ERS549211 SAMEA2778887 3702 Arabidopsis thaliana Uod-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778887 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 980 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTCGAGAGTACG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 980 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549209 SAMEA2778885 3702 Arabidopsis thaliana Ull2-3_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778885 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 978 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTCCACATGAGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 978 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549208 SAMEA2778884 3702 Arabidopsis thaliana Ull2-3_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778884 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 977 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTCATGTACAGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 977 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549207 SAMEA2778883 3702 Arabidopsis thaliana Tu-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778883 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 976 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTCAGTATGCAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 976 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549206 SAMEA2778882 3702 Arabidopsis thaliana Tu-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778882 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 975 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTCAATGACTCA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 975 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549205 SAMEA2778881 3702 Arabidopsis thaliana Tsu-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778881 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 974 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTATGCTTGATG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 974 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549204 SAMEA2778880 3702 Arabidopsis thaliana Ts-5_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778880 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 973 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTATCTAGCGAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 973 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549203 SAMEA2778879 3702 Arabidopsis thaliana Ts-5_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778879 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 972 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTATCAGTGTAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 972 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549202 SAMEA2778878 3702 Arabidopsis thaliana Ts-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778878 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 971 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTATAGTCGTGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 971 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549226 SAMEA2778902 3702 Arabidopsis thaliana Vinslov_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778902 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 995 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTGGCTGTATGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 995 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549225 SAMEA2778901 3702 Arabidopsis thaliana Vinslov_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778901 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 994 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTGGAGCATGAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 994 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549224 SAMEA2778900 3702 Arabidopsis thaliana Vimmerby_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778900 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 993 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTGGACTCATAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 993 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549210 SAMEA2778886 3702 Arabidopsis thaliana Uod-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778886 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 979 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTCCTACTGTCT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 979 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549212 SAMEA2778888 3702 Arabidopsis thaliana Uod-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778888 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 981 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTCGATTAGATC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 981 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549213 SAMEA2778889 3702 Arabidopsis thaliana Uod-2_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778889 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 982 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTCGCACATATA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 982 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549214 SAMEA2778890 3702 Arabidopsis thaliana Uod-7_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778890 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 983 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTCGTGGAGTAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 983 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549215 SAMEA2778891 3702 Arabidopsis thaliana Uod-7_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778891 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 984 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTCTCTACCTGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 984 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549216 SAMEA2778892 3702 Arabidopsis thaliana Van-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778892 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 985 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTCTGAAGTCTA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 985 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549217 SAMEA2778893 3702 Arabidopsis thaliana Van-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778893 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 986 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTCTGCTAGCCT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 986 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549218 SAMEA2778894 3702 Arabidopsis thaliana Var2-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778894 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 987 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTGAACGCTAGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 987 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549219 SAMEA2778895 3702 Arabidopsis thaliana Var2-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778895 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 988 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTGACACGACAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 988 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549220 SAMEA2778896 3702 Arabidopsis thaliana Var2-6_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778896 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 989 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTGAGATACGCG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 989 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549221 SAMEA2778897 3702 Arabidopsis thaliana Vastervik_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778897 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 990 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTGAGCAGAGTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 990 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549222 SAMEA2778898 3702 Arabidopsis thaliana Vastervik_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778898 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 991 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTGCAGTACTTA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 991 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549223 SAMEA2778899 3702 Arabidopsis thaliana Vimmerby_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778899 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 992 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTGCTGCGAAGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 992 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549227 SAMEA2778903 3702 Arabidopsis thaliana Wa-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778903 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 996 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTGTATCGTATG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 996 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549228 SAMEA2778904 3702 Arabidopsis thaliana Wei-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778904 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 997 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTGTCTCTCCTA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 997 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549229 SAMEA2778905 3702 Arabidopsis thaliana Wei-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778905 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 998 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTGTGACATTGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 998 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549230 SAMEA2778906 3702 Arabidopsis thaliana Ws-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778906 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 999 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTGTGGATCGAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 999 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549231 SAMEA2778907 3702 Arabidopsis thaliana Nfa-10_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778907 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1000 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTGAGAGAAGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1000 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549232 SAMEA2778908 3702 Arabidopsis thaliana Fly2-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778908 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1001 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTGCGATGCGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1001 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549233 SAMEA2778909 3702 Arabidopsis thaliana Kas-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778909 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 1002 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTGGATGCTCT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1002 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549234 SAMEA2778910 3702 Arabidopsis thaliana Can-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778910 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1003 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTGTCACGGTG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1003 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549236 SAMEA2778912 3702 Arabidopsis thaliana Pu2-7_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778912 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 1005 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTTAGTGCGTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1005 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549237 SAMEA2778913 3702 Arabidopsis thaliana Pa-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778913 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 1006 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTTCAGACGCT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1006 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549238 SAMEA2778914 3702 Arabidopsis thaliana Wt-5_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778914 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 1007 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTTCTACGTCA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1007 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549235 SAMEA2778911 3702 Arabidopsis thaliana Draiii-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778911 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1004 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTGTTCGATCG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1004 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549239 SAMEA2778915 3702 Arabidopsis thaliana En-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778915 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 1008 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATAATCTCGTCG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1008 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549240 SAMEA2778916 3702 Arabidopsis thaliana Hov4-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778916 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 1009 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATACACGTGGCG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1009 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549241 SAMEA2778917 3702 Arabidopsis thaliana An-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778917 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 1010 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATACAGAGCTCC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1010 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549242 SAMEA2778918 3702 Arabidopsis thaliana Mr-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778918 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 1011 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATACGTCTTCGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1011 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549243 SAMEA2778919 3702 Arabidopsis thaliana Rd-0_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778919 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 1012 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATACTATTGCGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1012 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549244 SAMEA2778920 3702 Arabidopsis thaliana Per-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778920 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 1013 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATACTCACTCAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1013 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549245 SAMEA2778921 3702 Arabidopsis thaliana Sq-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778921 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 1014 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATAGCTCCATAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1014 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549246 SAMEA2778922 3702 Arabidopsis thaliana Ba1-2_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778922 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 1015 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATAGGCGATCTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1015 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549247 SAMEA2778923 3702 Arabidopsis thaliana Per-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778923 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 1016 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATATCGCTACTG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1016 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549248 SAMEA2778924 3702 Arabidopsis thaliana Hsm_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778924 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 1017 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATATGCCAGTGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1017 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549249 SAMEA2778925 3702 Arabidopsis thaliana Petergof_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778925 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 1018 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCACTAGTCAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1018 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549250 SAMEA2778926 3702 Arabidopsis thaliana Bor-4_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778926 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 1019 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCAGGCGTGTG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1019 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549251 SAMEA2778927 3702 Arabidopsis thaliana Se-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778927 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1020 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCCGATCACAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1020 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549252 SAMEA2778928 3702 Arabidopsis thaliana Hr-10_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778928 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1021 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCCTCAGTAGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1021 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549253 SAMEA2778929 3702 Arabidopsis thaliana Gu-0_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778929 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 1022 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCGATCTGTGG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1022 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549254 SAMEA2778930 3702 Arabidopsis thaliana Lund_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778930 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 1023 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCGCGGACGAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1023 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549255 SAMEA2778931 3702 Arabidopsis thaliana Vastervik_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778931 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1024 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCGCTCGAGGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1024 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549256 SAMEA2778932 3702 Arabidopsis thaliana Santa_clara_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778932 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 1025 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCGTACAACTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1025 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549257 SAMEA2778933 3702 Arabidopsis thaliana Nw-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778933 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1026 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCTACTACACG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1026 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549258 SAMEA2778934 3702 Arabidopsis thaliana Petergof_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778934 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 1027 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCTCTGGCATA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1027 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549259 SAMEA2778935 3702 Arabidopsis thaliana Lip-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778935 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1028 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCTGAGCTGGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1028 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549260 SAMEA2778936 3702 Arabidopsis thaliana Ga-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778936 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1029 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCTGGTGCTAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1029 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549261 SAMEA2778937 3702 Arabidopsis thaliana Pu2-8_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778937 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1030 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCTTAGACTGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1030 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549262 SAMEA2778938 3702 Arabidopsis thaliana Ren-11_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778938 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1031 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGACCATCGTG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1031 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549263 SAMEA2778939 3702 Arabidopsis thaliana Bg-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778939 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1032 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGACTCATTCG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1032 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549264 SAMEA2778940 3702 Arabidopsis thaliana Ba5-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778940 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 1033 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGAGACTCCAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1033 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549265 SAMEA2778941 3702 Arabidopsis thaliana Ws-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778941 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 1034 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGATCGAGAGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1034 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549266 SAMEA2778942 3702 Arabidopsis thaliana Dem-4_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778942 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1035 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGCACTGGCGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1035 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549267 SAMEA2778943 3702 Arabidopsis thaliana Kz-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778943 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1036 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGCAGCTCAGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1036 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549268 SAMEA2778944 3702 Arabidopsis thaliana Lp2-6_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778944 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1037 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGCCTGAGCAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1037 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549269 SAMEA2778945 3702 Arabidopsis thaliana Ra-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778945 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1038 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGCGTAGTGCG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1038 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549270 SAMEA2778946 3702 Arabidopsis thaliana Ull2-3_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778946 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 1039 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGGATACGCTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1039 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549271 SAMEA2778947 3702 Arabidopsis thaliana Var2-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778947 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 1040 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGGCAGCTCTA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1040 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549272 SAMEA2778948 3702 Arabidopsis thaliana Col-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778948 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 1041 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGGCGTGCACA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1041 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549273 SAMEA2778949 3702 Arabidopsis thaliana Buckhorn_pass_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778949 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 1042 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGGTCTACTAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1042 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549274 SAMEA2778950 3702 Arabidopsis thaliana Tsu-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778950 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 1043 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGTACGGCGAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1043 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549275 SAMEA2778951 3702 Arabidopsis thaliana Ts-5_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778951 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 1044 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGTCACCGTGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1044 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549276 SAMEA2778952 3702 Arabidopsis thaliana Hov4-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778952 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 1045 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGTGCACGACT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1045 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549277 SAMEA2778953 3702 Arabidopsis thaliana Jm-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778953 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 1046 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGTGTCGACTT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1046 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549278 SAMEA2778954 3702 Arabidopsis thaliana Eden-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778954 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 1047 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATTATCGTGCAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1047 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549279 SAMEA2778955 3702 Arabidopsis thaliana Lis-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778955 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 1048 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATTCTGTGAGCG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1048 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549280 SAMEA2778956 3702 Arabidopsis thaliana Ren-11_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778956 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 1049 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAACACGCACGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1049 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549281 SAMEA2778957 3702 Arabidopsis thaliana Br-0_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778957 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 1050 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAACTATCAGCT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1050 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549282 SAMEA2778958 3702 Arabidopsis thaliana Bro1-6_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778958 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 1051 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAACTCATCGTA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1051 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549286 SAMEA2778962 3702 Arabidopsis thaliana Yo-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778962 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 1055 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACAGCTCGAAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1055 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549287 SAMEA2778963 3702 Arabidopsis thaliana Uod-7_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778963 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 1056 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACAGTGGACGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1056 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549288 SAMEA2778964 3702 Arabidopsis thaliana Bil-5_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778964 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 1057 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACATCTAACAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1057 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549283 SAMEA2778959 3702 Arabidopsis thaliana Gd-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778959 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 1052 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAAGATCGACTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1052 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549284 SAMEA2778960 3702 Arabidopsis thaliana Eden-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778960 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 1053 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAAGTGAGAGAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1053 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549285 SAMEA2778961 3702 Arabidopsis thaliana Var2-6_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778961 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 1054 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACACGTGAGCA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1054 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549289 SAMEA2778965 3702 Arabidopsis thaliana Fja1-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778965 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1058 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACATTGTGAGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1058 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549290 SAMEA2778966 3702 Arabidopsis thaliana Sf-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778966 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1059 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACGACAGGCTA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1059 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549291 SAMEA2778967 3702 Arabidopsis thaliana Ga-0_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778967 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1060 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACGGACTATAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1060 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549292 SAMEA2778968 3702 Arabidopsis thaliana Sap-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778968 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1061 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACGTCGATGGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1061 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549293 SAMEA2778969 3702 Arabidopsis thaliana Nfa-8_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778969 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1062 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACGTGACATGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1062 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549294 SAMEA2778970 3702 Arabidopsis thaliana Yo-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778970 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 1063 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACTACTGTTGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1063 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549295 SAMEA2778971 3702 Arabidopsis thaliana Got-7_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778971 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1064 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACTCAACAGAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1064 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549296 SAMEA2778972 3702 Arabidopsis thaliana Kelsterbach-4_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778972 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 1065 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACTCTGATTAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1065 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549297 SAMEA2778973 3702 Arabidopsis thaliana Rmx-a180_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778973 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 1066 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACTGGTATATC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1066 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549298 SAMEA2778974 3702 Arabidopsis thaliana Koln_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778974 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1067 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACTGTAGGACG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1067 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549299 SAMEA2778975 3702 Arabidopsis thaliana Tamm-2_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778975 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1068 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGACATTGCGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1068 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549300 SAMEA2778976 3702 Arabidopsis thaliana Sav-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778976 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1069 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGACTCGCAGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1069 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549301 SAMEA2778977 3702 Arabidopsis thaliana Lp2-6_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778977 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 1070 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGAGGAGCTCT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1070 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549302 SAMEA2778978 3702 Arabidopsis thaliana Ag-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778978 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1071 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGATACACTTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1071 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549303 SAMEA2778979 3702 Arabidopsis thaliana Mz-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778979 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 1072 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGATCGGATCG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1072 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549304 SAMEA2778980 3702 Arabidopsis thaliana Ws-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778980 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1073 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGCACTAAGCG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1073 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549305 SAMEA2778981 3702 Arabidopsis thaliana Pi-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778981 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1074 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGCATGTGTTG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1074 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549306 SAMEA2778982 3702 Arabidopsis thaliana Rmx-a180_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778982 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1075 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGCGGTGACAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1075 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549307 SAMEA2778983 3702 Arabidopsis thaliana Ei-2_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778983 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 1076 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGCTAGAACGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1076 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549308 SAMEA2778984 3702 Arabidopsis thaliana Na-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778984 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 1077 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGGTGCTACTA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1077 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549309 SAMEA2778985 3702 Arabidopsis thaliana Lip-0_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778985 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 1078 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGTACGATCTT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1078 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549310 SAMEA2778986 3702 Arabidopsis thaliana Lu-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778986 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 1079 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGTCACTAACG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1079 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549311 SAMEA2778987 3702 Arabidopsis thaliana Uod-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778987 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 1080 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGTCGAAGCTG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1080 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549312 SAMEA2778988 3702 Arabidopsis thaliana Pro-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778988 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 1081 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGTGATCCTAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1081 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549313 SAMEA2778989 3702 Arabidopsis thaliana Ost-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778989 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 1082 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGTGCATATGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1082 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549314 SAMEA2778990 3702 Arabidopsis thaliana Pna-17_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778990 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 1083 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGTGTCAGGAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1083 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549315 SAMEA2778991 3702 Arabidopsis thaliana Gul1-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778991 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 1084 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATACCAGTAGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1084 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549316 SAMEA2778992 3702 Arabidopsis thaliana Is-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778992 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 1085 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATAGACGTTCG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1085 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549317 SAMEA2778993 3702 Arabidopsis thaliana Ka-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778993 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 1086 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATAGCGAGTTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1086 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549318 SAMEA2778994 3702 Arabidopsis thaliana Kz-13_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778994 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 1087 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATATACTCGCA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1087 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549319 SAMEA2778995 3702 Arabidopsis thaliana Est-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778995 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 1088 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATATCGCAGTT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1088 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549320 SAMEA2778996 3702 Arabidopsis thaliana Kz-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778996 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 1089 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATCAGCGTGTA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1089 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549321 SAMEA2778997 3702 Arabidopsis thaliana Wa-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778997 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 1090 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATCATGAGGCT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1090 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549322 SAMEA2778998 3702 Arabidopsis thaliana Jm-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778998 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 1091 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATCGTATCAAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1091 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549323 SAMEA2778999 3702 Arabidopsis thaliana H55_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778999 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 1092 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATCTGTAGCGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1092 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549324 SAMEA2779000 3702 Arabidopsis thaliana Uod-7_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779000 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 1093 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATGAGTGCTAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1093 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549325 SAMEA2779001 3702 Arabidopsis thaliana Vinslov_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779001 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 1094 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATGCAGACTGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1094 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549326 SAMEA2779002 3702 Arabidopsis thaliana Kondara_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779002 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 1095 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AACGCACGCTAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1095 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549327 SAMEA2779003 3702 Arabidopsis thaliana Zdr-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779003 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 1096 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AACTCGTCGATG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1096 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549328 SAMEA2779004 3702 Arabidopsis thaliana Hs-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779004 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1097 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AACTGTGCGTAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1097 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549329 SAMEA2779005 3702 Arabidopsis thaliana Kno-18_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779005 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 1098 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AAGAGATGTCGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1098 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549330 SAMEA2779006 3702 Arabidopsis thaliana Wei-0_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779006 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 1099 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AAGCTGCAGTCG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1099 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549331 SAMEA2779007 3702 Arabidopsis thaliana Ms-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779007 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 1100 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AATCAGTCTCGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1100 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549332 SAMEA2779008 3702 Arabidopsis thaliana Ka-0_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779008 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 1101 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AATCGTGACTCG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1101 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549333 SAMEA2779009 3702 Arabidopsis thaliana Nyl-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779009 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1102 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACACACTATGGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1102 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549334 SAMEA2779010 3702 Arabidopsis thaliana Lm-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779010 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 1103 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACACATGTCTAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1103 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549335 SAMEA2779011 3702 Arabidopsis thaliana Zdr-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779011 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 1104 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACACGAGCCACA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1104 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549336 SAMEA2779012 3702 Arabidopsis thaliana Phw-34_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779012 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 1105 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACACGGTGTCTA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1105 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549337 SAMEA2779013 3702 Arabidopsis thaliana Bu-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779013 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 1106 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACACTAGATCCG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1106 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549338 SAMEA2779014 3702 Arabidopsis thaliana Tu-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779014 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 1107 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACACTGTTCATG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1107 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549339 SAMEA2779015 3702 Arabidopsis thaliana Van-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779015 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 1108 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACAGACCACTCA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1108 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549340 SAMEA2779016 3702 Arabidopsis thaliana Boo2-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779016 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 1109 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACAGAGTCGGCT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1109 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549341 SAMEA2779017 3702 Arabidopsis thaliana Kavlinge-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779017 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 1110 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACAGCAGTGGTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1110 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549342 SAMEA2779018 3702 Arabidopsis thaliana Nyl-2_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779018 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1111 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACAGCTAGCTTG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1111 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549343 SAMEA2779019 3702 Arabidopsis thaliana Nc-6_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779019 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1112 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACAGTGCTTCAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1112 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549344 SAMEA2779020 3702 Arabidopsis thaliana Can-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779020 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1113 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACAGTTGCGCGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1113 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549345 SAMEA2779021 3702 Arabidopsis thaliana Hod_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779021 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1114 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACATCACTTAGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1114 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549346 SAMEA2779022 3702 Arabidopsis thaliana Draii-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779022 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 1115 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACATGATCGTTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1115 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549347 SAMEA2779023 3702 Arabidopsis thaliana Lov-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779023 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 1116 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACATGTCACGTG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1116 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549348 SAMEA2779024 3702 Arabidopsis thaliana Eds-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779024 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 1117 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACATTCAGCGCA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1117 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549349 SAMEA2779025 3702 Arabidopsis thaliana Co_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779025 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 1118 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACCACATACATC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1118 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549350 SAMEA2779026 3702 Arabidopsis thaliana Zdr-6_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779026 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 1119 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACCAGACGATGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1119 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549351 SAMEA2779027 3702 Arabidopsis thaliana Blh-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779027 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 1120 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACCAGCGACTAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1120 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549352 SAMEA2779028 3702 Arabidopsis thaliana Sf-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779028 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 1121 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACCGCAGAGTCA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1121 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549353 SAMEA2779029 3702 Arabidopsis thaliana Fei-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779029 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 1122 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACCTCGATCAGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1122 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549354 SAMEA2779030 3702 Arabidopsis thaliana Bs-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779030 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1123 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACCTGTCTCTCT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1123 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549355 SAMEA2779031 3702 Arabidopsis thaliana Ull1-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779031 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1124 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGACGTCTTAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1124 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549356 SAMEA2779032 3702 Arabidopsis thaliana H55_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779032 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 1125 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGAGTGCTATC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1125 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549357 SAMEA2779033 3702 Arabidopsis thaliana Bur-0_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779033 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1126 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGATGCGACCA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1126 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549358 SAMEA2779034 3702 Arabidopsis thaliana En-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779034 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1127 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGCAACTGCTA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1127 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549359 SAMEA2779035 3702 Arabidopsis thaliana Pi-0_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779035 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 1128 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGCGATACTGG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1128 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549360 SAMEA2779036 3702 Arabidopsis thaliana Bil-5_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779036 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 1129 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGCGCAGATAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1129 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549361 SAMEA2779037 3702 Arabidopsis thaliana Spr1-6_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779037 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 1130 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGCTATCTGGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1130 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549362 SAMEA2779038 3702 Arabidopsis thaliana Kent_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779038 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1131 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGCTCATGGAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1131 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549363 SAMEA2779039 3702 Arabidopsis thaliana Lp2-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779039 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1132 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGGATCGTCAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1132 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549364 SAMEA2779040 3702 Arabidopsis thaliana Wt-5_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779040 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 1133 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGGTGAGTGTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1133 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549365 SAMEA2779041 3702 Arabidopsis thaliana Pu2-23_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779041 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1134 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGTACTCAGTG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1134 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549366 SAMEA2779042 3702 Arabidopsis thaliana Est-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779042 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1135 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGTCTGTAGCA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1135 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549367 SAMEA2779043 3702 Arabidopsis thaliana Ba3-3_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779043 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 1136 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGTGAGAGAAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1136 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549368 SAMEA2779044 3702 Arabidopsis thaliana Got-7_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779044 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 1137 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGTGCCGTAGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1137 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549369 SAMEA2779045 3702 Arabidopsis thaliana Lis-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779045 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1138 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGTTAGCACAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1138 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549370 SAMEA2779046 3702 Arabidopsis thaliana Spr1-6_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779046 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 1139 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTACAGCCTAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1139 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549371 SAMEA2779047 3702 Arabidopsis thaliana Cibc-17_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779047 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 1140 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTACGTGTGGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1140 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549372 SAMEA2779048 3702 Arabidopsis thaliana Spr1-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779048 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1141 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTAGCTCCATA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1141 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549373 SAMEA2779049 3702 Arabidopsis thaliana Lz-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779049 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1142 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTATTGTCACG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1142 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549374 SAMEA2779050 3702 Arabidopsis thaliana Kni-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779050 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1143 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTCACGGTATG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1143 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549375 SAMEA2779051 3702 Arabidopsis thaliana N13_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779051 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 1144 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTCGATTCGAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1144 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549376 SAMEA2779052 3702 Arabidopsis thaliana Eden-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779052 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 1145 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTCGCACAGGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1145 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549378 SAMEA2779054 3702 Arabidopsis thaliana San-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779054 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 1147 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTGACAGCCAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1147 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549379 SAMEA2779055 3702 Arabidopsis thaliana Is-0_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779055 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 1148 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTGATCCTAGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1148 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549380 SAMEA2779056 3702 Arabidopsis thaliana Pro-0_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779056 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 1149 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTGTACGCGTA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1149 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549381 SAMEA2779057 3702 Arabidopsis thaliana Col-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779057 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 1150 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTGTCGAAGCT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1150 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549382 SAMEA2779058 3702 Arabidopsis thaliana Cibc-17_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779058 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1151 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTGTGACTTCA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1151 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549377 SAMEA2779053 3702 Arabidopsis thaliana Lm-2_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779053 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 1146 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTCTTCTAGAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1146 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549383 SAMEA2779059 3702 Arabidopsis thaliana Tu-0_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779059 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 1152 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTTGTAGCAGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1152 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549384 SAMEA2779060 3702 Arabidopsis thaliana Pna-17_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779060 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1153 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGAACACGTCTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1153 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549385 SAMEA2779061 3702 Arabidopsis thaliana Sorbo_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779061 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 1154 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGACCGTCAGAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1154 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549386 SAMEA2779062 3702 Arabidopsis thaliana Fab-4_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779062 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1155 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGACGTGCACTG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1155 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549387 SAMEA2779063 3702 Arabidopsis thaliana Ren-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779063 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1156 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGACTGCGTACT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1156 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549388 SAMEA2779064 3702 Arabidopsis thaliana Ba4-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779064 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1157 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGAGAGCAAGTG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1157 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549389 SAMEA2779065 3702 Arabidopsis thaliana Edi-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779065 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 1158 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGAGCAAGAGCA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1158 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549390 SAMEA2779066 3702 Arabidopsis thaliana Lom1-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779066 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 1159 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGAGTAGCTAAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1159 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549391 SAMEA2779067 3702 Arabidopsis thaliana Rrs-7_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779067 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 1160 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGAGTCCTGAGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1160 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549392 SAMEA2779068 3702 Arabidopsis thaliana Sav-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779068 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 1161 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGATACACGCGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1161 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549393 SAMEA2779069 3702 Arabidopsis thaliana Rak-2_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779069 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 1162 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGATCGGCTCGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1162 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549394 SAMEA2779070 3702 Arabidopsis thaliana Ang-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779070 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 1163 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGATCTCTGCAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1163 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549395 SAMEA2779071 3702 Arabidopsis thaliana Santa_clara_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779071 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 1164 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGATGTTCTGCT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1164 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549396 SAMEA2779072 3702 Arabidopsis thaliana Fei-0_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779072 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1165 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCACACCTACA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1165 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549397 SAMEA2779073 3702 Arabidopsis thaliana Lis-2_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779073 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 1166 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCACGAGCCTA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1166 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549398 SAMEA2779074 3702 Arabidopsis thaliana Hr-10_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779074 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 1167 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCAGCACTTGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1167 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549399 SAMEA2779075 3702 Arabidopsis thaliana Edi-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779075 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 1168 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCAGTCGCGAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1168 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549400 SAMEA2779076 3702 Arabidopsis thaliana Oy-0_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779076 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 1169 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCATATGAGAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1169 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549401 SAMEA2779077 3702 Arabidopsis thaliana Fab-2_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779077 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 1170 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCCATACTGAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1170 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549402 SAMEA2779078 3702 Arabidopsis thaliana Duk_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779078 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 1171 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCGACTGTGCA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1171 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549403 SAMEA2779079 3702 Arabidopsis thaliana Kni-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779079 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1172 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCGAGCTATCT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1172 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549404 SAMEA2779080 3702 Arabidopsis thaliana Got-22_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779080 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 1173 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCGCTGATGTG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1173 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549405 SAMEA2779081 3702 Arabidopsis thaliana Bg-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779081 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:18Z INSDC status public Submitter Id 1174 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCGTAGGTCGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1174 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549406 SAMEA2779082 3702 Arabidopsis thaliana Duk_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779082 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:18Z INSDC status public Submitter Id 1175 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCTATCCACGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1175 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549407 SAMEA2779083 3702 Arabidopsis thaliana Hi-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779083 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 1176 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCTCCATACAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1176 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549408 SAMEA2779084 3702 Arabidopsis thaliana Hov2-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779084 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 1177 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCTCTCAGAGG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1177 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549409 SAMEA2779085 3702 Arabidopsis thaliana Dra3-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779085 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 1178 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCTGACTAGTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1178 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549410 SAMEA2779086 3702 Arabidopsis thaliana Rrs-7_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779086 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 1179 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCTTGACAGCT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1179 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549411 SAMEA2779087 3702 Arabidopsis thaliana Rubezhnoe-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779087 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 1180 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGGACGCACTGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1180 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549412 SAMEA2779088 3702 Arabidopsis thaliana Ang-0_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779088 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 1181 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGGCTACACGAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1181 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549413 SAMEA2779089 3702 Arabidopsis thaliana San-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779089 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 1182 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGGTGTGATCGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1182 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549414 SAMEA2779090 3702 Arabidopsis thaliana Eden-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779090 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 1183 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTACGCTCGAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1183 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549415 SAMEA2779091 3702 Arabidopsis thaliana Nw-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779091 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 1184 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTACTGCAGGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1184 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549416 SAMEA2779092 3702 Arabidopsis thaliana Bla-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779092 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 1185 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTAGTATCCTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1185 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549417 SAMEA2779093 3702 Arabidopsis thaliana Rmx-a02_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779093 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 1186 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTCACATCACT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1186 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549418 SAMEA2779094 3702 Arabidopsis thaliana Lom1-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779094 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:18Z INSDC status public Submitter Id 1187 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTCCATAGCTG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1187 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549419 SAMEA2779095 3702 Arabidopsis thaliana Sanna-2_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779095 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:18Z INSDC status public Submitter Id 1188 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTCTACTCTGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1188 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549420 SAMEA2779096 3702 Arabidopsis thaliana An-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779096 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:18Z INSDC status public Submitter Id 1189 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTCTCGCATAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1189 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549421 SAMEA2779097 3702 Arabidopsis thaliana Lov-5_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779097 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:18Z INSDC status public Submitter Id 1190 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AACGCACGCTAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1190 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549422 SAMEA2779098 3702 Arabidopsis thaliana Cibc-5_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779098 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 1191 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AACTGTGCGTAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1191 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549423 SAMEA2779099 3702 Arabidopsis thaliana Cibc-5_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779099 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 1192 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AAGCTGCAGTCG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1192 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549424 SAMEA2779100 3702 Arabidopsis thaliana Bil-7_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779100 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 1193 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AATCGTGACTCG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1193 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549425 SAMEA2779101 3702 Arabidopsis thaliana Hr-5_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779101 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 1194 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACACATGTCTAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1194 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549426 SAMEA2779102 3702 Arabidopsis thaliana Hr-5_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779102 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:18Z INSDC status public Submitter Id 1195 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACACGGTGTCTA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1195 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549427 SAMEA2779103 3702 Arabidopsis thaliana Kno-10_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779103 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 1196 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACACTGTTCATG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1196 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549428 SAMEA2779104 3702 Arabidopsis thaliana Kno-10_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779104 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 1197 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACAGAGTCGGCT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1197 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549429 SAMEA2779105 3702 Arabidopsis thaliana Kz-9_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779105 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:18Z INSDC status public Submitter Id 1198 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACAGCTAGCTTG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1198 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549430 SAMEA2779106 3702 Arabidopsis thaliana Kz-9_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779106 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 1199 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACAGTTGCGCGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1199 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549431 SAMEA2779107 3702 Arabidopsis thaliana Mrk-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779107 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 1200 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACATGATCGTTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1200 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549432 SAMEA2779108 3702 Arabidopsis thaliana Mrk-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779108 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 1201 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACATTCAGCGCA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1201 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549433 SAMEA2779109 3702 Arabidopsis thaliana Mz-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779109 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:18Z INSDC status public Submitter Id 1202 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACCAGACGATGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1202 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549434 SAMEA2779110 3702 Arabidopsis thaliana Mz-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779110 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 1203 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACCGCAGAGTCA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1203 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549435 SAMEA2779111 3702 Arabidopsis thaliana Nd-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779111 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:18Z INSDC status public Submitter Id 1204 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACCTGTCTCTCT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1204 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549436 SAMEA2779112 3702 Arabidopsis thaliana Nd-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779112 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 1205 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGAGTGCTATC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1205 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549437 SAMEA2779113 3702 Arabidopsis thaliana Ull2-5_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779113 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 1206 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGCAACTGCTA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1206 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549438 SAMEA2779114 3702 Arabidopsis thaliana Ull2-5_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779114 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 1207 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGCGCAGATAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1207 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549439 SAMEA2779115 3702 Arabidopsis thaliana Rrs-10_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779115 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 1208 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGCTCATGGAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1208 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549440 SAMEA2779116 3702 Arabidopsis thaliana Rrs-10_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779116 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 1209 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGGTGAGTGTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1209 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549441 SAMEA2779117 3702 Arabidopsis thaliana Omo2-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779117 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 1210 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGTCTGTAGCA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1210 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549442 SAMEA2779118 3702 Arabidopsis thaliana Omo2-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779118 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 1211 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGTGCCGTAGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1211 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549443 SAMEA2779119 3702 Arabidopsis thaliana Bil-7_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779119 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 1212 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTACAGCCTAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1212 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549444 SAMEA2779120 3702 Arabidopsis thaliana Kin-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779120 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:18Z INSDC status public Submitter Id 1213 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTAGCTCCATA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1213 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549445 SAMEA2779121 3702 Arabidopsis thaliana Kin-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779121 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:18Z INSDC status public Submitter Id 1214 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTCACGGTATG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1214 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549446 SAMEA2779122 3702 Arabidopsis thaliana Lov-5_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779122 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:18Z INSDC status public Submitter Id 1215 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTCGATTCGAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1215 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549447 SAMEA2779123 3702 Arabidopsis thaliana Lov-5_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779123 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:18Z INSDC status public Submitter Id 1216 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTCTTCTAGAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1216 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549448 SAMEA2779124 3702 Arabidopsis thaliana Cibc-5_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779124 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 1217 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTGATCCTAGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1217 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549449 SAMEA2779125 3702 Arabidopsis thaliana Hr-5_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779125 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 1218 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTGTCGAAGCT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1218 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549450 SAMEA2779126 3702 Arabidopsis thaliana Hr-5_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779126 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 1219 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTTGTAGCAGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1219 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549451 SAMEA2779127 3702 Arabidopsis thaliana Kno-10_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779127 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 1220 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGACCGTCAGAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1220 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549452 SAMEA2779128 3702 Arabidopsis thaliana Kno-10_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779128 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 1221 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGACTGCGTACT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1221 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549453 SAMEA2779129 3702 Arabidopsis thaliana Kz-9_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779129 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 1222 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGAGCAAGAGCA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1222 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549454 SAMEA2779130 3702 Arabidopsis thaliana Kz-9_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779130 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 1223 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGAGTCCTGAGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1223 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549455 SAMEA2779131 3702 Arabidopsis thaliana Mrk-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779131 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 1224 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGATCGGCTCGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1224 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549456 SAMEA2779132 3702 Arabidopsis thaliana Mrk-0_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779132 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 1225 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGATGTTCTGCT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1225 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549457 SAMEA2779133 3702 Arabidopsis thaliana Bil-7_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779133 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 1226 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCACGAGCCTA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1226 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549458 SAMEA2779134 3702 Arabidopsis thaliana Bil-7_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779134 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 1227 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCAGTCGCGAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1227 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549459 SAMEA2779135 3702 Arabidopsis thaliana Mz-0_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779135 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 1228 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCCATACTGAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1228 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548232 SAMEA2777908 3702 Arabidopsis thaliana Br-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777908 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 1 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTGAGAGAAGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548233 SAMEA2777909 3702 Arabidopsis thaliana Rak-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777909 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 2 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTGCGATGCGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 2 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548234 SAMEA2777910 3702 Arabidopsis thaliana Mt-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777910 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 3 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTGGATGCTCT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 3 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548235 SAMEA2777911 3702 Arabidopsis thaliana Fab-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777911 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 4 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTGTCACGGTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 4 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548236 SAMEA2777912 3702 Arabidopsis thaliana Dem-4_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777912 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 5 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTGTTCGATCG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 5 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548237 SAMEA2777913 3702 Arabidopsis thaliana Vastervik_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777913 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 6 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTTAGTGCGTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 6 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548238 SAMEA2777914 3702 Arabidopsis thaliana Na-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777914 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 7 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTTCAGACGCT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 7 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548239 SAMEA2777915 3702 Arabidopsis thaliana Tsu-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777915 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 8 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTTCTACGTCA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 8 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548240 SAMEA2777916 3702 Arabidopsis thaliana Sorbo_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777916 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 9 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATAATCTCGTCG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 9 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548241 SAMEA2777917 3702 Arabidopsis thaliana Sq-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777917 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 10 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATACACGTGGCG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 10 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548242 SAMEA2777918 3702 Arabidopsis thaliana St-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777918 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 11 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATACAGAGCTCC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 11 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548243 SAMEA2777919 3702 Arabidopsis thaliana Kulturen-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777919 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 12 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATACGTCTTCGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 12 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548244 SAMEA2777920 3702 Arabidopsis thaliana Gr-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777920 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 13 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATACTATTGCGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 13 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548245 SAMEA2777921 3702 Arabidopsis thaliana Ba3-3_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777921 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 14 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATACTCACTCAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 14 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548246 SAMEA2777922 3702 Arabidopsis thaliana Cen-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777922 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 15 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATAGCTCCATAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 15 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548247 SAMEA2777923 3702 Arabidopsis thaliana Kavlinge-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777923 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 16 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATAGGCGATCTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 16 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548248 SAMEA2777924 3702 Arabidopsis thaliana Pna-10_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777924 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 17 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATATCGCTACTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 17 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548249 SAMEA2777925 3702 Arabidopsis thaliana Sanna-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777925 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 18 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATATGCCAGTGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 18 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548250 SAMEA2777926 3702 Arabidopsis thaliana Tottarp-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777926 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 19 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCACGTAGCGG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 19 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548251 SAMEA2777927 3702 Arabidopsis thaliana Mt-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777927 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 20 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCACTAGTCAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 20 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548252 SAMEA2777928 3702 Arabidopsis thaliana Tamm-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777928 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 21 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCAGGCGTGTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 21 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548253 SAMEA2777929 3702 Arabidopsis thaliana Ts-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777929 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 22 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCCGATCACAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 22 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548254 SAMEA2777930 3702 Arabidopsis thaliana Hsm_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777930 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 23 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCCTCAGTAGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 23 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548255 SAMEA2777931 3702 Arabidopsis thaliana Ost-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777931 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 24 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCGATCTGTGG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 24 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548256 SAMEA2777932 3702 Arabidopsis thaliana Or-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777932 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 25 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCGCGGACGAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 25 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548257 SAMEA2777933 3702 Arabidopsis thaliana Mr-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777933 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 26 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCGCTCGAGGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 26 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548258 SAMEA2777934 3702 Arabidopsis thaliana Var2-6_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777934 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 27 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCGTACAACTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 27 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548259 SAMEA2777935 3702 Arabidopsis thaliana Ge-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777935 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 28 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCTACTACACG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 28 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548260 SAMEA2777936 3702 Arabidopsis thaliana Vinslov_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777936 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 29 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCTCTGGCATA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 29 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548261 SAMEA2777937 3702 Arabidopsis thaliana Seattle-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777937 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 30 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCTGAGCTGGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 30 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548262 SAMEA2777938 3702 Arabidopsis thaliana Bur-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777938 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 31 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCTGGTGCTAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 31 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548263 SAMEA2777939 3702 Arabidopsis thaliana Ct-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777939 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 32 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCTTAGACTGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 32 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548264 SAMEA2777940 3702 Arabidopsis thaliana Kz-13_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777940 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 33 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGACTCATTCG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 33 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548265 SAMEA2777941 3702 Arabidopsis thaliana Alc-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777941 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 34 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGAGACTCCAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 34 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548266 SAMEA2777942 3702 Arabidopsis thaliana Lc-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777942 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 35 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGATCGAGAGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 35 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548267 SAMEA2777943 3702 Arabidopsis thaliana Rsch-4_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777943 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 36 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGCACTGGCGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 36 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548268 SAMEA2777944 3702 Arabidopsis thaliana Sq-8_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777944 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 37 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGCAGCTCAGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 37 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548269 SAMEA2777945 3702 Arabidopsis thaliana Ull1-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777945 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 38 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGCCTGAGCAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 38 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548270 SAMEA2777946 3702 Arabidopsis thaliana Stu1-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777946 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 39 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGCGTAGTGCG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 39 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548271 SAMEA2777947 3702 Arabidopsis thaliana St-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777947 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 40 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGGATACGCTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 40 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548272 SAMEA2777948 3702 Arabidopsis thaliana Hov2-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777948 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 41 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGGCAGCTCTA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 41 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548273 SAMEA2777949 3702 Arabidopsis thaliana Eds-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777949 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 42 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGGCGTGCACA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 42 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548274 SAMEA2777950 3702 Arabidopsis thaliana Hod_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777950 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 43 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGGTCTACTAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 43 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548275 SAMEA2777951 3702 Arabidopsis thaliana Ba1-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777951 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 44 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGTACGGCGAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 44 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548276 SAMEA2777952 3702 Arabidopsis thaliana Buckhorn_pass_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777952 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 45 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGTCACCGTGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 45 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548277 SAMEA2777953 3702 Arabidopsis thaliana Vimmerby_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777953 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 46 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGTGCACGACT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 46 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548278 SAMEA2777954 3702 Arabidopsis thaliana Rsch-4_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777954 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 47 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGTGTCGACTT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 47 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548279 SAMEA2777955 3702 Arabidopsis thaliana Tamm-27_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777955 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 48 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATTATCGTGCAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 48 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548280 SAMEA2777956 3702 Arabidopsis thaliana Sr_5_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777956 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 49 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATTCTGTGAGCG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 49 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548281 SAMEA2777957 3702 Arabidopsis thaliana Bor-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777957 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 50 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAACACGCACGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 50 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548282 SAMEA2777958 3702 Arabidopsis thaliana Nok-3_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777958 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 51 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAACTATCAGCT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 51 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548283 SAMEA2777959 3702 Arabidopsis thaliana Stu1-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777959 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 52 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAACTCATCGTA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 52 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548284 SAMEA2777960 3702 Arabidopsis thaliana Draii-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777960 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 53 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAAGATCGACTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 53 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548285 SAMEA2777961 3702 Arabidopsis thaliana Kas-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777961 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 54 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAAGTGAGAGAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 54 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548286 SAMEA2777962 3702 Arabidopsis thaliana Hovdala-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777962 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 55 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACACGTGAGCA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 55 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548287 SAMEA2777963 3702 Arabidopsis thaliana Algutsrum_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777963 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 56 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACAGCTCGAAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 56 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548288 SAMEA2777964 3702 Arabidopsis thaliana Omo2-3_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777964 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 57 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACAGTGGACGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 57 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548289 SAMEA2777965 3702 Arabidopsis thaliana Rev-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777965 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 58 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACATCTAACAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 58 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548290 SAMEA2777966 3702 Arabidopsis thaliana Uod-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777966 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 59 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACATTGTGAGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 59 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548291 SAMEA2777967 3702 Arabidopsis thaliana Pna-10_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777967 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 60 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACGACAGGCTA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 60 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548292 SAMEA2777968 3702 Arabidopsis thaliana Stw-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777968 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 61 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACGGACTATAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 61 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548293 SAMEA2777969 3702 Arabidopsis thaliana Fja1-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777969 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 62 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACGTCGATGGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 62 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548294 SAMEA2777970 3702 Arabidopsis thaliana Co_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777970 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 63 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACGTGACATGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 63 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548295 SAMEA2777971 3702 Arabidopsis thaliana Bs-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777971 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 64 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACTACTGTTGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 64 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548296 SAMEA2777972 3702 Arabidopsis thaliana Se-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777972 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 65 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACTCAACAGAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 65 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548297 SAMEA2777973 3702 Arabidopsis thaliana Bor-4_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777973 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 66 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACTCTGATTAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 66 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548298 SAMEA2777974 3702 Arabidopsis thaliana Ba5-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777974 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 67 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACTGGTATATC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 67 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548299 SAMEA2777975 3702 Arabidopsis thaliana Ts-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777975 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:18Z INSDC status public Submitter Id 68 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACTGTAGGACG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 68 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548300 SAMEA2777976 3702 Arabidopsis thaliana Gul1-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777976 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:18Z INSDC status public Submitter Id 69 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGACATTGCGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 69 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548301 SAMEA2777977 3702 Arabidopsis thaliana Rubezhnoe-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777977 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 70 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGACTCGCAGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 70 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548302 SAMEA2777978 3702 Arabidopsis thaliana Algutsrum_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777978 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 71 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGAGGAGCTCT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 71 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548303 SAMEA2777979 3702 Arabidopsis thaliana Kno-18_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777979 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 72 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGATACACTTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 72 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548304 SAMEA2777980 3702 Arabidopsis thaliana Draiii-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777980 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 73 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGATCGGATCG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 73 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548305 SAMEA2777981 3702 Arabidopsis thaliana Or-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777981 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 74 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGCATGTGTTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 74 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548306 SAMEA2777982 3702 Arabidopsis thaliana Ll-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777982 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 75 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGCGGTGACAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 75 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548307 SAMEA2777983 3702 Arabidopsis thaliana Sr_5_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777983 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 76 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGCTAGAACGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 76 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548308 SAMEA2777984 3702 Arabidopsis thaliana Dra3-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777984 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 77 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGGTGCTACTA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 77 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548309 SAMEA2777985 3702 Arabidopsis thaliana Gu-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777985 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 78 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGTACGATCTT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 78 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548310 SAMEA2777986 3702 Arabidopsis thaliana Ler-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777986 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 79 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGTCACTAACG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 79 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548311 SAMEA2777987 3702 Arabidopsis thaliana Ei-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777987 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 80 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGTCGAAGCTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 80 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548312 SAMEA2777988 3702 Arabidopsis thaliana Kelsterbach-4_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777988 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 81 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGTGATCCTAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 81 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548313 SAMEA2777989 3702 Arabidopsis thaliana Uod-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777989 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:18Z INSDC status public Submitter Id 82 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGTGCATATGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 82 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548314 SAMEA2777990 3702 Arabidopsis thaliana Ge-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777990 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:18Z INSDC status public Submitter Id 83 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGTGTCAGGAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 83 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548315 SAMEA2777991 3702 Arabidopsis thaliana Lov-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777991 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 84 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATACCAGTAGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 84 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548316 SAMEA2777992 3702 Arabidopsis thaliana Wei-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777992 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 85 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATAGACGTTCG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 85 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548317 SAMEA2777993 3702 Arabidopsis thaliana Uod-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777993 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:18Z INSDC status public Submitter Id 86 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATAGCGAGTTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 86 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548318 SAMEA2777994 3702 Arabidopsis thaliana Omo2-3_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777994 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 87 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATATACTCGCA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 87 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548319 SAMEA2777995 3702 Arabidopsis thaliana In-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777995 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 88 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATATCGCAGTT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 88 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548320 SAMEA2777996 3702 Arabidopsis thaliana Nc-6_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777996 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 89 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATCAGCGTGTA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 89 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548321 SAMEA2777997 3702 Arabidopsis thaliana Boo2-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777997 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 90 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATCATGAGGCT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 90 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548322 SAMEA2777998 3702 Arabidopsis thaliana Rd-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777998 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 91 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATCGTATCAAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 91 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548323 SAMEA2777999 3702 Arabidopsis thaliana Nok-3_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2777999 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 92 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATCTGTAGCGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 92 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548324 SAMEA2778000 3702 Arabidopsis thaliana Oy-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778000 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 93 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATGAGTGCTAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 93 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548325 SAMEA2778001 3702 Arabidopsis thaliana Var2-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778001 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 94 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATGCAGACTGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 94 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548326 SAMEA2778002 3702 Arabidopsis thaliana Ag-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778002 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 95 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AACGCACGCTAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 95 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548327 SAMEA2778003 3702 Arabidopsis thaliana Ag-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778003 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 96 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AACTCGTCGATG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 96 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548328 SAMEA2778004 3702 Arabidopsis thaliana Algutsrum_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778004 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 97 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AACTGTGCGTAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 97 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548329 SAMEA2778005 3702 Arabidopsis thaliana Algutsrum_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778005 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 98 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AAGAGATGTCGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 98 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548330 SAMEA2778006 3702 Arabidopsis thaliana An-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778006 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:18Z INSDC status public Submitter Id 99 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AAGCTGCAGTCG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 99 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548331 SAMEA2778007 3702 Arabidopsis thaliana An-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778007 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 100 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AATCAGTCTCGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 100 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548332 SAMEA2778008 3702 Arabidopsis thaliana Ang-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778008 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 101 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AATCGTGACTCG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 101 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548333 SAMEA2778009 3702 Arabidopsis thaliana Ang-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778009 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 102 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACACACTATGGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 102 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548334 SAMEA2778010 3702 Arabidopsis thaliana Ba1-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778010 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 103 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACACATGTCTAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 103 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548335 SAMEA2778011 3702 Arabidopsis thaliana Ba1-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778011 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 104 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACACGAGCCACA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 104 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548336 SAMEA2778012 3702 Arabidopsis thaliana Ba3-3_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778012 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 105 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACACGGTGTCTA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 105 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548337 SAMEA2778013 3702 Arabidopsis thaliana Ba3-3_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778013 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 106 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACACTAGATCCG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 106 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548338 SAMEA2778014 3702 Arabidopsis thaliana Ba4-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778014 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 107 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACACTGTTCATG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 107 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548339 SAMEA2778015 3702 Arabidopsis thaliana Ba4-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778015 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 108 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACAGACCACTCA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 108 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548340 SAMEA2778016 3702 Arabidopsis thaliana Ba5-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778016 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 109 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACAGAGTCGGCT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 109 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548342 SAMEA2778018 3702 Arabidopsis thaliana Bg-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778018 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 111 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACAGCTAGCTTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 111 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548343 SAMEA2778019 3702 Arabidopsis thaliana Bil-5_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778019 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 112 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACAGTGCTTCAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 112 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548344 SAMEA2778020 3702 Arabidopsis thaliana Bla-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778020 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 113 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACATCACTTAGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 113 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548345 SAMEA2778021 3702 Arabidopsis thaliana Blh-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778021 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 114 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACATGATCGTTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 114 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548346 SAMEA2778022 3702 Arabidopsis thaliana Boo2-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778022 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 115 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACATGTCACGTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 115 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548341 SAMEA2778017 3702 Arabidopsis thaliana Ba5-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778017 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 110 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACAGCAGTGGTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 110 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548347 SAMEA2778023 3702 Arabidopsis thaliana Boo2-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778023 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 116 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACATTCAGCGCA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 116 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548348 SAMEA2778024 3702 Arabidopsis thaliana Bor-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778024 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 117 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACCACATACATC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 117 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548349 SAMEA2778025 3702 Arabidopsis thaliana Bor-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778025 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 118 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACCAGACGATGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 118 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548350 SAMEA2778026 3702 Arabidopsis thaliana Bor-4_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778026 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 119 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACCAGCGACTAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 119 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548351 SAMEA2778027 3702 Arabidopsis thaliana Bor-4_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778027 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 120 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACCGCAGAGTCA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 120 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548352 SAMEA2778028 3702 Arabidopsis thaliana Br-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778028 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 121 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACCTCGATCAGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 121 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548353 SAMEA2778029 3702 Arabidopsis thaliana Br-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778029 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 122 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACCTGTCTCTCT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 122 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548354 SAMEA2778030 3702 Arabidopsis thaliana Bro1-6_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778030 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 123 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGACGTCTTAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 123 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548355 SAMEA2778031 3702 Arabidopsis thaliana Bro1-6_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778031 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 124 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGAGTGCTATC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 124 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548356 SAMEA2778032 3702 Arabidopsis thaliana Bs-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778032 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 125 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGATGCGACCA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 125 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548357 SAMEA2778033 3702 Arabidopsis thaliana Bs-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778033 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 126 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGCAACTGCTA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 126 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548358 SAMEA2778034 3702 Arabidopsis thaliana Bu-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778034 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 127 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGCGATACTGG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 127 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548359 SAMEA2778035 3702 Arabidopsis thaliana Bu-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778035 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 128 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGCGCAGATAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 128 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548360 SAMEA2778036 3702 Arabidopsis thaliana Bur-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778036 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 129 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGCTATCTGGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 129 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548361 SAMEA2778037 3702 Arabidopsis thaliana Bur-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778037 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 130 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGCTCATGGAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 130 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548362 SAMEA2778038 3702 Arabidopsis thaliana Can-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778038 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 131 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGGATCGTCAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 131 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548363 SAMEA2778039 3702 Arabidopsis thaliana Cen-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778039 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 132 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGGTGAGTGTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 132 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548364 SAMEA2778040 3702 Arabidopsis thaliana Cen-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778040 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 133 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGTACTCAGTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 133 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548365 SAMEA2778041 3702 Arabidopsis thaliana Cibc-17_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778041 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 134 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGTCTGTAGCA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 134 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548366 SAMEA2778042 3702 Arabidopsis thaliana Cibc-17_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778042 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 135 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGTGAGAGAAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 135 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548367 SAMEA2778043 3702 Arabidopsis thaliana Cibc-5_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778043 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 136 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGTGCCGTAGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 136 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548368 SAMEA2778044 3702 Arabidopsis thaliana Col-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778044 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 137 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGTTAGCACAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 137 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548369 SAMEA2778045 3702 Arabidopsis thaliana N13_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778045 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 138 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTACAGCCTAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 138 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548370 SAMEA2778046 3702 Arabidopsis thaliana N13_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778046 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 139 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTACGTGTGGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 139 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548371 SAMEA2778047 3702 Arabidopsis thaliana Phw-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778047 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 140 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTAGCTCCATA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 140 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548372 SAMEA2778048 3702 Arabidopsis thaliana Phw-34_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778048 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 141 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTATTGTCACG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 141 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548373 SAMEA2778049 3702 Arabidopsis thaliana Phw-34_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778049 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:18Z INSDC status public Submitter Id 142 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTCACGGTATG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 142 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548374 SAMEA2778050 3702 Arabidopsis thaliana Kelsterbach-4_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778050 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 143 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTCAGATACTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 143 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548375 SAMEA2778051 3702 Arabidopsis thaliana Kelsterbach-4_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778051 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 144 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTCGATTCGAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 144 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548376 SAMEA2778052 3702 Arabidopsis thaliana Seattle-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778052 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 145 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTCGCACAGGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 145 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548377 SAMEA2778053 3702 Arabidopsis thaliana Dem-4_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778053 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 146 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTCTTCTAGAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 146 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548378 SAMEA2778054 3702 Arabidopsis thaliana Dem-4_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778054 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 147 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTGACAGCCAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 147 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548379 SAMEA2778055 3702 Arabidopsis thaliana Dra3-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778055 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 148 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTGATCCTAGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 148 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548380 SAMEA2778056 3702 Arabidopsis thaliana Dra3-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778056 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 149 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTGTACGCGTA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 149 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548381 SAMEA2778057 3702 Arabidopsis thaliana Draii-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778057 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 150 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTGTCGAAGCT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 150 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548382 SAMEA2778058 3702 Arabidopsis thaliana Draii-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778058 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 151 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTGTGACTTCA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 151 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548383 SAMEA2778059 3702 Arabidopsis thaliana Draiii-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778059 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 152 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTTGTAGCAGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 152 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548384 SAMEA2778060 3702 Arabidopsis thaliana Draiii-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778060 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 153 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGAACACGTCTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 153 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548385 SAMEA2778061 3702 Arabidopsis thaliana Duk_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778061 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 154 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGACCGTCAGAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 154 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548386 SAMEA2778062 3702 Arabidopsis thaliana Duk_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778062 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 155 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGACGTGCACTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 155 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548387 SAMEA2778063 3702 Arabidopsis thaliana Eden-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778063 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 156 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGACTGCGTACT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 156 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548388 SAMEA2778064 3702 Arabidopsis thaliana Eden-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778064 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 157 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGAGAGCAAGTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 157 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548389 SAMEA2778065 3702 Arabidopsis thaliana Edi-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778065 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 158 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGAGCAAGAGCA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 158 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548390 SAMEA2778066 3702 Arabidopsis thaliana Eds-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778066 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 159 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGAGTAGCTAAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 159 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548391 SAMEA2778067 3702 Arabidopsis thaliana Eds-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778067 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 160 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGAGTCCTGAGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 160 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548392 SAMEA2778068 3702 Arabidopsis thaliana Ei-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778068 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 161 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGATACACGCGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 161 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548393 SAMEA2778069 3702 Arabidopsis thaliana Ei-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778069 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 162 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGATCGGCTCGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 162 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548394 SAMEA2778070 3702 Arabidopsis thaliana En-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778070 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 163 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGATCTCTGCAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 163 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548395 SAMEA2778071 3702 Arabidopsis thaliana Est-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778071 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 164 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGATGTTCTGCT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 164 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548396 SAMEA2778072 3702 Arabidopsis thaliana Est-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778072 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 165 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCACACCTACA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 165 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548397 SAMEA2778073 3702 Arabidopsis thaliana Fab-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778073 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 166 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCACGAGCCTA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 166 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548398 SAMEA2778074 3702 Arabidopsis thaliana Fab-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778074 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 167 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCAGCACTTGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 167 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548399 SAMEA2778075 3702 Arabidopsis thaliana Fab-4_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778075 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 168 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCAGTCGCGAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 168 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548400 SAMEA2778076 3702 Arabidopsis thaliana Fab-4_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778076 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 169 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCATATGAGAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 169 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548401 SAMEA2778077 3702 Arabidopsis thaliana Fei-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778077 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 170 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCCATACTGAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 170 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548402 SAMEA2778078 3702 Arabidopsis thaliana Fei-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778078 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 171 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCGACTGTGCA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 171 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548403 SAMEA2778079 3702 Arabidopsis thaliana Fja1-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778079 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 172 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCGAGCTATCT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 172 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548404 SAMEA2778080 3702 Arabidopsis thaliana Fja1-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778080 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 173 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCGCTGATGTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 173 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548405 SAMEA2778081 3702 Arabidopsis thaliana Fly2-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778081 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 174 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCGTAGGTCGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 174 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548407 SAMEA2778083 3702 Arabidopsis thaliana Ga-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778083 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 176 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCTCCATACAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 176 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548408 SAMEA2778084 3702 Arabidopsis thaliana Gd-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778084 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 177 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCTCTCAGAGG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 177 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548409 SAMEA2778085 3702 Arabidopsis thaliana Gd-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778085 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 178 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCTGACTAGTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 178 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548410 SAMEA2778086 3702 Arabidopsis thaliana Ge-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778086 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 179 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCTTGACAGCT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 179 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548411 SAMEA2778087 3702 Arabidopsis thaliana Got-7_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778087 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 180 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGGACGCACTGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 180 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548412 SAMEA2778088 3702 Arabidopsis thaliana Got-7_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778088 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 181 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGGCTACACGAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 181 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548413 SAMEA2778089 3702 Arabidopsis thaliana Gr-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778089 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 182 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGGTGTGATCGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 182 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548414 SAMEA2778090 3702 Arabidopsis thaliana Gr-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778090 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 183 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTACGCTCGAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 183 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548415 SAMEA2778091 3702 Arabidopsis thaliana Gu-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778091 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 184 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTACTGCAGGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 184 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548416 SAMEA2778092 3702 Arabidopsis thaliana Gu-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778092 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 185 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTAGTATCCTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 185 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548417 SAMEA2778093 3702 Arabidopsis thaliana Gul1-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778093 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 186 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTCACATCACT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 186 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548418 SAMEA2778094 3702 Arabidopsis thaliana H55_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778094 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 187 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTCCATAGCTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 187 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548419 SAMEA2778095 3702 Arabidopsis thaliana H55_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778095 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 188 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTCTACTCTGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 188 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548420 SAMEA2778096 3702 Arabidopsis thaliana Hi-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778096 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 189 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTCTCGCATAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 189 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548421 SAMEA2778097 3702 Arabidopsis thaliana Hod_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778097 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 190 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTGAGAGAAGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 190 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548422 SAMEA2778098 3702 Arabidopsis thaliana Hod_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778098 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 191 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTGCGATGCGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 191 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548423 SAMEA2778099 3702 Arabidopsis thaliana Hov2-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778099 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 192 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTGGATGCTCT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 192 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548424 SAMEA2778100 3702 Arabidopsis thaliana Hov2-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778100 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 193 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTGTCACGGTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 193 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548425 SAMEA2778101 3702 Arabidopsis thaliana Hov4-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778101 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 194 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTGTTCGATCG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 194 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548426 SAMEA2778102 3702 Arabidopsis thaliana Hov4-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778102 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 195 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTTAGTGCGTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 195 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548427 SAMEA2778103 3702 Arabidopsis thaliana Hovdala-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778103 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 196 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTTCAGACGCT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 196 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548428 SAMEA2778104 3702 Arabidopsis thaliana Hovdala-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778104 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 197 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTTCTACGTCA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 197 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548429 SAMEA2778105 3702 Arabidopsis thaliana Hr-10_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778105 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 198 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATAATCTCGTCG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 198 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548430 SAMEA2778106 3702 Arabidopsis thaliana Hr-10_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778106 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 199 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATACACGTGGCG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 199 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548431 SAMEA2778107 3702 Arabidopsis thaliana Hs-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778107 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 200 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATACGTCTTCGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 200 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548432 SAMEA2778108 3702 Arabidopsis thaliana Hs-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778108 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 201 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATACTATTGCGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 201 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548433 SAMEA2778109 3702 Arabidopsis thaliana Hsm_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778109 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 202 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATACTCACTCAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 202 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548434 SAMEA2778110 3702 Arabidopsis thaliana Hsm_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778110 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 203 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATAGCTCCATAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 203 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548435 SAMEA2778111 3702 Arabidopsis thaliana In-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778111 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 204 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATAGGCGATCTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 204 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548436 SAMEA2778112 3702 Arabidopsis thaliana In-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778112 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 205 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATATCGCTACTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 205 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548437 SAMEA2778113 3702 Arabidopsis thaliana Is-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778113 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 206 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATATGCCAGTGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 206 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548439 SAMEA2778115 3702 Arabidopsis thaliana Jm-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778115 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 208 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCACTAGTCAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 208 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548440 SAMEA2778116 3702 Arabidopsis thaliana Ka-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778116 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 209 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCAGGCGTGTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 209 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548441 SAMEA2778117 3702 Arabidopsis thaliana Ka-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778117 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 210 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCCGATCACAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 210 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548442 SAMEA2778118 3702 Arabidopsis thaliana Kas-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778118 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 211 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCCTCAGTAGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 211 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548443 SAMEA2778119 3702 Arabidopsis thaliana Kavlinge-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778119 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 212 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCGATCTGTGG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 212 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548444 SAMEA2778120 3702 Arabidopsis thaliana Kent_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778120 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 213 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCGCGGACGAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 213 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548445 SAMEA2778121 3702 Arabidopsis thaliana Kent_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778121 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 214 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCGCTCGAGGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 214 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548446 SAMEA2778122 3702 Arabidopsis thaliana Kni-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778122 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 215 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCGTACAACTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 215 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548447 SAMEA2778123 3702 Arabidopsis thaliana Kno-18_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778123 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 216 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCTACTACACG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 216 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548448 SAMEA2778124 3702 Arabidopsis thaliana Koln_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778124 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 217 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCTCTGGCATA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 217 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548449 SAMEA2778125 3702 Arabidopsis thaliana Koln_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778125 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 218 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCTGAGCTGGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 218 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548450 SAMEA2778126 3702 Arabidopsis thaliana Kondara_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778126 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 219 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCTGGTGCTAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 219 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548451 SAMEA2778127 3702 Arabidopsis thaliana Kondara_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778127 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 220 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCTTAGACTGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 220 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548452 SAMEA2778128 3702 Arabidopsis thaliana Kulturen-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778128 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 221 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGACCATCGTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 221 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548453 SAMEA2778129 3702 Arabidopsis thaliana Kulturen-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778129 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 222 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGACTCATTCG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 222 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548454 SAMEA2778130 3702 Arabidopsis thaliana Kz-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778130 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 223 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGAGACTCCAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 223 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548455 SAMEA2778131 3702 Arabidopsis thaliana Kz-13_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778131 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 224 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGATCGAGAGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 224 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548456 SAMEA2778132 3702 Arabidopsis thaliana Kz-13_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778132 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 225 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGCACTGGCGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 225 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548457 SAMEA2778133 3702 Arabidopsis thaliana Lc-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778133 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 226 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGCAGCTCAGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 226 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548458 SAMEA2778134 3702 Arabidopsis thaliana Lc-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778134 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:18Z INSDC status public Submitter Id 227 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGCCTGAGCAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 227 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548459 SAMEA2778135 3702 Arabidopsis thaliana Ler-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778135 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:18Z INSDC status public Submitter Id 228 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGCGTAGTGCG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 228 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548460 SAMEA2778136 3702 Arabidopsis thaliana Ler-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778136 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 229 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGGATACGCTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 229 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548461 SAMEA2778137 3702 Arabidopsis thaliana Liarum_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778137 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 230 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGGCAGCTCTA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 230 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548462 SAMEA2778138 3702 Arabidopsis thaliana Liarum_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778138 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 231 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGGCGTGCACA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 231 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548463 SAMEA2778139 3702 Arabidopsis thaliana Lillo-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778139 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 232 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGGTCTACTAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 232 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548464 SAMEA2778140 3702 Arabidopsis thaliana Lillo-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778140 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 233 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGTACGGCGAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 233 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548465 SAMEA2778141 3702 Arabidopsis thaliana Lip-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778141 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 234 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGTCACCGTGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 234 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548466 SAMEA2778142 3702 Arabidopsis thaliana Lip-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778142 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:18Z INSDC status public Submitter Id 235 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGTGCACGACT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 235 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548467 SAMEA2778143 3702 Arabidopsis thaliana Lis-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778143 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:18Z INSDC status public Submitter Id 236 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGTGTCGACTT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 236 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548468 SAMEA2778144 3702 Arabidopsis thaliana Lis-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778144 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:18Z INSDC status public Submitter Id 237 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATTATCGTGCAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 237 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548469 SAMEA2778145 3702 Arabidopsis thaliana Lis-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778145 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 238 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATTCTGTGAGCG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 238 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548470 SAMEA2778146 3702 Arabidopsis thaliana Lis-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778146 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 239 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAACACGCACGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 239 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548472 SAMEA2778148 3702 Arabidopsis thaliana Ll-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778148 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:18Z INSDC status public Submitter Id 241 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAACTCATCGTA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 241 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548473 SAMEA2778149 3702 Arabidopsis thaliana Lm-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778149 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:18Z INSDC status public Submitter Id 242 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAAGATCGACTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 242 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548474 SAMEA2778150 3702 Arabidopsis thaliana Lm-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778150 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:18Z INSDC status public Submitter Id 243 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAAGTGAGAGAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 243 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548475 SAMEA2778151 3702 Arabidopsis thaliana Lom1-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778151 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:18Z INSDC status public Submitter Id 244 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACACGTGAGCA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 244 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548476 SAMEA2778152 3702 Arabidopsis thaliana Lov-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778152 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 245 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACAGCTCGAAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 245 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548477 SAMEA2778153 3702 Arabidopsis thaliana Lov-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778153 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:18Z INSDC status public Submitter Id 246 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACAGTGGACGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 246 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548478 SAMEA2778154 3702 Arabidopsis thaliana Lp2-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778154 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 247 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACATCTAACAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 247 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548479 SAMEA2778155 3702 Arabidopsis thaliana Lp2-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778155 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:18Z INSDC status public Submitter Id 248 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACATTGTGAGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 248 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548480 SAMEA2778156 3702 Arabidopsis thaliana Lp2-6_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778156 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 249 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACGACAGGCTA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 249 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548481 SAMEA2778157 3702 Arabidopsis thaliana Lp2-6_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778157 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 250 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACGGACTATAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 250 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548482 SAMEA2778158 3702 Arabidopsis thaliana Lu-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778158 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 251 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACGTCGATGGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 251 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548483 SAMEA2778159 3702 Arabidopsis thaliana Lu-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778159 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 252 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACGTGACATGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 252 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548484 SAMEA2778160 3702 Arabidopsis thaliana Lund_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778160 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 253 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACTACTGTTGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 253 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548485 SAMEA2778161 3702 Arabidopsis thaliana Lund_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778161 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 254 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACTCAACAGAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 254 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548486 SAMEA2778162 3702 Arabidopsis thaliana Lz-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778162 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 255 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACTCTGATTAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 255 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548487 SAMEA2778163 3702 Arabidopsis thaliana Lz-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778163 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:18Z INSDC status public Submitter Id 256 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACTGGTATATC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 256 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548488 SAMEA2778164 3702 Arabidopsis thaliana Mir-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778164 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 257 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACTGTAGGACG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 257 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548489 SAMEA2778165 3702 Arabidopsis thaliana Ms-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778165 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 258 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGACATTGCGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 258 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548490 SAMEA2778166 3702 Arabidopsis thaliana Ms-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778166 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:18Z INSDC status public Submitter Id 259 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGACTCGCAGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 259 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548491 SAMEA2778167 3702 Arabidopsis thaliana Mt-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778167 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 260 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGAGGAGCTCT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 260 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548492 SAMEA2778168 3702 Arabidopsis thaliana Mt-0_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778168 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 261 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGATACACTTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 261 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548493 SAMEA2778169 3702 Arabidopsis thaliana Na-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778169 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 262 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGATCGGATCG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 262 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548495 SAMEA2778171 3702 Arabidopsis thaliana Nc-6_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778171 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 264 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGCATGTGTTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 264 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548496 SAMEA2778172 3702 Arabidopsis thaliana Nc-6_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778172 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 265 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGCGGTGACAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 265 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548497 SAMEA2778173 3702 Arabidopsis thaliana Nfa-10_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778173 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 266 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGCTAGAACGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 266 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548498 SAMEA2778174 3702 Arabidopsis thaliana Nfa-8_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778174 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:18Z INSDC status public Submitter Id 267 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGGTGCTACTA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 267 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548499 SAMEA2778175 3702 Arabidopsis thaliana Nok-3_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778175 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 268 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGTACGATCTT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 268 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548501 SAMEA2778177 3702 Arabidopsis thaliana Nw-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778177 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 270 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGTCGAAGCTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 270 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548502 SAMEA2778178 3702 Arabidopsis thaliana Nyl-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778178 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 271 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGTGATCCTAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 271 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548503 SAMEA2778179 3702 Arabidopsis thaliana Nyl-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778179 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 272 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGTGCATATGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 272 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548504 SAMEA2778180 3702 Arabidopsis thaliana Omo2-3_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778180 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 273 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGTGTCAGGAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 273 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548505 SAMEA2778181 3702 Arabidopsis thaliana Omo2-3_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778181 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 274 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATACCAGTAGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 274 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548506 SAMEA2778182 3702 Arabidopsis thaliana Or-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778182 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 275 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATAGACGTTCG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 275 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548507 SAMEA2778183 3702 Arabidopsis thaliana Or-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778183 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 276 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATAGCGAGTTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 276 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548508 SAMEA2778184 3702 Arabidopsis thaliana Ost-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778184 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 277 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATATACTCGCA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 277 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548509 SAMEA2778185 3702 Arabidopsis thaliana Oy-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778185 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 278 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATATCGCAGTT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 278 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548510 SAMEA2778186 3702 Arabidopsis thaliana Oy-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778186 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 279 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATCAGCGTGTA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 279 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548511 SAMEA2778187 3702 Arabidopsis thaliana Per-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778187 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 280 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATCATGAGGCT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 280 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548512 SAMEA2778188 3702 Arabidopsis thaliana Per-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778188 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 281 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATCGTATCAAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 281 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548513 SAMEA2778189 3702 Arabidopsis thaliana Petergof_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778189 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 282 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATCTGTAGCGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 282 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548514 SAMEA2778190 3702 Arabidopsis thaliana Petergof_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778190 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 283 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATGAGTGCTAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 283 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548515 SAMEA2778191 3702 Arabidopsis thaliana Pi-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778191 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 284 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATGCAGACTGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 284 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548516 SAMEA2778192 3702 Arabidopsis thaliana Pi-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778192 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 285 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AACGCACGCTAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 285 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548517 SAMEA2778193 3702 Arabidopsis thaliana Pna-10_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778193 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 286 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AACTCGTCGATG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 286 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548518 SAMEA2778194 3702 Arabidopsis thaliana Pna-10_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778194 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 287 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AACTGTGCGTAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 287 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548519 SAMEA2778195 3702 Arabidopsis thaliana Pna-17_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778195 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 288 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AAGAGATGTCGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 288 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548520 SAMEA2778196 3702 Arabidopsis thaliana Pro-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778196 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 289 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AAGCTGCAGTCG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 289 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548521 SAMEA2778197 3702 Arabidopsis thaliana Pro-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778197 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 290 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AATCAGTCTCGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 290 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548522 SAMEA2778198 3702 Arabidopsis thaliana Pu2-23_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778198 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 291 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AATCGTGACTCG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 291 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548523 SAMEA2778199 3702 Arabidopsis thaliana Pu2-23_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778199 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 292 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACACACTATGGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 292 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548524 SAMEA2778200 3702 Arabidopsis thaliana Pu2-7_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778200 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 293 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACACATGTCTAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 293 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548525 SAMEA2778201 3702 Arabidopsis thaliana Pu2-7_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778201 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 294 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACACGAGCCACA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 294 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548526 SAMEA2778202 3702 Arabidopsis thaliana Pu2-8_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778202 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 295 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACACGGTGTCTA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 295 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548527 SAMEA2778203 3702 Arabidopsis thaliana Pu2-8_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778203 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 296 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACACTAGATCCG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 296 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548528 SAMEA2778204 3702 Arabidopsis thaliana Ra-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778204 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 297 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACACTGTTCATG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 297 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548529 SAMEA2778205 3702 Arabidopsis thaliana Rak-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778205 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 298 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACAGACCACTCA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 298 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548530 SAMEA2778206 3702 Arabidopsis thaliana Rak-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778206 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 299 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACAGAGTCGGCT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 299 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548531 SAMEA2778207 3702 Arabidopsis thaliana Rd-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778207 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 300 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACAGCAGTGGTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 300 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548532 SAMEA2778208 3702 Arabidopsis thaliana Rd-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778208 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 301 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACAGCTAGCTTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 301 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548533 SAMEA2778209 3702 Arabidopsis thaliana Ren-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778209 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 302 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACAGTGCTTCAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 302 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548534 SAMEA2778210 3702 Arabidopsis thaliana Ren-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778210 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 303 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACAGTTGCGCGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 303 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548535 SAMEA2778211 3702 Arabidopsis thaliana Ren-11_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778211 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 304 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACATCACTTAGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 304 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548536 SAMEA2778212 3702 Arabidopsis thaliana Ren-11_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778212 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 305 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACATGATCGTTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 305 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548537 SAMEA2778213 3702 Arabidopsis thaliana Rev-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778213 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 306 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACATGTCACGTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 306 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548538 SAMEA2778214 3702 Arabidopsis thaliana Rev-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778214 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 307 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACATTCAGCGCA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 307 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548539 SAMEA2778215 3702 Arabidopsis thaliana Rmx-a02_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778215 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 308 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACCACATACATC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 308 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548540 SAMEA2778216 3702 Arabidopsis thaliana Rmx-a02_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778216 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 309 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACCAGACGATGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 309 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548541 SAMEA2778217 3702 Arabidopsis thaliana Rmx-a180_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778217 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 310 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACCAGCGACTAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 310 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548542 SAMEA2778218 3702 Arabidopsis thaliana Rmx-a180_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778218 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 311 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACCGCAGAGTCA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 311 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548543 SAMEA2778219 3702 Arabidopsis thaliana Rrs-7_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778219 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 312 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACCTCGATCAGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 312 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548544 SAMEA2778220 3702 Arabidopsis thaliana Rrs-7_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778220 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 313 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACCTGTCTCTCT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 313 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548545 SAMEA2778221 3702 Arabidopsis thaliana Rsch-4_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778221 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 314 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGACGTCTTAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 314 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548546 SAMEA2778222 3702 Arabidopsis thaliana Rsch-4_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778222 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 315 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGAGTGCTATC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 315 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548547 SAMEA2778223 3702 Arabidopsis thaliana Rubezhnoe-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778223 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 316 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGATGCGACCA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 316 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548548 SAMEA2778224 3702 Arabidopsis thaliana Rubezhnoe-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778224 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 317 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGCAACTGCTA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 317 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548549 SAMEA2778225 3702 Arabidopsis thaliana San-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778225 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 318 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGCGATACTGG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 318 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548550 SAMEA2778226 3702 Arabidopsis thaliana Sanna-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778226 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 319 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGCGCAGATAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 319 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548551 SAMEA2778227 3702 Arabidopsis thaliana Sanna-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778227 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 320 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGCTATCTGGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 320 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548552 SAMEA2778228 3702 Arabidopsis thaliana Santa_clara_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778228 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 321 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGCTCATGGAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 321 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548553 SAMEA2778229 3702 Arabidopsis thaliana Santa_clara_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778229 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 322 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGGATCGTCAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 322 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548554 SAMEA2778230 3702 Arabidopsis thaliana Sap-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778230 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 323 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGGTGAGTGTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 323 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548555 SAMEA2778231 3702 Arabidopsis thaliana Sap-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778231 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 324 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGTACTCAGTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 324 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548556 SAMEA2778232 3702 Arabidopsis thaliana Sav-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778232 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 325 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGTCTGTAGCA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 325 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548557 SAMEA2778233 3702 Arabidopsis thaliana Se-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778233 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 326 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGTGAGAGAAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 326 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548558 SAMEA2778234 3702 Arabidopsis thaliana Sf-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778234 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 327 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGTGCCGTAGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 327 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548559 SAMEA2778235 3702 Arabidopsis thaliana Sf-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778235 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 328 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGTTAGCACAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 328 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548560 SAMEA2778236 3702 Arabidopsis thaliana Shahdara_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778236 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 329 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTACAGCCTAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 329 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548561 SAMEA2778237 3702 Arabidopsis thaliana Sorbo_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778237 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 330 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTACGTGTGGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 330 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548562 SAMEA2778238 3702 Arabidopsis thaliana Spr1-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778238 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 331 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTAGCTCCATA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 331 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548563 SAMEA2778239 3702 Arabidopsis thaliana Spr1-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778239 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:14Z INSDC status public Submitter Id 332 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTATTGTCACG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 332 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548564 SAMEA2778240 3702 Arabidopsis thaliana Sq-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778240 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 333 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTCACGGTATG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 333 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548565 SAMEA2778241 3702 Arabidopsis thaliana Sq-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778241 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 334 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTCAGATACTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 334 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548566 SAMEA2778242 3702 Arabidopsis thaliana Sq-8_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778242 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 335 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTCGATTCGAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 335 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548567 SAMEA2778243 3702 Arabidopsis thaliana Sr5_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778243 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 336 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTCGCACAGGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 336 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548568 SAMEA2778244 3702 Arabidopsis thaliana Sr5_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778244 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 337 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTCTTCTAGAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 337 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548569 SAMEA2778245 3702 Arabidopsis thaliana St-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778245 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 338 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTGACAGCCAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 338 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548570 SAMEA2778246 3702 Arabidopsis thaliana St-0_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778246 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 339 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTGATCCTAGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 339 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548571 SAMEA2778247 3702 Arabidopsis thaliana Stu1-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778247 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 340 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTGTACGCGTA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 340 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548572 SAMEA2778248 3702 Arabidopsis thaliana Stu1-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778248 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 341 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTGTCGAAGCT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 341 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548573 SAMEA2778249 3702 Arabidopsis thaliana Stw-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778249 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 342 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTGTGACTTCA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 342 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548574 SAMEA2778250 3702 Arabidopsis thaliana Stw-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778250 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 343 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTTGTAGCAGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 343 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548575 SAMEA2778251 3702 Arabidopsis thaliana Ta-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778251 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 344 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGAACACGTCTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 344 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548576 SAMEA2778252 3702 Arabidopsis thaliana Ta-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778252 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 345 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGACCGTCAGAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 345 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548577 SAMEA2778253 3702 Arabidopsis thaliana Tamm-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778253 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 346 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGACGTGCACTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 346 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548578 SAMEA2778254 3702 Arabidopsis thaliana Tamm-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778254 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 347 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGACTGCGTACT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 347 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548579 SAMEA2778255 3702 Arabidopsis thaliana Tamm-27_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778255 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 348 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGAGAGCAAGTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 348 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548580 SAMEA2778256 3702 Arabidopsis thaliana Tamm-27_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778256 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 349 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGAGCAAGAGCA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 349 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548581 SAMEA2778257 3702 Arabidopsis thaliana Tottarp-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778257 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 350 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGAGTAGCTAAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 350 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548582 SAMEA2778258 3702 Arabidopsis thaliana Tottarp-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778258 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 351 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGAGTCCTGAGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 351 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548583 SAMEA2778259 3702 Arabidopsis thaliana Ts-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778259 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 352 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGATACACGCGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 352 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548584 SAMEA2778260 3702 Arabidopsis thaliana Ts-5_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778260 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 353 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGATCGGCTCGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 353 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548585 SAMEA2778261 3702 Arabidopsis thaliana Ts-5_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778261 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 354 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGATCTCTGCAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 354 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548586 SAMEA2778262 3702 Arabidopsis thaliana Tsu-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778262 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 355 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGATGTTCTGCT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 355 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548587 SAMEA2778263 3702 Arabidopsis thaliana Tu-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778263 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 356 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCACACCTACA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 356 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548588 SAMEA2778264 3702 Arabidopsis thaliana Tu-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778264 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 357 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCACGAGCCTA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 357 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548589 SAMEA2778265 3702 Arabidopsis thaliana Ull2-3_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778265 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 358 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCAGCACTTGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 358 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548590 SAMEA2778266 3702 Arabidopsis thaliana Ull2-3_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778266 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 359 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCAGTCGCGAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 359 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548591 SAMEA2778267 3702 Arabidopsis thaliana Uod-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778267 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 360 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCATATGAGAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 360 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548592 SAMEA2778268 3702 Arabidopsis thaliana Uod-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778268 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 361 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCCATACTGAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 361 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548593 SAMEA2778269 3702 Arabidopsis thaliana Uod-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778269 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 362 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCGACTGTGCA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 362 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548594 SAMEA2778270 3702 Arabidopsis thaliana Uod-2_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778270 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 363 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCGAGCTATCT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 363 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548595 SAMEA2778271 3702 Arabidopsis thaliana Uod-7_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778271 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 364 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCGCTGATGTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 364 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548596 SAMEA2778272 3702 Arabidopsis thaliana Uod-7_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778272 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 365 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCGTAGGTCGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 365 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548597 SAMEA2778273 3702 Arabidopsis thaliana Van-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778273 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 366 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCTATCCACGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 366 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548598 SAMEA2778274 3702 Arabidopsis thaliana Van-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778274 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 367 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCTCCATACAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 367 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548599 SAMEA2778275 3702 Arabidopsis thaliana Var2-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778275 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 368 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCTCTCAGAGG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 368 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548600 SAMEA2778276 3702 Arabidopsis thaliana Var2-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778276 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 369 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCTGACTAGTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 369 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548601 SAMEA2778277 3702 Arabidopsis thaliana Var2-6_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778277 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 370 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCTTGACAGCT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 370 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548602 SAMEA2778278 3702 Arabidopsis thaliana Vastervik_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778278 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 371 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGGACGCACTGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 371 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548603 SAMEA2778279 3702 Arabidopsis thaliana Vastervik_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778279 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 372 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGGCTACACGAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 372 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548604 SAMEA2778280 3702 Arabidopsis thaliana Vimmerby_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778280 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 373 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGGTGTGATCGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 373 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548605 SAMEA2778281 3702 Arabidopsis thaliana Vimmerby_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778281 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 374 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTACGCTCGAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 374 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548606 SAMEA2778282 3702 Arabidopsis thaliana Vinslov_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778282 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 375 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTACTGCAGGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 375 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548607 SAMEA2778283 3702 Arabidopsis thaliana Vinslov_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778283 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 376 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTAGTATCCTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 376 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548608 SAMEA2778284 3702 Arabidopsis thaliana Wa-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778284 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 377 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTCACATCACT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 377 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548609 SAMEA2778285 3702 Arabidopsis thaliana Wei-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778285 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 378 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTCCATAGCTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 378 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548610 SAMEA2778286 3702 Arabidopsis thaliana Wei-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778286 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 379 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTCTACTCTGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 379 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548611 SAMEA2778287 3702 Arabidopsis thaliana Ws-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778287 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 380 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTCTCGCATAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 380 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548612 SAMEA2778288 3702 Arabidopsis thaliana Nfa-10_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778288 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 381 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTGAGAGAAGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 381 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548613 SAMEA2778289 3702 Arabidopsis thaliana Fly2-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778289 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 382 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTGCGATGCGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 382 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548614 SAMEA2778290 3702 Arabidopsis thaliana Kas-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778290 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 383 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTGGATGCTCT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 383 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548616 SAMEA2778292 3702 Arabidopsis thaliana Draiii-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778292 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 385 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTGTTCGATCG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 385 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548617 SAMEA2778293 3702 Arabidopsis thaliana Pu2-7_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778293 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 386 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTTAGTGCGTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 386 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548618 SAMEA2778294 3702 Arabidopsis thaliana Pa-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778294 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 387 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTTCAGACGCT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 387 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548620 SAMEA2778296 3702 Arabidopsis thaliana En-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778296 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 389 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATAATCTCGTCG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 389 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548621 SAMEA2778297 3702 Arabidopsis thaliana Hov4-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778297 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 390 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATACACGTGGCG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 390 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548622 SAMEA2778298 3702 Arabidopsis thaliana An-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778298 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 391 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATACAGAGCTCC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 391 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548623 SAMEA2778299 3702 Arabidopsis thaliana Mr-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778299 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 392 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATACGTCTTCGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 392 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548624 SAMEA2778300 3702 Arabidopsis thaliana Rd-0_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778300 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 393 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATACTATTGCGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 393 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548625 SAMEA2778301 3702 Arabidopsis thaliana Per-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778301 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 394 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATACTCACTCAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 394 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548626 SAMEA2778302 3702 Arabidopsis thaliana Sq-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778302 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 395 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATAGCTCCATAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 395 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548627 SAMEA2778303 3702 Arabidopsis thaliana Ba1-2_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778303 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 396 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATAGGCGATCTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 396 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548628 SAMEA2778304 3702 Arabidopsis thaliana Per-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778304 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 397 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATATCGCTACTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 397 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548629 SAMEA2778305 3702 Arabidopsis thaliana Hsm_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778305 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 398 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATATGCCAGTGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 398 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548630 SAMEA2778306 3702 Arabidopsis thaliana Petergof_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778306 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 399 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCACTAGTCAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 399 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548631 SAMEA2778307 3702 Arabidopsis thaliana Bor-4_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778307 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 400 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCAGGCGTGTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 400 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548632 SAMEA2778308 3702 Arabidopsis thaliana Se-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778308 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 401 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCCGATCACAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 401 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548633 SAMEA2778309 3702 Arabidopsis thaliana Hr-10_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778309 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 402 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCCTCAGTAGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 402 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548634 SAMEA2778310 3702 Arabidopsis thaliana Gu-0_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778310 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 403 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCGATCTGTGG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 403 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548635 SAMEA2778311 3702 Arabidopsis thaliana Lund_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778311 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 404 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCGCGGACGAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 404 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548636 SAMEA2778312 3702 Arabidopsis thaliana Vastervik_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778312 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 405 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCGCTCGAGGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 405 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548637 SAMEA2778313 3702 Arabidopsis thaliana Santa_clara_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778313 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 406 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCGTACAACTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 406 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548638 SAMEA2778314 3702 Arabidopsis thaliana Nw-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778314 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 407 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCTACTACACG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 407 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548639 SAMEA2778315 3702 Arabidopsis thaliana Petergof_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778315 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 408 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCTCTGGCATA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 408 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548640 SAMEA2778316 3702 Arabidopsis thaliana Lip-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778316 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 409 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCTGAGCTGGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 409 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548641 SAMEA2778317 3702 Arabidopsis thaliana Ga-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778317 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 410 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCTGGTGCTAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 410 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548642 SAMEA2778318 3702 Arabidopsis thaliana Pu2-8_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778318 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 411 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCTTAGACTGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 411 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548643 SAMEA2778319 3702 Arabidopsis thaliana Ren-11_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778319 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 412 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGACCATCGTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 412 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548644 SAMEA2778320 3702 Arabidopsis thaliana Bg-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778320 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 413 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGACTCATTCG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 413 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548645 SAMEA2778321 3702 Arabidopsis thaliana Ba5-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778321 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 414 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGAGACTCCAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 414 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548646 SAMEA2778322 3702 Arabidopsis thaliana Ws-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778322 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 415 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGATCGAGAGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 415 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548647 SAMEA2778323 3702 Arabidopsis thaliana Dem-4_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778323 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 416 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGCACTGGCGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 416 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548648 SAMEA2778324 3702 Arabidopsis thaliana Kz-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778324 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 417 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGCAGCTCAGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 417 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548649 SAMEA2778325 3702 Arabidopsis thaliana Lp2-6_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778325 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 418 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGCCTGAGCAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 418 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548650 SAMEA2778326 3702 Arabidopsis thaliana Ra-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778326 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 419 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGCGTAGTGCG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 419 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548651 SAMEA2778327 3702 Arabidopsis thaliana Ull2-3_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778327 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 420 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGGATACGCTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 420 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548652 SAMEA2778328 3702 Arabidopsis thaliana Var2-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778328 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 421 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGGCAGCTCTA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 421 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548653 SAMEA2778329 3702 Arabidopsis thaliana Col-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778329 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 422 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGGCGTGCACA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 422 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548654 SAMEA2778330 3702 Arabidopsis thaliana Buckhorn_pass_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778330 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 423 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGGTCTACTAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 423 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548655 SAMEA2778331 3702 Arabidopsis thaliana Tsu-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778331 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 424 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGTACGGCGAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 424 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548656 SAMEA2778332 3702 Arabidopsis thaliana Ts-5_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778332 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 425 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGTCACCGTGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 425 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548657 SAMEA2778333 3702 Arabidopsis thaliana Hov4-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778333 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 426 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGTGCACGACT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 426 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548658 SAMEA2778334 3702 Arabidopsis thaliana Jm-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778334 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 427 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGTGTCGACTT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 427 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548659 SAMEA2778335 3702 Arabidopsis thaliana Eden-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778335 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 428 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATTATCGTGCAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 428 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548660 SAMEA2778336 3702 Arabidopsis thaliana Lis-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778336 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 429 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATTCTGTGAGCG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 429 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548661 SAMEA2778337 3702 Arabidopsis thaliana Ren-11_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778337 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 430 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAACACGCACGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 430 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548662 SAMEA2778338 3702 Arabidopsis thaliana Br-0_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778338 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 431 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAACTATCAGCT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 431 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548664 SAMEA2778340 3702 Arabidopsis thaliana Gd-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778340 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 433 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAAGATCGACTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 433 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548665 SAMEA2778341 3702 Arabidopsis thaliana Eden-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778341 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 434 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAAGTGAGAGAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 434 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548668 SAMEA2778344 3702 Arabidopsis thaliana Uod-7_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778344 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 437 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACAGTGGACGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 437 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548669 SAMEA2778345 3702 Arabidopsis thaliana Bil-5_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778345 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 438 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACATCTAACAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 438 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548670 SAMEA2778346 3702 Arabidopsis thaliana Fja1-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778346 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 439 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACATTGTGAGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 439 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548671 SAMEA2778347 3702 Arabidopsis thaliana Sf-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778347 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 440 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACGACAGGCTA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 440 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548672 SAMEA2778348 3702 Arabidopsis thaliana Ga-0_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778348 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 441 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACGGACTATAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 441 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548673 SAMEA2778349 3702 Arabidopsis thaliana Sap-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778349 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 442 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACGTCGATGGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 442 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548674 SAMEA2778350 3702 Arabidopsis thaliana Nfa-8_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778350 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 443 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACGTGACATGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 443 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548675 SAMEA2778351 3702 Arabidopsis thaliana Yo-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778351 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 444 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACTACTGTTGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 444 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548676 SAMEA2778352 3702 Arabidopsis thaliana Got-7_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778352 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 445 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACTCAACAGAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 445 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548677 SAMEA2778353 3702 Arabidopsis thaliana Kelsterbach-4_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778353 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 446 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACTCTGATTAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 446 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548678 SAMEA2778354 3702 Arabidopsis thaliana Rmx-a180_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778354 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 447 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACTGGTATATC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 447 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548679 SAMEA2778355 3702 Arabidopsis thaliana Koln_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778355 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 448 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACTGTAGGACG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 448 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548680 SAMEA2778356 3702 Arabidopsis thaliana Tamm-2_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778356 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 449 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGACATTGCGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 449 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548681 SAMEA2778357 3702 Arabidopsis thaliana Sav-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778357 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 450 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGACTCGCAGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 450 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548682 SAMEA2778358 3702 Arabidopsis thaliana Lp2-6_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778358 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 451 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGAGGAGCTCT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 451 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548683 SAMEA2778359 3702 Arabidopsis thaliana Ag-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778359 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 452 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGATACACTTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 452 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548684 SAMEA2778360 3702 Arabidopsis thaliana Mz-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778360 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 453 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGATCGGATCG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 453 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548685 SAMEA2778361 3702 Arabidopsis thaliana Ws-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778361 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 454 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGCACTAAGCG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 454 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548686 SAMEA2778362 3702 Arabidopsis thaliana Pi-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778362 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 455 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGCATGTGTTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 455 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548687 SAMEA2778363 3702 Arabidopsis thaliana Rmx-a180_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778363 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 456 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGCGGTGACAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 456 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548688 SAMEA2778364 3702 Arabidopsis thaliana Ei-2_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778364 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 457 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGCTAGAACGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 457 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548689 SAMEA2778365 3702 Arabidopsis thaliana Na-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778365 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 458 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGGTGCTACTA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 458 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548690 SAMEA2778366 3702 Arabidopsis thaliana Lip-0_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778366 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 459 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGTACGATCTT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 459 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548691 SAMEA2778367 3702 Arabidopsis thaliana Lu-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778367 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 460 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGTCACTAACG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 460 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548692 SAMEA2778368 3702 Arabidopsis thaliana Uod-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778368 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 461 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGTCGAAGCTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 461 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548693 SAMEA2778369 3702 Arabidopsis thaliana Pro-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778369 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 462 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGTGATCCTAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 462 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548694 SAMEA2778370 3702 Arabidopsis thaliana Ost-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778370 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 463 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGTGCATATGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 463 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548695 SAMEA2778371 3702 Arabidopsis thaliana Pna-17_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778371 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 464 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGTGTCAGGAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 464 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548696 SAMEA2778372 3702 Arabidopsis thaliana Gul1-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778372 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 465 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATACCAGTAGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 465 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548697 SAMEA2778373 3702 Arabidopsis thaliana Is-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778373 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 466 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATAGACGTTCG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 466 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548698 SAMEA2778374 3702 Arabidopsis thaliana Ka-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778374 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 467 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATAGCGAGTTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 467 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548699 SAMEA2778375 3702 Arabidopsis thaliana Kz-13_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778375 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 468 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATATACTCGCA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 468 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548700 SAMEA2778376 3702 Arabidopsis thaliana Est-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778376 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 469 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATATCGCAGTT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 469 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548701 SAMEA2778377 3702 Arabidopsis thaliana Kz-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778377 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 470 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATCAGCGTGTA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 470 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548702 SAMEA2778378 3702 Arabidopsis thaliana Wa-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778378 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 471 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATCATGAGGCT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 471 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548703 SAMEA2778379 3702 Arabidopsis thaliana Jm-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778379 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 472 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATCGTATCAAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 472 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548704 SAMEA2778380 3702 Arabidopsis thaliana H55_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778380 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 473 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATCTGTAGCGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 473 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548705 SAMEA2778381 3702 Arabidopsis thaliana Uod-7_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778381 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 474 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATGAGTGCTAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 474 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548707 SAMEA2778383 3702 Arabidopsis thaliana Kondara_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778383 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 476 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AACGCACGCTAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 476 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548708 SAMEA2778384 3702 Arabidopsis thaliana Zdr-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778384 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 477 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AACTCGTCGATG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 477 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548709 SAMEA2778385 3702 Arabidopsis thaliana Hs-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778385 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 478 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AACTGTGCGTAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 478 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548710 SAMEA2778386 3702 Arabidopsis thaliana Kno-18_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778386 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 479 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AAGAGATGTCGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 479 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548711 SAMEA2778387 3702 Arabidopsis thaliana Wei-0_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778387 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 480 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AAGCTGCAGTCG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 480 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548712 SAMEA2778388 3702 Arabidopsis thaliana Ms-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778388 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 481 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AATCAGTCTCGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 481 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548713 SAMEA2778389 3702 Arabidopsis thaliana Ka-0_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778389 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 482 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AATCGTGACTCG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 482 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548714 SAMEA2778390 3702 Arabidopsis thaliana Nyl-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778390 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 483 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACACACTATGGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 483 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548715 SAMEA2778391 3702 Arabidopsis thaliana Lm-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778391 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 484 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACACATGTCTAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 484 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548716 SAMEA2778392 3702 Arabidopsis thaliana Zdr-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778392 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 485 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACACGAGCCACA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 485 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548717 SAMEA2778393 3702 Arabidopsis thaliana Phw-34_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778393 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 486 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACACGGTGTCTA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 486 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548718 SAMEA2778394 3702 Arabidopsis thaliana Bu-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778394 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 487 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACACTAGATCCG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 487 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548719 SAMEA2778395 3702 Arabidopsis thaliana Tu-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778395 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 488 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACACTGTTCATG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 488 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548720 SAMEA2778396 3702 Arabidopsis thaliana Van-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778396 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 489 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACAGACCACTCA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 489 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548721 SAMEA2778397 3702 Arabidopsis thaliana Boo2-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778397 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 490 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACAGAGTCGGCT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 490 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548722 SAMEA2778398 3702 Arabidopsis thaliana Kavlinge-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778398 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 491 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACAGCAGTGGTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 491 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548723 SAMEA2778399 3702 Arabidopsis thaliana Nyl-2_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778399 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 492 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACAGCTAGCTTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 492 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548724 SAMEA2778400 3702 Arabidopsis thaliana Nc-6_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778400 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 493 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACAGTGCTTCAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 493 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548725 SAMEA2778401 3702 Arabidopsis thaliana Can-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778401 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 494 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACAGTTGCGCGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 494 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548726 SAMEA2778402 3702 Arabidopsis thaliana Hod_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778402 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 495 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACATCACTTAGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 495 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548727 SAMEA2778403 3702 Arabidopsis thaliana Draii-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778403 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 496 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACATGATCGTTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 496 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548728 SAMEA2778404 3702 Arabidopsis thaliana Lov-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778404 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 497 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACATGTCACGTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 497 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548729 SAMEA2778405 3702 Arabidopsis thaliana Eds-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778405 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 498 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACATTCAGCGCA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 498 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548730 SAMEA2778406 3702 Arabidopsis thaliana Co_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778406 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 499 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACCACATACATC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 499 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548731 SAMEA2778407 3702 Arabidopsis thaliana Zdr-6_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778407 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 500 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACCAGACGATGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 500 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548732 SAMEA2778408 3702 Arabidopsis thaliana Blh-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778408 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 501 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACCAGCGACTAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 501 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548733 SAMEA2778409 3702 Arabidopsis thaliana Sf-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778409 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 502 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACCGCAGAGTCA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 502 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548734 SAMEA2778410 3702 Arabidopsis thaliana Fei-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778410 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 503 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACCTCGATCAGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 503 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548736 SAMEA2778412 3702 Arabidopsis thaliana Ull1-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778412 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 505 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGACGTCTTAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 505 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548737 SAMEA2778413 3702 Arabidopsis thaliana H55_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778413 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 506 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGAGTGCTATC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 506 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548738 SAMEA2778414 3702 Arabidopsis thaliana Bur-0_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778414 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 507 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGATGCGACCA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 507 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548739 SAMEA2778415 3702 Arabidopsis thaliana En-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778415 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 508 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGCAACTGCTA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 508 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548740 SAMEA2778416 3702 Arabidopsis thaliana Pi-0_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778416 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 509 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGCGATACTGG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 509 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548741 SAMEA2778417 3702 Arabidopsis thaliana Bil-5_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778417 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 510 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGCGCAGATAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 510 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548735 SAMEA2778411 3702 Arabidopsis thaliana Bs-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778411 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 504 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACCTGTCTCTCT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 504 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548742 SAMEA2778418 3702 Arabidopsis thaliana Spr1-6_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778418 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 511 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGCTATCTGGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 511 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548743 SAMEA2778419 3702 Arabidopsis thaliana Kent_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778419 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 512 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGCTCATGGAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 512 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548744 SAMEA2778420 3702 Arabidopsis thaliana Lp2-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778420 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 513 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGGATCGTCAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 513 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548745 SAMEA2778421 3702 Arabidopsis thaliana Wt-5_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778421 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 514 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGGTGAGTGTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 514 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548746 SAMEA2778422 3702 Arabidopsis thaliana Pu2-23_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778422 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 515 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGTACTCAGTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 515 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548747 SAMEA2778423 3702 Arabidopsis thaliana Est-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778423 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 516 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGTCTGTAGCA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 516 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548748 SAMEA2778424 3702 Arabidopsis thaliana Ba3-3_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778424 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 517 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGTGAGAGAAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 517 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548749 SAMEA2778425 3702 Arabidopsis thaliana Got-7_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778425 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 518 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGTGCCGTAGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 518 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548750 SAMEA2778426 3702 Arabidopsis thaliana Lis-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778426 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 519 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGTTAGCACAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 519 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548751 SAMEA2778427 3702 Arabidopsis thaliana Spr1-6_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778427 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 520 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTACAGCCTAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 520 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548752 SAMEA2778428 3702 Arabidopsis thaliana Cibc-17_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778428 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 521 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTACGTGTGGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 521 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548753 SAMEA2778429 3702 Arabidopsis thaliana Spr1-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778429 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 522 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTAGCTCCATA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 522 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548754 SAMEA2778430 3702 Arabidopsis thaliana Lz-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778430 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 523 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTATTGTCACG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 523 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548755 SAMEA2778431 3702 Arabidopsis thaliana Kni-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778431 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 524 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTCACGGTATG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 524 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548756 SAMEA2778432 3702 Arabidopsis thaliana N13_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778432 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 525 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTCGATTCGAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 525 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548757 SAMEA2778433 3702 Arabidopsis thaliana Eden-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778433 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 526 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTCGCACAGGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 526 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548758 SAMEA2778434 3702 Arabidopsis thaliana Lm-2_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778434 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 527 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTCTTCTAGAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 527 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548759 SAMEA2778435 3702 Arabidopsis thaliana San-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778435 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 528 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTGACAGCCAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 528 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548760 SAMEA2778436 3702 Arabidopsis thaliana Is-0_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778436 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 529 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTGATCCTAGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 529 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548761 SAMEA2778437 3702 Arabidopsis thaliana Pro-0_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778437 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 530 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTGTACGCGTA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 530 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548762 SAMEA2778438 3702 Arabidopsis thaliana Col-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778438 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 531 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTGTCGAAGCT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 531 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548763 SAMEA2778439 3702 Arabidopsis thaliana Cibc-17_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778439 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 532 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTGTGACTTCA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 532 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548764 SAMEA2778440 3702 Arabidopsis thaliana Tu-0_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778440 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 533 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTTGTAGCAGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 533 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548765 SAMEA2778441 3702 Arabidopsis thaliana Pna-17_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778441 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 534 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGAACACGTCTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 534 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548766 SAMEA2778442 3702 Arabidopsis thaliana Sorbo_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778442 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 535 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGACCGTCAGAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 535 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548767 SAMEA2778443 3702 Arabidopsis thaliana Fab-4_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778443 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 536 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGACGTGCACTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 536 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548768 SAMEA2778444 3702 Arabidopsis thaliana Ren-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778444 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 537 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGACTGCGTACT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 537 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548769 SAMEA2778445 3702 Arabidopsis thaliana Ba4-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778445 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 538 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGAGAGCAAGTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 538 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548770 SAMEA2778446 3702 Arabidopsis thaliana Edi-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778446 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 539 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGAGCAAGAGCA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 539 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548771 SAMEA2778447 3702 Arabidopsis thaliana Lom1-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778447 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 540 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGAGTAGCTAAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 540 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548772 SAMEA2778448 3702 Arabidopsis thaliana Rrs-7_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778448 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 541 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGAGTCCTGAGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 541 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548773 SAMEA2778449 3702 Arabidopsis thaliana Sav-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778449 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 542 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGATACACGCGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 542 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548774 SAMEA2778450 3702 Arabidopsis thaliana Rak-2_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778450 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 543 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGATCGGCTCGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 543 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548775 SAMEA2778451 3702 Arabidopsis thaliana Ang-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778451 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 544 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGATCTCTGCAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 544 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548776 SAMEA2778452 3702 Arabidopsis thaliana Santa_clara_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778452 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 545 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGATGTTCTGCT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 545 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548777 SAMEA2778453 3702 Arabidopsis thaliana Fei-0_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778453 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 546 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCACACCTACA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 546 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548778 SAMEA2778454 3702 Arabidopsis thaliana Lis-2_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778454 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 547 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCACGAGCCTA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 547 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548779 SAMEA2778455 3702 Arabidopsis thaliana Hr-10_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778455 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 548 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCAGCACTTGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 548 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548780 SAMEA2778456 3702 Arabidopsis thaliana Edi-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778456 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 549 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCAGTCGCGAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 549 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548781 SAMEA2778457 3702 Arabidopsis thaliana Oy-0_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778457 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 550 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCATATGAGAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 550 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548782 SAMEA2778458 3702 Arabidopsis thaliana Fab-2_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778458 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 551 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCCATACTGAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 551 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548783 SAMEA2778459 3702 Arabidopsis thaliana Duk_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778459 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 552 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCGACTGTGCA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 552 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548784 SAMEA2778460 3702 Arabidopsis thaliana Kni-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778460 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 553 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCGAGCTATCT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 553 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548785 SAMEA2778461 3702 Arabidopsis thaliana Got-22_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778461 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 554 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCGCTGATGTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 554 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548786 SAMEA2778462 3702 Arabidopsis thaliana Bg-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778462 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 555 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCGTAGGTCGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 555 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548787 SAMEA2778463 3702 Arabidopsis thaliana Duk_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778463 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 556 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCTATCCACGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 556 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548788 SAMEA2778464 3702 Arabidopsis thaliana Hi-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778464 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 557 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCTCCATACAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 557 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548789 SAMEA2778465 3702 Arabidopsis thaliana Hov2-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778465 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 558 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCTCTCAGAGG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 558 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548790 SAMEA2778466 3702 Arabidopsis thaliana Dra3-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778466 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 559 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCTGACTAGTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 559 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548791 SAMEA2778467 3702 Arabidopsis thaliana Rrs-7_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778467 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 560 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCTTGACAGCT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 560 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548792 SAMEA2778468 3702 Arabidopsis thaliana Rubezhnoe-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778468 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 561 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGGACGCACTGT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 561 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548793 SAMEA2778469 3702 Arabidopsis thaliana Ang-0_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778469 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 562 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGGCTACACGAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 562 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548794 SAMEA2778470 3702 Arabidopsis thaliana San-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778470 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 563 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGGTGTGATCGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 563 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548795 SAMEA2778471 3702 Arabidopsis thaliana Eden-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778471 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 564 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTACGCTCGAG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 564 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548796 SAMEA2778472 3702 Arabidopsis thaliana Nw-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778472 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 565 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTACTGCAGGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 565 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548797 SAMEA2778473 3702 Arabidopsis thaliana Bla-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778473 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 566 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTAGTATCCTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 566 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548798 SAMEA2778474 3702 Arabidopsis thaliana Rmx-a02_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778474 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 567 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTCACATCACT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 567 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548799 SAMEA2778475 3702 Arabidopsis thaliana Lom1-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778475 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 568 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTCCATAGCTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 568 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548800 SAMEA2778476 3702 Arabidopsis thaliana Sanna-2_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778476 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 569 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTCTACTCTGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 569 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548801 SAMEA2778477 3702 Arabidopsis thaliana An-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778477 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 570 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTCTCGCATAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 570 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548803 SAMEA2778479 3702 Arabidopsis thaliana Cibc-5_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778479 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 572 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AACTGTGCGTAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 572 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548804 SAMEA2778480 3702 Arabidopsis thaliana Cibc-5_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778480 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 573 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AAGCTGCAGTCG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 573 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548805 SAMEA2778481 3702 Arabidopsis thaliana Bil-7_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778481 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 574 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AATCGTGACTCG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 574 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548807 SAMEA2778483 3702 Arabidopsis thaliana Hr-5_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778483 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 576 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACACGGTGTCTA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 576 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548808 SAMEA2778484 3702 Arabidopsis thaliana Kno-10_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778484 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 577 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACACTGTTCATG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 577 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548809 SAMEA2778485 3702 Arabidopsis thaliana Kno-10_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778485 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 578 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACAGAGTCGGCT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 578 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548810 SAMEA2778486 3702 Arabidopsis thaliana Kz-9_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778486 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 579 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACAGCTAGCTTG pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 579 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548811 SAMEA2778487 3702 Arabidopsis thaliana Kz-9_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778487 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 580 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACAGTTGCGCGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 580 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548812 SAMEA2778488 3702 Arabidopsis thaliana Mrk-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778488 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 581 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACATGATCGTTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 581 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548815 SAMEA2778491 3702 Arabidopsis thaliana Mz-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778491 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 584 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACCGCAGAGTCA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 584 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548816 SAMEA2778492 3702 Arabidopsis thaliana Nd-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778492 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 585 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACCTGTCTCTCT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 585 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548817 SAMEA2778493 3702 Arabidopsis thaliana Nd-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778493 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 586 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGAGTGCTATC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 586 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548819 SAMEA2778495 3702 Arabidopsis thaliana Ull2-5_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778495 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 588 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGCGCAGATAC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 588 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548820 SAMEA2778496 3702 Arabidopsis thaliana Rrs-10_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778496 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 589 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGCTCATGGAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 589 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548824 SAMEA2778500 3702 Arabidopsis thaliana Bil-7_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778500 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 593 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTACAGCCTAT pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 593 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548825 SAMEA2778501 3702 Arabidopsis thaliana Kin-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778501 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 594 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTAGCTCCATA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 594 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548831 SAMEA2778507 3702 Arabidopsis thaliana Hr-5_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778507 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 600 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTTGTAGCAGC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 600 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548838 SAMEA2778514 3702 Arabidopsis thaliana Bil-7_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778514 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 607 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCACGAGCCTA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 607 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548845 SAMEA2778521 3702 Arabidopsis thaliana Rrs-10_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778521 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 614 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCTGACTAGTC pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 614 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548850 SAMEA2778526 3702 Arabidopsis thaliana Ull2-5_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778526 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 619 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTCTACTCTGA pcr primers AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 619 sequencing method 454 target gene 16S rRNA target subfragment V5-V7 ERS548851 SAMEA2778527 3702 Arabidopsis thaliana Br-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778527 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 620 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATGGCTACACA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 620 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548852 SAMEA2778528 3702 Arabidopsis thaliana Rak-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778528 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 621 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATGTAATGCTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 621 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548853 SAMEA2778529 3702 Arabidopsis thaliana Mt-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778529 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 622 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATGTCTCTCCG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 622 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548854 SAMEA2778530 3702 Arabidopsis thaliana Fab-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778530 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 623 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATTCGATGACT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 623 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548855 SAMEA2778531 3702 Arabidopsis thaliana Dem-4_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778531 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 624 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATTGTCTGTGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 624 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548856 SAMEA2778532 3702 Arabidopsis thaliana Vastervik_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778532 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 625 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CCAGATGATCGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 625 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548857 SAMEA2778533 3702 Arabidopsis thaliana Na-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778533 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 626 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CCAGTGTATGCA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 626 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548858 SAMEA2778534 3702 Arabidopsis thaliana Tsu-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778534 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 627 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CCATACATAGCT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 627 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548859 SAMEA2778535 3702 Arabidopsis thaliana Sorbo_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778535 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 628 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CCGACTGAGATG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 628 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548860 SAMEA2778536 3702 Arabidopsis thaliana Sq-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778536 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 629 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CCGATGTCAGAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 629 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548861 SAMEA2778537 3702 Arabidopsis thaliana St-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778537 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 630 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CCTAGTACTGAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 630 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548862 SAMEA2778538 3702 Arabidopsis thaliana Kulturen-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778538 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 631 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CCTCTCGTGATC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 631 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548863 SAMEA2778539 3702 Arabidopsis thaliana Gr-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778539 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 632 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGAAGACTGCTG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 632 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548864 SAMEA2778540 3702 Arabidopsis thaliana Ba3-3_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778540 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 633 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGAATCGACACT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 633 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548865 SAMEA2778541 3702 Arabidopsis thaliana Cen-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778541 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 634 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGACAGCTGACA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 634 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548866 SAMEA2778542 3702 Arabidopsis thaliana Kavlinge-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778542 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 635 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGACATGCTATT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 635 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548867 SAMEA2778543 3702 Arabidopsis thaliana Pna-10_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778543 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 636 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGACTTATGTGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 636 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548868 SAMEA2778544 3702 Arabidopsis thaliana Sanna-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778544 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 637 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGAGAGTTACGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 637 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548869 SAMEA2778545 3702 Arabidopsis thaliana Tottarp-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778545 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 638 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGAGCAGCACAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 638 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548870 SAMEA2778546 3702 Arabidopsis thaliana Mt-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778546 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 639 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGAGGCTCAGTA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 639 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548871 SAMEA2778547 3702 Arabidopsis thaliana Tamm-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778547 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 640 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGAGTCTAGTTG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 640 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548872 SAMEA2778548 3702 Arabidopsis thaliana Ts-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778548 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 641 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGAGTTGTAGCG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 641 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548873 SAMEA2778549 3702 Arabidopsis thaliana Hsm_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778549 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 642 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGATAGATCTTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 642 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548874 SAMEA2778550 3702 Arabidopsis thaliana Ost-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778550 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 643 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGATATTCATCG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 643 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548875 SAMEA2778551 3702 Arabidopsis thaliana Or-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778551 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 644 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGATCGAGTGTT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 644 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548876 SAMEA2778552 3702 Arabidopsis thaliana Mr-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778552 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 645 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGATGCACCAGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 645 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548877 SAMEA2778553 3702 Arabidopsis thaliana Var2-6_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778553 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 646 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGATGTCGTCAA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 646 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548878 SAMEA2778554 3702 Arabidopsis thaliana Ge-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778554 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 647 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGCACATGTTAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 647 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548879 SAMEA2778555 3702 Arabidopsis thaliana Vinslov_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778555 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 648 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGCACTCTAGAA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 648 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548880 SAMEA2778556 3702 Arabidopsis thaliana Seattle-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778556 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 649 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGCAGACAGACT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 649 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548881 SAMEA2778557 3702 Arabidopsis thaliana Bur-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778557 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 650 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGCAGCGGTATA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 650 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548882 SAMEA2778558 3702 Arabidopsis thaliana Ct-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778558 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 651 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGCATGAGGATC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 651 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548883 SAMEA2778559 3702 Arabidopsis thaliana Kz-13_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778559 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 652 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGCGTAACTGTA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 652 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548884 SAMEA2778560 3702 Arabidopsis thaliana Alc-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778560 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 653 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGCTAGAACGCA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 653 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548885 SAMEA2778561 3702 Arabidopsis thaliana Lc-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778561 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 654 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGCTTATCGAGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 654 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548886 SAMEA2778562 3702 Arabidopsis thaliana Rsch-4_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778562 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 655 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGGAGTGTCTAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 655 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548887 SAMEA2778563 3702 Arabidopsis thaliana Sq-8_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778563 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 656 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGGCGATGTACA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 656 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548888 SAMEA2778564 3702 Arabidopsis thaliana Ull1-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778564 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 657 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGTAAGTCTACT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 657 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548889 SAMEA2778565 3702 Arabidopsis thaliana Stu1-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778565 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 658 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGTACAGTTATC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 658 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548890 SAMEA2778566 3702 Arabidopsis thaliana St-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778566 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 659 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGTACTAGACTG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 659 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548891 SAMEA2778567 3702 Arabidopsis thaliana Hov2-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778567 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 660 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGTAGAACGTGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 660 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548892 SAMEA2778568 3702 Arabidopsis thaliana Eds-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778568 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 661 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGTATCTGCGAA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 661 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548893 SAMEA2778569 3702 Arabidopsis thaliana Hod_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778569 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 662 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGTATGCTGTAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 662 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548894 SAMEA2778570 3702 Arabidopsis thaliana Ba1-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778570 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 663 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGTCAACGATGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 663 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548895 SAMEA2778571 3702 Arabidopsis thaliana Buckhorn_pass_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778571 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 664 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGTCACGACTAA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 664 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548896 SAMEA2778572 3702 Arabidopsis thaliana Vimmerby_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778572 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 665 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGTCAGACGGAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 665 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548897 SAMEA2778573 3702 Arabidopsis thaliana Rsch-4_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778573 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 666 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGTCGATCTCTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 666 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548898 SAMEA2778574 3702 Arabidopsis thaliana Tamm-27_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778574 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 667 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGTGACAATGTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 667 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548899 SAMEA2778575 3702 Arabidopsis thaliana Sr5_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778575 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 668 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGTGATCTCTCC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 668 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548900 SAMEA2778576 3702 Arabidopsis thaliana Bor-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778576 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 669 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGTGCATTATCA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 669 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548901 SAMEA2778577 3702 Arabidopsis thaliana Nok-3_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778577 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 670 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGTGTACATCAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 670 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548902 SAMEA2778578 3702 Arabidopsis thaliana Stu1-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778578 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 671 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGTGTGATCAGG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 671 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548903 SAMEA2778579 3702 Arabidopsis thaliana Draii-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778579 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 672 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGTTACTAGAGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 672 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548904 SAMEA2778580 3702 Arabidopsis thaliana Kas-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778580 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 673 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGTTATGTACAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 673 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548905 SAMEA2778581 3702 Arabidopsis thaliana Hovdala-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778581 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 674 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGTTCGCATAGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 674 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548906 SAMEA2778582 3702 Arabidopsis thaliana Algutsrum_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778582 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 675 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTAACGCAGTCA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 675 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548907 SAMEA2778583 3702 Arabidopsis thaliana Omo2-3_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778583 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 676 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTACACAAGCAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 676 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548908 SAMEA2778584 3702 Arabidopsis thaliana Rev-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778584 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 677 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTACATCTAAGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 677 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548909 SAMEA2778585 3702 Arabidopsis thaliana Uod-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778585 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 678 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTACGCGTCTCT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 678 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548910 SAMEA2778586 3702 Arabidopsis thaliana Pna-10_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778586 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 679 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTACTACAGGTG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 679 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548911 SAMEA2778587 3702 Arabidopsis thaliana Stw-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778587 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 680 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTACTGATATCG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 680 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548912 SAMEA2778588 3702 Arabidopsis thaliana Fja1-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778588 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 681 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTAGAACGCACT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 681 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548913 SAMEA2778589 3702 Arabidopsis thaliana Co_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778589 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 682 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTAGAGACTCTT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 682 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548914 SAMEA2778590 3702 Arabidopsis thaliana Bs-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778590 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 683 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTAGCGAACATC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 683 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548915 SAMEA2778591 3702 Arabidopsis thaliana Se-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778591 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 684 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTAGGTCACTAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 684 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548916 SAMEA2778592 3702 Arabidopsis thaliana Bor-4_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778592 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 685 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTAGTCAGCTGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 685 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548917 SAMEA2778593 3702 Arabidopsis thaliana Ba5-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778593 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 686 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTATAGTCGTGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 686 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548918 SAMEA2778594 3702 Arabidopsis thaliana Ts-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778594 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 687 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTATCAGTGTAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 687 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548919 SAMEA2778595 3702 Arabidopsis thaliana Gul1-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778595 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 688 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTATCTAGCGAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 688 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548920 SAMEA2778596 3702 Arabidopsis thaliana Rubezhnoe-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778596 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 689 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTATGCTTGATG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 689 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548921 SAMEA2778597 3702 Arabidopsis thaliana Algutsrum_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778597 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 690 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTCAATGACTCA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 690 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548922 SAMEA2778598 3702 Arabidopsis thaliana Kno-18_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778598 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 691 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTCAGTATGCAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 691 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548923 SAMEA2778599 3702 Arabidopsis thaliana Draiii-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778599 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 692 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTCATGTACAGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 692 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548924 SAMEA2778600 3702 Arabidopsis thaliana Or-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778600 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 693 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTCCTACTGTCT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 693 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548925 SAMEA2778601 3702 Arabidopsis thaliana Ll-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778601 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 694 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTCGAGAGTACG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 694 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548926 SAMEA2778602 3702 Arabidopsis thaliana Sr5_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778602 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 695 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTCGATTAGATC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 695 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548927 SAMEA2778603 3702 Arabidopsis thaliana Dra3-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778603 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 696 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTCGCACATATA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 696 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548928 SAMEA2778604 3702 Arabidopsis thaliana Gu-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778604 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 697 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTCGTGGAGTAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 697 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548929 SAMEA2778605 3702 Arabidopsis thaliana Ler-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778605 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 698 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTCTCTACCTGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 698 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548930 SAMEA2778606 3702 Arabidopsis thaliana Ei-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778606 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 699 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTCTGAAGTCTA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 699 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548931 SAMEA2778607 3702 Arabidopsis thaliana Kelsterbach-4_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778607 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 700 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTCTGCTAGCCT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 700 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548932 SAMEA2778608 3702 Arabidopsis thaliana Uod-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778608 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 701 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTGAACGCTAGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 701 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548933 SAMEA2778609 3702 Arabidopsis thaliana Ge-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778609 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 702 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTGACACGACAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 702 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548934 SAMEA2778610 3702 Arabidopsis thaliana Lov-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778610 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 703 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTGAGATACGCG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 703 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548935 SAMEA2778611 3702 Arabidopsis thaliana Wei-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778611 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 704 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTGAGCAGAGTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 704 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548936 SAMEA2778612 3702 Arabidopsis thaliana Uod-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778612 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 705 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTGCAGTACTTA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 705 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548937 SAMEA2778613 3702 Arabidopsis thaliana Omo2-3_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778613 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 706 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTGCTGCGAAGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 706 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548938 SAMEA2778614 3702 Arabidopsis thaliana In-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778614 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 707 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTGGACTCATAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 707 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548939 SAMEA2778615 3702 Arabidopsis thaliana Nc-6_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778615 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 708 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTGGAGCATGAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 708 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548940 SAMEA2778616 3702 Arabidopsis thaliana Boo2-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778616 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 709 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTGGCTGTATGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 709 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548941 SAMEA2778617 3702 Arabidopsis thaliana Rd-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778617 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 710 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTGTATCGTATG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 710 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548942 SAMEA2778618 3702 Arabidopsis thaliana Nok-3_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778618 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 711 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTGTCTCTCCTA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 711 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548943 SAMEA2778619 3702 Arabidopsis thaliana Oy-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778619 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 712 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTGTGACATTGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 712 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548944 SAMEA2778620 3702 Arabidopsis thaliana Var2-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778620 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 713 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTGTGGATCGAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 713 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548945 SAMEA2778621 3702 Arabidopsis thaliana Ag-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778621 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 714 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AACGCACGCTAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 714 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548946 SAMEA2778622 3702 Arabidopsis thaliana Ag-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778622 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 715 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AACTCGTCGATG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 715 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548947 SAMEA2778623 3702 Arabidopsis thaliana Algutsrum_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778623 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 716 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AACTGTGCGTAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 716 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548948 SAMEA2778624 3702 Arabidopsis thaliana Algutsrum_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778624 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 717 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AAGAGATGTCGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 717 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548949 SAMEA2778625 3702 Arabidopsis thaliana An-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778625 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 718 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AAGCTGCAGTCG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 718 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548950 SAMEA2778626 3702 Arabidopsis thaliana An-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778626 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 719 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AATCAGTCTCGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 719 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548951 SAMEA2778627 3702 Arabidopsis thaliana Ang-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778627 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 720 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AATCGTGACTCG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 720 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548952 SAMEA2778628 3702 Arabidopsis thaliana Ang-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778628 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 721 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACACACTATGGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 721 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548953 SAMEA2778629 3702 Arabidopsis thaliana Ba1-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778629 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 722 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACACATGTCTAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 722 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548954 SAMEA2778630 3702 Arabidopsis thaliana Ba1-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778630 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 723 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACACGAGCCACA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 723 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548955 SAMEA2778631 3702 Arabidopsis thaliana Ba3-3_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778631 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 724 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACACGGTGTCTA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 724 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548956 SAMEA2778632 3702 Arabidopsis thaliana Ba3-3_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778632 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 725 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACACTAGATCCG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 725 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548957 SAMEA2778633 3702 Arabidopsis thaliana Ba4-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778633 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 726 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACACTGTTCATG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 726 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548958 SAMEA2778634 3702 Arabidopsis thaliana Ba4-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778634 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 727 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACAGACCACTCA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 727 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548959 SAMEA2778635 3702 Arabidopsis thaliana Ba5-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778635 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 728 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACAGAGTCGGCT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 728 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548960 SAMEA2778636 3702 Arabidopsis thaliana Ba5-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778636 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 729 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACAGCAGTGGTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 729 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548961 SAMEA2778637 3702 Arabidopsis thaliana Bg-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778637 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 730 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACAGCTAGCTTG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 730 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548962 SAMEA2778638 3702 Arabidopsis thaliana Bil-5_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778638 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 731 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACAGTGCTTCAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 731 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548963 SAMEA2778639 3702 Arabidopsis thaliana Bla-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778639 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 732 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACATCACTTAGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 732 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548964 SAMEA2778640 3702 Arabidopsis thaliana Blh-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778640 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 733 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACATGATCGTTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 733 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548965 SAMEA2778641 3702 Arabidopsis thaliana Boo2-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778641 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 734 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACATGTCACGTG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 734 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548966 SAMEA2778642 3702 Arabidopsis thaliana Boo2-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778642 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 735 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACATTCAGCGCA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 735 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548967 SAMEA2778643 3702 Arabidopsis thaliana Bor-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778643 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 736 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACCACATACATC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 736 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548968 SAMEA2778644 3702 Arabidopsis thaliana Bor-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778644 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 737 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACCAGACGATGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 737 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548969 SAMEA2778645 3702 Arabidopsis thaliana Bor-4_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778645 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 738 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACCAGCGACTAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 738 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548970 SAMEA2778646 3702 Arabidopsis thaliana Bor-4_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778646 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 739 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACCGCAGAGTCA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 739 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548971 SAMEA2778647 3702 Arabidopsis thaliana Br-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778647 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 740 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACCTCGATCAGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 740 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548972 SAMEA2778648 3702 Arabidopsis thaliana Br-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778648 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 741 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACCTGTCTCTCT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 741 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548973 SAMEA2778649 3702 Arabidopsis thaliana Bro1-6_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778649 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 742 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGACGTCTTAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 742 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548974 SAMEA2778650 3702 Arabidopsis thaliana Bro1-6_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778650 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 743 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGAGTGCTATC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 743 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548975 SAMEA2778651 3702 Arabidopsis thaliana Bs-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778651 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 744 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGATGCGACCA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 744 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548976 SAMEA2778652 3702 Arabidopsis thaliana Bs-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778652 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 745 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGCAACTGCTA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 745 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548977 SAMEA2778653 3702 Arabidopsis thaliana Bu-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778653 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 746 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGCGATACTGG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 746 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548978 SAMEA2778654 3702 Arabidopsis thaliana Bu-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778654 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 747 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGCGCAGATAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 747 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548979 SAMEA2778655 3702 Arabidopsis thaliana Bur-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778655 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 748 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGCTATCTGGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 748 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548980 SAMEA2778656 3702 Arabidopsis thaliana Bur-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778656 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 749 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGCTCATGGAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 749 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548981 SAMEA2778657 3702 Arabidopsis thaliana Can-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778657 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 750 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGGATCGTCAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 750 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548982 SAMEA2778658 3702 Arabidopsis thaliana Cen-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778658 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 751 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGGTGAGTGTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 751 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548983 SAMEA2778659 3702 Arabidopsis thaliana Cen-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778659 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 752 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGTACTCAGTG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 752 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548984 SAMEA2778660 3702 Arabidopsis thaliana Cibc-17_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778660 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 753 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGTCTGTAGCA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 753 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548985 SAMEA2778661 3702 Arabidopsis thaliana Cibc-17_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778661 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 754 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGTGAGAGAAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 754 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548986 SAMEA2778662 3702 Arabidopsis thaliana Cibc-5_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778662 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 755 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGTGCCGTAGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 755 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548987 SAMEA2778663 3702 Arabidopsis thaliana Col-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778663 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 756 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACGTTAGCACAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 756 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548988 SAMEA2778664 3702 Arabidopsis thaliana N13_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778664 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 757 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTACAGCCTAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 757 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548989 SAMEA2778665 3702 Arabidopsis thaliana N13_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778665 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 758 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTACGTGTGGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 758 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548990 SAMEA2778666 3702 Arabidopsis thaliana Phw-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778666 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 759 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTAGCTCCATA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 759 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548991 SAMEA2778667 3702 Arabidopsis thaliana Phw-34_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778667 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 760 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTATTGTCACG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 760 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548992 SAMEA2778668 3702 Arabidopsis thaliana Phw-34_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778668 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 761 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTCACGGTATG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 761 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548993 SAMEA2778669 3702 Arabidopsis thaliana Kelsterbach-4_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778669 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 762 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTCAGATACTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 762 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548994 SAMEA2778670 3702 Arabidopsis thaliana Kelsterbach-4_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778670 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 763 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTCGATTCGAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 763 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548995 SAMEA2778671 3702 Arabidopsis thaliana Seattle-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778671 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 764 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTCGCACAGGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 764 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548996 SAMEA2778672 3702 Arabidopsis thaliana Dem-4_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778672 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 765 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTCTTCTAGAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 765 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548997 SAMEA2778673 3702 Arabidopsis thaliana Dem-4_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778673 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 766 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTGACAGCCAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 766 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548998 SAMEA2778674 3702 Arabidopsis thaliana Dra3-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778674 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 767 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTGATCCTAGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 767 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS548999 SAMEA2778675 3702 Arabidopsis thaliana Dra3-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778675 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 768 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTGTACGCGTA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 768 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549000 SAMEA2778676 3702 Arabidopsis thaliana Draii-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778676 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 769 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTGTCGAAGCT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 769 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549001 SAMEA2778677 3702 Arabidopsis thaliana Draii-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778677 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 770 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTGTGACTTCA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 770 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549002 SAMEA2778678 3702 Arabidopsis thaliana Draiii-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778678 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 771 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ACTTGTAGCAGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 771 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549003 SAMEA2778679 3702 Arabidopsis thaliana Draiii-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778679 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 772 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGAACACGTCTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 772 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549004 SAMEA2778680 3702 Arabidopsis thaliana Duk_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778680 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 773 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGACCGTCAGAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 773 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549005 SAMEA2778681 3702 Arabidopsis thaliana Duk_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778681 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 774 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGACGTGCACTG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 774 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549006 SAMEA2778682 3702 Arabidopsis thaliana Eden-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778682 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 775 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGACTGCGTACT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 775 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549007 SAMEA2778683 3702 Arabidopsis thaliana Eden-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778683 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 776 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGAGAGCAAGTG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 776 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549008 SAMEA2778684 3702 Arabidopsis thaliana Edi-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778684 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 777 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGAGCAAGAGCA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 777 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549009 SAMEA2778685 3702 Arabidopsis thaliana Eds-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778685 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 778 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGAGTAGCTAAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 778 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549010 SAMEA2778686 3702 Arabidopsis thaliana Eds-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778686 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 779 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGAGTCCTGAGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 779 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549011 SAMEA2778687 3702 Arabidopsis thaliana Ei-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778687 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 780 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGATACACGCGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 780 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549012 SAMEA2778688 3702 Arabidopsis thaliana Ei-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778688 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 781 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGATCGGCTCGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 781 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549013 SAMEA2778689 3702 Arabidopsis thaliana En-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778689 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 782 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGATCTCTGCAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 782 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549014 SAMEA2778690 3702 Arabidopsis thaliana Est-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778690 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 783 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGATGTTCTGCT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 783 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549015 SAMEA2778691 3702 Arabidopsis thaliana Est-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778691 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 784 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCACACCTACA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 784 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549016 SAMEA2778692 3702 Arabidopsis thaliana Fab-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778692 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 785 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCACGAGCCTA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 785 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549017 SAMEA2778693 3702 Arabidopsis thaliana Fab-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778693 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 786 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCAGCACTTGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 786 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549018 SAMEA2778694 3702 Arabidopsis thaliana Fab-4_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778694 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 787 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCAGTCGCGAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 787 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549019 SAMEA2778695 3702 Arabidopsis thaliana Fab-4_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778695 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 788 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCATATGAGAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 788 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549020 SAMEA2778696 3702 Arabidopsis thaliana Fei-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778696 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 789 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCCATACTGAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 789 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549021 SAMEA2778697 3702 Arabidopsis thaliana Fei-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778697 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 790 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCGACTGTGCA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 790 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549022 SAMEA2778698 3702 Arabidopsis thaliana Fja1-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778698 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 791 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCGAGCTATCT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 791 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549023 SAMEA2778699 3702 Arabidopsis thaliana Fja1-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778699 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 792 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCGCTGATGTG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 792 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549024 SAMEA2778700 3702 Arabidopsis thaliana Fly2-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778700 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 793 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCGTAGGTCGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 793 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549025 SAMEA2778701 3702 Arabidopsis thaliana Ga-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778701 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 794 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCTATCCACGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 794 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549026 SAMEA2778702 3702 Arabidopsis thaliana Ga-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778702 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 795 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCTCCATACAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 795 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549027 SAMEA2778703 3702 Arabidopsis thaliana Gd-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778703 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 796 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCTCTCAGAGG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 796 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549028 SAMEA2778704 3702 Arabidopsis thaliana Gd-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778704 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 797 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCTGACTAGTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 797 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549029 SAMEA2778705 3702 Arabidopsis thaliana Ge-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778705 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 798 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCTTGACAGCT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 798 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549030 SAMEA2778706 3702 Arabidopsis thaliana Got-7_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778706 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 799 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGGACGCACTGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 799 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549031 SAMEA2778707 3702 Arabidopsis thaliana Got-7_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778707 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 800 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGGCTACACGAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 800 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549032 SAMEA2778708 3702 Arabidopsis thaliana Gr-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778708 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 801 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGGTGTGATCGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 801 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549033 SAMEA2778709 3702 Arabidopsis thaliana Gr-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778709 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 802 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTACGCTCGAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 802 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549034 SAMEA2778710 3702 Arabidopsis thaliana Gu-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778710 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 803 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTACTGCAGGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 803 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549035 SAMEA2778711 3702 Arabidopsis thaliana Gu-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778711 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 804 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTAGTATCCTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 804 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549036 SAMEA2778712 3702 Arabidopsis thaliana Gul1-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778712 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 805 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTCACATCACT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 805 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549037 SAMEA2778713 3702 Arabidopsis thaliana H55_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778713 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 806 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTCCATAGCTG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 806 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549038 SAMEA2778714 3702 Arabidopsis thaliana H55_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778714 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 807 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTCTACTCTGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 807 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549039 SAMEA2778715 3702 Arabidopsis thaliana Hi-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778715 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 808 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTCTCGCATAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 808 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549040 SAMEA2778716 3702 Arabidopsis thaliana Hod_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778716 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 809 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTGAGAGAAGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 809 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549041 SAMEA2778717 3702 Arabidopsis thaliana Hod_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778717 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 810 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTGCGATGCGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 810 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549042 SAMEA2778718 3702 Arabidopsis thaliana Hov2-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778718 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 811 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTGGATGCTCT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 811 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549043 SAMEA2778719 3702 Arabidopsis thaliana Hov2-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778719 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 812 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTGTCACGGTG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 812 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549044 SAMEA2778720 3702 Arabidopsis thaliana Hov4-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778720 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 813 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTGTTCGATCG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 813 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549045 SAMEA2778721 3702 Arabidopsis thaliana Hov4-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778721 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 814 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTTAGTGCGTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 814 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549046 SAMEA2778722 3702 Arabidopsis thaliana Hovdala-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778722 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 815 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTTCAGACGCT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 815 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549047 SAMEA2778723 3702 Arabidopsis thaliana Hovdala-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778723 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 816 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTTCTACGTCA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 816 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549048 SAMEA2778724 3702 Arabidopsis thaliana Hr-10_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778724 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 817 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATAATCTCGTCG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 817 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549049 SAMEA2778725 3702 Arabidopsis thaliana Hr-10_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778725 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 818 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATACACGTGGCG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 818 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549050 SAMEA2778726 3702 Arabidopsis thaliana Hs-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778726 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 819 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATACGTCTTCGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 819 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549051 SAMEA2778727 3702 Arabidopsis thaliana Hs-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778727 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 820 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATACTATTGCGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 820 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549052 SAMEA2778728 3702 Arabidopsis thaliana Hsm_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778728 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 821 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATACTCACTCAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 821 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549053 SAMEA2778729 3702 Arabidopsis thaliana Hsm_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778729 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 822 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATAGCTCCATAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 822 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549054 SAMEA2778730 3702 Arabidopsis thaliana In-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778730 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 823 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATAGGCGATCTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 823 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549055 SAMEA2778731 3702 Arabidopsis thaliana In-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778731 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 824 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATATCGCTACTG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 824 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549056 SAMEA2778732 3702 Arabidopsis thaliana Is-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778732 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 825 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATATGCCAGTGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 825 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549057 SAMEA2778733 3702 Arabidopsis thaliana Is-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778733 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 826 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCACGTAGCGG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 826 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549058 SAMEA2778734 3702 Arabidopsis thaliana Jm-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778734 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 827 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCACTAGTCAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 827 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549059 SAMEA2778735 3702 Arabidopsis thaliana Ka-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778735 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 828 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCAGGCGTGTG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 828 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549060 SAMEA2778736 3702 Arabidopsis thaliana Ka-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778736 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 829 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCCGATCACAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 829 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549061 SAMEA2778737 3702 Arabidopsis thaliana Kas-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778737 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 830 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCCTCAGTAGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 830 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549062 SAMEA2778738 3702 Arabidopsis thaliana Kavlinge-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778738 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 831 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCGATCTGTGG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 831 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549063 SAMEA2778739 3702 Arabidopsis thaliana Kent_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778739 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 832 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCGCGGACGAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 832 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549064 SAMEA2778740 3702 Arabidopsis thaliana Kent_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778740 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 833 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCGCTCGAGGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 833 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549065 SAMEA2778741 3702 Arabidopsis thaliana Kni-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778741 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 834 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCGTACAACTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 834 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549066 SAMEA2778742 3702 Arabidopsis thaliana Kno-18_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778742 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 835 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCTACTACACG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 835 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549067 SAMEA2778743 3702 Arabidopsis thaliana Koln_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778743 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 836 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCTCTGGCATA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 836 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549068 SAMEA2778744 3702 Arabidopsis thaliana Koln_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778744 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 837 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCTGAGCTGGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 837 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549069 SAMEA2778745 3702 Arabidopsis thaliana Kondara_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778745 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 838 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCTGGTGCTAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 838 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549070 SAMEA2778746 3702 Arabidopsis thaliana Kondara_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778746 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 839 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATCTTAGACTGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 839 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549071 SAMEA2778747 3702 Arabidopsis thaliana Kulturen-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778747 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 840 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGACCATCGTG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 840 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549072 SAMEA2778748 3702 Arabidopsis thaliana Kulturen-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778748 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 841 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGACTCATTCG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 841 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549073 SAMEA2778749 3702 Arabidopsis thaliana Kz-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778749 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 842 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGAGACTCCAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 842 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549074 SAMEA2778750 3702 Arabidopsis thaliana Kz-13_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778750 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 843 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGATCGAGAGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 843 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549075 SAMEA2778751 3702 Arabidopsis thaliana Kz-13_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778751 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 844 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGCACTGGCGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 844 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549076 SAMEA2778752 3702 Arabidopsis thaliana Lc-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778752 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 845 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGCAGCTCAGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 845 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549077 SAMEA2778753 3702 Arabidopsis thaliana Lc-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778753 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 846 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGCCTGAGCAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 846 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549078 SAMEA2778754 3702 Arabidopsis thaliana Ler-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778754 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 847 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGCGTAGTGCG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 847 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549079 SAMEA2778755 3702 Arabidopsis thaliana Ler-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778755 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 848 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGGATACGCTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 848 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549080 SAMEA2778756 3702 Arabidopsis thaliana Liarum_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778756 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 849 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGGCAGCTCTA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 849 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549081 SAMEA2778757 3702 Arabidopsis thaliana Liarum_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778757 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 850 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGGCGTGCACA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 850 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549082 SAMEA2778758 3702 Arabidopsis thaliana Lillo-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778758 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 851 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGGTCTACTAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 851 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549083 SAMEA2778759 3702 Arabidopsis thaliana Lillo-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778759 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 852 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGTACGGCGAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 852 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549084 SAMEA2778760 3702 Arabidopsis thaliana Lip-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778760 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 853 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGTCACCGTGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 853 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549085 SAMEA2778761 3702 Arabidopsis thaliana Lip-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778761 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 854 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGTGCACGACT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 854 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549086 SAMEA2778762 3702 Arabidopsis thaliana Lis-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778762 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 855 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATGTGTCGACTT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 855 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549087 SAMEA2778763 3702 Arabidopsis thaliana Lis-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778763 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 856 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATTATCGTGCAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 856 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549088 SAMEA2778764 3702 Arabidopsis thaliana Lis-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778764 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 857 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers ATTCTGTGAGCG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 857 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549089 SAMEA2778765 3702 Arabidopsis thaliana Lis-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778765 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 858 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAACACGCACGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 858 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549090 SAMEA2778766 3702 Arabidopsis thaliana Lisse_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778766 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 859 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAACTATCAGCT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 859 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549091 SAMEA2778767 3702 Arabidopsis thaliana Ll-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778767 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 860 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAACTCATCGTA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 860 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549092 SAMEA2778768 3702 Arabidopsis thaliana Lm-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778768 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 861 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAAGATCGACTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 861 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549093 SAMEA2778769 3702 Arabidopsis thaliana Lm-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778769 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 862 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAAGTGAGAGAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 862 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549094 SAMEA2778770 3702 Arabidopsis thaliana Lom1-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778770 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 863 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACACGTGAGCA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 863 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549095 SAMEA2778771 3702 Arabidopsis thaliana Lov-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778771 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 864 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACAGCTCGAAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 864 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549096 SAMEA2778772 3702 Arabidopsis thaliana Lov-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778772 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 865 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACAGTGGACGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 865 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549097 SAMEA2778773 3702 Arabidopsis thaliana Lp2-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778773 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 866 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACATCTAACAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 866 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549098 SAMEA2778774 3702 Arabidopsis thaliana Lp2-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778774 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 867 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACATTGTGAGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 867 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549099 SAMEA2778775 3702 Arabidopsis thaliana Lp2-6_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778775 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 868 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACGACAGGCTA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 868 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549100 SAMEA2778776 3702 Arabidopsis thaliana Lp2-6_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778776 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 869 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACGGACTATAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 869 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549101 SAMEA2778777 3702 Arabidopsis thaliana Lu-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778777 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 870 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACGTCGATGGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 870 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549102 SAMEA2778778 3702 Arabidopsis thaliana Lu-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778778 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 871 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACGTGACATGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 871 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549103 SAMEA2778779 3702 Arabidopsis thaliana Lund_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778779 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 872 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACTACTGTTGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 872 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549104 SAMEA2778780 3702 Arabidopsis thaliana Lund_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778780 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 873 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACTCAACAGAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 873 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549105 SAMEA2778781 3702 Arabidopsis thaliana Lz-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778781 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 874 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACTCTGATTAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 874 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549106 SAMEA2778782 3702 Arabidopsis thaliana Lz-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778782 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:10Z INSDC status public Submitter Id 875 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACTGGTATATC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 875 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549107 SAMEA2778783 3702 Arabidopsis thaliana Mir-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778783 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 876 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CACTGTAGGACG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 876 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549108 SAMEA2778784 3702 Arabidopsis thaliana Ms-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778784 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 877 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGACATTGCGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 877 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549109 SAMEA2778785 3702 Arabidopsis thaliana Ms-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778785 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 878 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGACTCGCAGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 878 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549110 SAMEA2778786 3702 Arabidopsis thaliana Mt-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778786 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 879 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGAGGAGCTCT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 879 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549111 SAMEA2778787 3702 Arabidopsis thaliana Mt-0_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778787 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 880 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGATACACTTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 880 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549112 SAMEA2778788 3702 Arabidopsis thaliana Na-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778788 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 881 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGATCGGATCG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 881 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549113 SAMEA2778789 3702 Arabidopsis thaliana Na-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778789 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 882 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGCACTAAGCG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 882 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549114 SAMEA2778790 3702 Arabidopsis thaliana Nc-6_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778790 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 883 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGCATGTGTTG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 883 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549115 SAMEA2778791 3702 Arabidopsis thaliana Nc-6_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778791 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 884 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGCGGTGACAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 884 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549116 SAMEA2778792 3702 Arabidopsis thaliana Nfa-10_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778792 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 885 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGCTAGAACGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 885 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549117 SAMEA2778793 3702 Arabidopsis thaliana Nfa-8_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778793 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 886 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGGTGCTACTA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 886 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549118 SAMEA2778794 3702 Arabidopsis thaliana Nok-3_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778794 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 887 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGTACGATCTT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 887 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549119 SAMEA2778795 3702 Arabidopsis thaliana Nok-3_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778795 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 888 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGTCACTAACG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 888 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549120 SAMEA2778796 3702 Arabidopsis thaliana Nw-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778796 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 889 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGTCGAAGCTG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 889 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549121 SAMEA2778797 3702 Arabidopsis thaliana Nyl-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778797 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 890 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGTGATCCTAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 890 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549122 SAMEA2778798 3702 Arabidopsis thaliana Nyl-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778798 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 891 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGTGCATATGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 891 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549123 SAMEA2778799 3702 Arabidopsis thaliana Omo2-3_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778799 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 892 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CAGTGTCAGGAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 892 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549124 SAMEA2778800 3702 Arabidopsis thaliana Omo2-3_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778800 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 893 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATACCAGTAGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 893 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549125 SAMEA2778801 3702 Arabidopsis thaliana Or-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778801 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 894 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATAGACGTTCG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 894 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549126 SAMEA2778802 3702 Arabidopsis thaliana Or-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778802 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 895 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATAGCGAGTTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 895 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549127 SAMEA2778803 3702 Arabidopsis thaliana Ost-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778803 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 896 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATATACTCGCA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 896 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549128 SAMEA2778804 3702 Arabidopsis thaliana Oy-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778804 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 897 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATATCGCAGTT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 897 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549129 SAMEA2778805 3702 Arabidopsis thaliana Oy-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778805 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 898 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATCAGCGTGTA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 898 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549130 SAMEA2778806 3702 Arabidopsis thaliana Per-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778806 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 899 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATCATGAGGCT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 899 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549131 SAMEA2778807 3702 Arabidopsis thaliana Per-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778807 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:08Z INSDC status public Submitter Id 900 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATCGTATCAAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 900 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549132 SAMEA2778808 3702 Arabidopsis thaliana Petergof_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778808 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 901 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATCTGTAGCGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 901 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549133 SAMEA2778809 3702 Arabidopsis thaliana Petergof_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778809 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 902 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATGAGTGCTAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 902 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549134 SAMEA2778810 3702 Arabidopsis thaliana Pi-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778810 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 903 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATGCAGACTGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 903 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549135 SAMEA2778811 3702 Arabidopsis thaliana Pi-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778811 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 904 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATGGCTACACA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 904 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549136 SAMEA2778812 3702 Arabidopsis thaliana Pna-10_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778812 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 905 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATGTAATGCTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 905 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549137 SAMEA2778813 3702 Arabidopsis thaliana Pna-10_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778813 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 906 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATGTCTCTCCG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 906 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549138 SAMEA2778814 3702 Arabidopsis thaliana Pna-17_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778814 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 907 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATTCGATGACT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 907 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549139 SAMEA2778815 3702 Arabidopsis thaliana Pro-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778815 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 908 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CATTGTCTGTGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 908 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549140 SAMEA2778816 3702 Arabidopsis thaliana Pro-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778816 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 909 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CCAGATGATCGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 909 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549141 SAMEA2778817 3702 Arabidopsis thaliana Pu2-23_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778817 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 910 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CCAGTGTATGCA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 910 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549142 SAMEA2778818 3702 Arabidopsis thaliana Pu2-23_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778818 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 911 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CCATACATAGCT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 911 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549143 SAMEA2778819 3702 Arabidopsis thaliana Pu2-7_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778819 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 912 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CCGACTGAGATG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 912 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549144 SAMEA2778820 3702 Arabidopsis thaliana Pu2-7_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778820 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 913 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CCGATGTCAGAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 913 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549145 SAMEA2778821 3702 Arabidopsis thaliana Pu2-8_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778821 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 914 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CCTAGTACTGAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 914 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549146 SAMEA2778822 3702 Arabidopsis thaliana Pu2-8_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778822 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 915 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CCTCTCGTGATC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 915 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549147 SAMEA2778823 3702 Arabidopsis thaliana Ra-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778823 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 916 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGAAGACTGCTG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 916 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549148 SAMEA2778824 3702 Arabidopsis thaliana Rak-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778824 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 917 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGAATCGACACT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 917 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549149 SAMEA2778825 3702 Arabidopsis thaliana Rak-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778825 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 918 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGACAGCTGACA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 918 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549150 SAMEA2778826 3702 Arabidopsis thaliana Rd-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778826 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 919 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGACATGCTATT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 919 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549151 SAMEA2778827 3702 Arabidopsis thaliana Rd-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778827 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 920 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGACTTATGTGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 920 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549152 SAMEA2778828 3702 Arabidopsis thaliana Ren-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778828 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 921 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGAGAGTTACGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 921 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549153 SAMEA2778829 3702 Arabidopsis thaliana Ren-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778829 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 922 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGAGCAGCACAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 922 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549154 SAMEA2778830 3702 Arabidopsis thaliana Ren-11_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778830 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:17Z INSDC status public Submitter Id 923 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGAGGCTCAGTA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 923 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549155 SAMEA2778831 3702 Arabidopsis thaliana Ren-11_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778831 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 924 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGAGTCTAGTTG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 924 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549156 SAMEA2778832 3702 Arabidopsis thaliana Rev-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778832 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 925 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGAGTTGTAGCG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 925 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549157 SAMEA2778833 3702 Arabidopsis thaliana Rev-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778833 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 926 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGATAGATCTTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 926 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549158 SAMEA2778834 3702 Arabidopsis thaliana Rmx-a02_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778834 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 927 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGATATTCATCG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 927 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549159 SAMEA2778835 3702 Arabidopsis thaliana Rmx-a02_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778835 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 928 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGATCGAGTGTT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 928 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549160 SAMEA2778836 3702 Arabidopsis thaliana Rmx-a180_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778836 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 929 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGATGCACCAGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 929 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549161 SAMEA2778837 3702 Arabidopsis thaliana Rmx-a180_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778837 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 930 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGATGTCGTCAA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 930 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549162 SAMEA2778838 3702 Arabidopsis thaliana Rrs-7_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778838 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 931 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGCACATGTTAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 931 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549163 SAMEA2778839 3702 Arabidopsis thaliana Rrs-7_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778839 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 932 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGCACTCTAGAA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 932 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549164 SAMEA2778840 3702 Arabidopsis thaliana Rsch-4_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778840 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 933 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGCAGACAGACT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 933 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549165 SAMEA2778841 3702 Arabidopsis thaliana Rsch-4_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778841 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 934 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGCAGCGGTATA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 934 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549166 SAMEA2778842 3702 Arabidopsis thaliana Rubezhnoe-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778842 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 935 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGCATGAGGATC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 935 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549167 SAMEA2778843 3702 Arabidopsis thaliana Rubezhnoe-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778843 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 936 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGCGATAGCAGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 936 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549168 SAMEA2778844 3702 Arabidopsis thaliana San-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778844 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 937 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGCGTAACTGTA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 937 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549169 SAMEA2778845 3702 Arabidopsis thaliana Sanna-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778845 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 938 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGCTAGAACGCA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 938 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549170 SAMEA2778846 3702 Arabidopsis thaliana Sanna-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778846 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 939 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGCTTATCGAGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 939 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549171 SAMEA2778847 3702 Arabidopsis thaliana Santa_clara_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778847 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 940 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGGAGTGTCTAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 940 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549172 SAMEA2778848 3702 Arabidopsis thaliana Santa_clara_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778848 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 941 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGGCGATGTACA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 941 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549173 SAMEA2778849 3702 Arabidopsis thaliana Sap-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778849 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 942 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGTAAGTCTACT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 942 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549174 SAMEA2778850 3702 Arabidopsis thaliana Sap-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778850 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 943 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGTACAGTTATC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 943 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549175 SAMEA2778851 3702 Arabidopsis thaliana Sav-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778851 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 944 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGTACTAGACTG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 944 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549176 SAMEA2778852 3702 Arabidopsis thaliana Se-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778852 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 945 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGTAGAACGTGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 945 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549177 SAMEA2778853 3702 Arabidopsis thaliana Sf-1_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778853 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 946 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGTATCTGCGAA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 946 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549178 SAMEA2778854 3702 Arabidopsis thaliana Sf-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778854 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 947 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGTATGCTGTAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 947 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549179 SAMEA2778855 3702 Arabidopsis thaliana Shahdara_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778855 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 948 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGTCAACGATGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 948 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549180 SAMEA2778856 3702 Arabidopsis thaliana Sorbo_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778856 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 949 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGTCACGACTAA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 949 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549181 SAMEA2778857 3702 Arabidopsis thaliana Spr1-2_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778857 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 950 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGTCAGACGGAT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 950 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549182 SAMEA2778858 3702 Arabidopsis thaliana Spr1-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778858 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 951 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGTCGATCTCTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 951 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549183 SAMEA2778859 3702 Arabidopsis thaliana Sq-1_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778859 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 952 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGTGACAATGTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 952 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549184 SAMEA2778860 3702 Arabidopsis thaliana Sq-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778860 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 953 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGTGATCTCTCC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 953 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549185 SAMEA2778861 3702 Arabidopsis thaliana Sq-8_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778861 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 954 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGTGCATTATCA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 954 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549186 SAMEA2778862 3702 Arabidopsis thaliana Sr5_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778862 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 955 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGTGTACATCAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 955 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549187 SAMEA2778863 3702 Arabidopsis thaliana Sr5_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778863 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 956 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGTGTGATCAGG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 956 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549188 SAMEA2778864 3702 Arabidopsis thaliana St-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778864 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 957 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGTTACTAGAGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 957 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549189 SAMEA2778865 3702 Arabidopsis thaliana St-0_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778865 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 958 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGTTATGTACAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 958 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549190 SAMEA2778866 3702 Arabidopsis thaliana Stu1-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778866 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 959 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CGTTCGCATAGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 959 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549191 SAMEA2778867 3702 Arabidopsis thaliana Stu1-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778867 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 960 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTAACGCAGTCA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 960 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549192 SAMEA2778868 3702 Arabidopsis thaliana Stw-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778868 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 961 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTACACAAGCAC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 961 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549193 SAMEA2778869 3702 Arabidopsis thaliana Stw-0_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778869 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:12Z INSDC status public Submitter Id 962 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTACATCTAAGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 962 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549194 SAMEA2778870 3702 Arabidopsis thaliana Ta-0_1 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778870 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 963 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTACGCGTCTCT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 963 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549195 SAMEA2778871 3702 Arabidopsis thaliana Ta-0_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778871 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 964 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTACTACAGGTG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 964 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549196 SAMEA2778872 3702 Arabidopsis thaliana Tamm-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778872 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 965 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTACTGATATCG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 965 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549197 SAMEA2778873 3702 Arabidopsis thaliana Tamm-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778873 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 966 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTAGAACGCACT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 966 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549198 SAMEA2778874 3702 Arabidopsis thaliana Tamm-27_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778874 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:11Z INSDC status public Submitter Id 967 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTAGAGACTCTT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 967 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549199 SAMEA2778875 3702 Arabidopsis thaliana Tamm-27_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778875 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:07Z INSDC status public Submitter Id 968 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTAGCGAACATC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 968 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549200 SAMEA2778876 3702 Arabidopsis thaliana Tottarp-2_2 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778876 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:16Z INSDC status public Submitter Id 969 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTAGGTCACTAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 969 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549201 SAMEA2778877 3702 Arabidopsis thaliana Tottarp-2_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2778877 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:15Z INSDC status public Submitter Id 970 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers CTAGTCAGCTGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 970 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549460 SAMEA2779136 3702 Arabidopsis thaliana Mz-0_5 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779136 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 1229 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCGAGCTATCT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1229 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549461 SAMEA2779137 3702 Arabidopsis thaliana Nd-1_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779137 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 1230 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCGTAGGTCGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1230 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549462 SAMEA2779138 3702 Arabidopsis thaliana Nd-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779138 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 1231 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCTCCATACAG pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1231 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549463 SAMEA2779139 3702 Arabidopsis thaliana Rrs-10_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779139 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 1232 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGCTGACTAGTC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1232 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549464 SAMEA2779140 3702 Arabidopsis thaliana Rrs-10_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779140 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 1233 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGGACGCACTGT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1233 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549466 SAMEA2779142 3702 Arabidopsis thaliana Omo2-1_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779142 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:18Z INSDC status public Submitter Id 1235 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTACTGCAGGC pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1235 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549467 SAMEA2779143 3702 Arabidopsis thaliana Ull2-5_3 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779143 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:05Z INSDC last update 2016-10-21T09:41:09Z INSDC status public Submitter Id 1236 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTCACATCACT pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1236 sequencing method 454 target gene ITS1 target subfragment ITS1 ERS549468 SAMEA2779144 3702 Arabidopsis thaliana Ull2-5_4 ENA first public 2014-10-03 ENA last update 2016-10-21 External Id SAMEA2779144 INSDC center alias GREGOR MENDEL INSTITUTE INSDC center name GREGOR MENDEL INSTITUTE INSDC first public 2014-10-03T17:01:06Z INSDC last update 2016-10-21T09:41:13Z INSDC status public Submitter Id 1237 adapters CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG collection date 2009-03-27 common name thale cress environment (biome) 113 environment (feature) field environment (material) soil geographic location (country and/or sea) USA geographic location (latitude) 42.0831 geographic location (longitude) 86.351 geographic location (region and locality) Benton Harbor, Michigan host age 179 host common name Arabidopsis thaliana host taxid 3702 investigation type mimarks-survey multiplex identifiers AGTCTACTCTGA pcr primers CTTGGTCATTTAGAGGAAGTAA, CAGCTGCGTTCTTCATCGATGC plant-associated environmental package plant-associated project name Arabidopsis leaves sample name 1237 sequencing method 454 target gene ITS1 target subfragment ITS1