_l of sterile H2O, 10????_l of 5 PRIME hot master mix (5 PRIME, Gaithersburg, MD, USA), 2????_l (5????_M) of the reverse primer, 1????_l (10????_M) of the forward primer and 2????_l of the sample DNA. Samples were denatured for 3???min at 94?????C followed by 25 cycles at 94?????C for 45???s, 50?????C for 30???s, 72?????C for 90???s and a final elongation step at 70?????C for 10???min. Three replicate PCR products were quantified, pooled and cleaned using MO BIO UltraClean-htp PCR Clean-up kits and 16S rRNA gene amplicons were sent to the Environmental Genomics Core Facility (Engencore) at University of South Carolina for 454 Life Sciences GS FLX Titanium pyrosequencing. experiment_design_description A total of 100 samples, 25 each from burned and unburned soils, collected at both 4 (October 2010) and 16 weeks postfire (January 2011) were analyzed in this study. Soils were sampled roughly 1???m from the base of living (unburned) and dead (burned) tree trunks near the southeastern edge of the Fourmile Fire (40.039N, 105.391W), that was ignited on 6 September 2010 on the eastern slope of the Colorado Front Range, Boulder County, CO, USA. row_number 16 target_gene 16S rRNA study_center CCME