ERX951334 SC_PacBio_EXP_m150304_032005_00127 SC_PacBio_EXP_m150304_032005_00127 ERP005928 NCTC_3000-sc-3012 PacBio sequencing of library 12944964, constructed from sample accession ERS647567 for study accession ERP005928. ERS647567 NCTC5742-sc-2222874 12944964 WGS GENOMIC RANDOM 0 Application Read Forward 1 1 Technical Read Adapter ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT PacBio RS BindingKit 100236500 SequencingKit 001558034 InstCtrlVer 2.3.0.0.140640 ERX951335 SC_PacBio_EXP_m150304_064005_00127 SC_PacBio_EXP_m150304_064005_00127 ERP005928 NCTC_3000-sc-3012 PacBio sequencing of library 12944967, constructed from sample accession ERS647568 for study accession ERP005928. ERS647568 NCTC4199-sc-2222875 12944967 WGS GENOMIC RANDOM 0 Application Read Forward 1 1 Technical Read Adapter ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT PacBio RS BindingKit 100236500 SequencingKit 001558034 InstCtrlVer 2.3.0.0.140640