ERS7802062 SAMEA10145555 506600 chicken gut metagenome Chicken gut metagenomic data from Ileum content; animal CA01.16 from cage CA01 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145555 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CA01_16C1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-03-12 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Ileum content host breed Cobb host common name Chicken host diet treatment Control host disease status Campylobacter:-;Salmonella:-;Clostridium:- host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CA01.16 host taxid 9031 host total mass 2350.4 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CA01_16C1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802063 SAMEA10145556 506600 chicken gut metagenome Chicken gut metagenomic data from Caecum content; animal CA01.16 from cage CA01 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145556 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CA01_16F1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-03-12 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Caecum content host breed Cobb host common name Chicken host diet treatment Control host disease status Campylobacter:-;Salmonella:-;Clostridium:- host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CA01.16 host taxid 9031 host total mass 2350.4 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CA01_16F1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802064 SAMEA10145557 506600 chicken gut metagenome Chicken gut metagenomic data from Ileum content; animal CA01.18 from cage CA01 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145557 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CA01_18C1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-03-13 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Ileum content host breed Cobb host common name Chicken host diet treatment Control host disease status Campylobacter:-;Salmonella:-;Clostridium:- host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CA01.18 host taxid 9031 host total mass 2844.8 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CA01_18C1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802066 SAMEA10145559 506600 chicken gut metagenome Chicken gut metagenomic data from Ileum content; animal CA11.14 from cage CA11 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145559 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CA11_14C1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-03-11 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Ileum content host breed Ross host common name Chicken host diet treatment Control host disease status Campylobacter:-;Salmonella:-;Clostridium:- host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CA11.14 host taxid 9031 host total mass 1830.8 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CA11_14C1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802067 SAMEA10145560 506600 chicken gut metagenome Chicken gut metagenomic data from Caecum content; animal CA11.14 from cage CA11 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145560 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CA11_14F1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-03-11 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Caecum content host breed Ross host common name Chicken host diet treatment Control host disease status Campylobacter:-;Salmonella:-;Clostridium:- host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CA11.14 host taxid 9031 host total mass 1830.8 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CA11_14F1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802068 SAMEA10145561 506600 chicken gut metagenome Chicken gut metagenomic data from Ileum content; animal CA11.16 from cage CA11 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145561 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CA11_16C1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-03-12 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Ileum content host breed Ross host common name Chicken host diet treatment Control host disease status Campylobacter:-;Salmonella:-;Clostridium:- host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CA11.16 host taxid 9031 host total mass 2074.4 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CA11_16C1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802069 SAMEA10145562 506600 chicken gut metagenome Chicken gut metagenomic data from Caecum content; animal CA11.16 from cage CA11 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145562 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CA11_16F1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-03-12 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Caecum content host breed Ross host common name Chicken host diet treatment Control host disease status Campylobacter:-;Salmonella:-;Clostridium:- host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CA11.16 host taxid 9031 host total mass 2074.4 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CA11_16F1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802070 SAMEA10145563 506600 chicken gut metagenome Chicken gut metagenomic data from Ileum content; animal CA22.15 from cage CA22 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145563 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CA22_15C1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-03-12 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Ileum content host breed Cobb host common name Chicken host diet treatment Control host disease status Campylobacter:-;Salmonella:-;Clostridium:- host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CA22.15 host taxid 9031 host total mass 2385.4 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CA22_15C1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802071 SAMEA10145564 506600 chicken gut metagenome Chicken gut metagenomic data from Caecum content; animal CA22.15 from cage CA22 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145564 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CA22_15F1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-03-12 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Caecum content host breed Cobb host common name Chicken host diet treatment Control host disease status Campylobacter:-;Salmonella:-;Clostridium:- host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CA22.15 host taxid 9031 host total mass 2385.4 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CA22_15F1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802072 SAMEA10145565 506600 chicken gut metagenome Chicken gut metagenomic data from Ileum content; animal CA22.18 from cage CA22 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145565 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CA22_18C1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-03-13 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Ileum content host breed Cobb host common name Chicken host diet treatment Control host disease status Campylobacter:-;Salmonella:-;Clostridium:+ host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CA22.18 host taxid 9031 host total mass 2871.0 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CA22_18C1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802073 SAMEA10145566 506600 chicken gut metagenome Chicken gut metagenomic data from Caecum content; animal CA22.18 from cage CA22 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145566 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CA22_18F1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-03-13 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Caecum content host breed Cobb host common name Chicken host diet treatment Control host disease status Campylobacter:-;Salmonella:-;Clostridium:+ host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CA22.18 host taxid 9031 host total mass 2871.0 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CA22_18F1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802074 SAMEA10145567 506600 chicken gut metagenome Chicken gut metagenomic data from Ileum content; animal CA23.14 from cage CA23 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145567 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CA23_14C1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-03-11 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Ileum content host breed Ross host common name Chicken host diet treatment Control host disease status Campylobacter:-;Salmonella:-;Clostridium:- host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CA23.14 host taxid 9031 host total mass 1923.4 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CA23_14C1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802075 SAMEA10145568 506600 chicken gut metagenome Chicken gut metagenomic data from Caecum content; animal CA23.14 from cage CA23 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145568 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CA23_14F1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-03-11 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Caecum content host breed Ross host common name Chicken host diet treatment Control host disease status Campylobacter:-;Salmonella:-;Clostridium:- host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CA23.14 host taxid 9031 host total mass 1923.4 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CA23_14F1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802076 SAMEA10145569 506600 chicken gut metagenome Chicken gut metagenomic data from Ileum content; animal CA23.16 from cage CA23 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145569 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CA23_16C1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-03-12 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Ileum content host breed Ross host common name Chicken host diet treatment Control host disease status Campylobacter:-;Salmonella:-;Clostridium:- host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CA23.16 host taxid 9031 host total mass 2491.2 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CA23_16C1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802077 SAMEA10145570 506600 chicken gut metagenome Chicken gut metagenomic data from Caecum content; animal CA23.16 from cage CA23 with treatment CC ENA-FIRST-PUBLIC 2023-03-22T12:21:57Z ENA-LAST-UPDATE 2023-03-22T12:21:57Z External Id SAMEA10145570 INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CA23_16F1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-03-12 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Caecum content host breed Ross host common name Chicken host diet treatment Control host disease status Campylobacter:-;Salmonella:-;Clostridium:- host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CA23.16 host taxid 9031 host total mass 2491.2 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project HoloFood project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CA23_16F1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802078 SAMEA10145571 506600 chicken gut metagenome Chicken gut metagenomic data from Ileum content; animal CB03.14 from cage CB03 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145571 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CB03_14C1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-06-03 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Ileum content host breed Cobb host common name Chicken host diet treatment Control host disease status Campylobacter:NS;Salmonella:NS;Clostridium:NS host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CB03.14 host taxid 9031 host total mass 2700.5 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CB03_14C1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802079 SAMEA10145572 506600 chicken gut metagenome Chicken gut metagenomic data from Caecum content; animal CB03.14 from cage CB03 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145572 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CB03_14F1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-06-03 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Caecum content host breed Cobb host common name Chicken host diet treatment Control host disease status Campylobacter:NS;Salmonella:NS;Clostridium:NS host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CB03.14 host taxid 9031 host total mass 2700.5 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CB03_14F1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802081 SAMEA10145574 506600 chicken gut metagenome Chicken gut metagenomic data from Ileum content; animal CB12.14 from cage CB12 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145574 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CB12_14C1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-06-03 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Ileum content host breed Ross host common name Chicken host diet treatment Control host disease status Campylobacter:-;Salmonella:-;Clostridium:- host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CB12.14 host taxid 9031 host total mass 2902.5 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CB12_14C1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802082 SAMEA10145575 506600 chicken gut metagenome Chicken gut metagenomic data from Caecum content; animal CB12.14 from cage CB12 with treatment CC ENA-FIRST-PUBLIC 2023-03-22T12:21:57Z ENA-LAST-UPDATE 2023-03-22T12:21:57Z External Id SAMEA10145575 INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CB12_14F1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-06-03 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Caecum content host breed Ross host common name Chicken host diet treatment Control host disease status Campylobacter:-;Salmonella:-;Clostridium:- host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CB12.14 host taxid 9031 host total mass 2902.5 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project HoloFood project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CB12_14F1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802083 SAMEA10145576 506600 chicken gut metagenome Chicken gut metagenomic data from Ileum content; animal CB12.17 from cage CB12 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145576 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CB12_17C1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-06-05 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Ileum content host breed Ross host common name Chicken host diet treatment Control host disease status Campylobacter:-;Salmonella:-;Clostridium:- host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CB12.17 host taxid 9031 host total mass 2400.7 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CB12_17C1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802084 SAMEA10145577 506600 chicken gut metagenome Chicken gut metagenomic data from Caecum content; animal CB12.17 from cage CB12 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145577 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CB12_17F1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-06-05 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Caecum content host breed Ross host common name Chicken host diet treatment Control host disease status Campylobacter:-;Salmonella:-;Clostridium:- host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CB12.17 host taxid 9031 host total mass 2400.7 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CB12_17F1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802085 SAMEA10145578 506600 chicken gut metagenome Chicken gut metagenomic data from Ileum content; animal CB17.14 from cage CB17 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145578 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CB17_14C1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-06-03 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Ileum content host breed Cobb host common name Chicken host diet treatment Control host disease status Campylobacter:-;Salmonella:-;Clostridium:- host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CB17.14 host taxid 9031 host total mass 2362.0 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CB17_14C1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802086 SAMEA10145579 506600 chicken gut metagenome Chicken gut metagenomic data from Caecum content; animal CB17.14 from cage CB17 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145579 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CB17_14F1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-06-03 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Caecum content host breed Cobb host common name Chicken host diet treatment Control host disease status Campylobacter:-;Salmonella:-;Clostridium:- host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CB17.14 host taxid 9031 host total mass 2362.0 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CB17_14F1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802087 SAMEA10145580 506600 chicken gut metagenome Chicken gut metagenomic data from Ileum content; animal CB17.18 from cage CB17 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145580 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CB17_18C1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-06-05 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Ileum content host breed Cobb host common name Chicken host diet treatment Control host disease status Campylobacter:-;Salmonella:-;Clostridium:- host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CB17.18 host taxid 9031 host total mass 2758.3 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CB17_18C1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802088 SAMEA10145581 506600 chicken gut metagenome Chicken gut metagenomic data from Caecum content; animal CB17.18 from cage CB17 with treatment CC ENA-FIRST-PUBLIC 2023-03-22T12:21:57Z ENA-LAST-UPDATE 2023-03-22T12:21:57Z External Id SAMEA10145581 INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CB17_18F1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-06-05 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Caecum content host breed Cobb host common name Chicken host diet treatment Control host disease status Campylobacter:-;Salmonella:-;Clostridium:- host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CB17.18 host taxid 9031 host total mass 2758.3 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project HoloFood project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CB17_18F1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802089 SAMEA10145582 506600 chicken gut metagenome Chicken gut metagenomic data from Ileum content; animal CB20.15 from cage CB20 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145582 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CB20_15C1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-06-04 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Ileum content host breed Ross host common name Chicken host diet treatment Control host disease status Campylobacter:-;Salmonella:-;Clostridium:- host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CB20.15 host taxid 9031 host total mass 2287.0 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CB20_15C1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802090 SAMEA10145583 506600 chicken gut metagenome Chicken gut metagenomic data from Caecum content; animal CB20.15 from cage CB20 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145583 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CB20_15F1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-06-04 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Caecum content host breed Ross host common name Chicken host diet treatment Control host disease status Campylobacter:-;Salmonella:-;Clostridium:- host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CB20.15 host taxid 9031 host total mass 2287.0 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CB20_15F1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802091 SAMEA10145584 506600 chicken gut metagenome Chicken gut metagenomic data from Ileum content; animal CB20.18 from cage CB20 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145584 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CB20_18C1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-06-05 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Ileum content host breed Ross host common name Chicken host diet treatment Control host disease status Campylobacter:NS;Salmonella:NS;Clostridium:NS host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CB20.18 host taxid 9031 host total mass 2639.2 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CB20_18C1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802092 SAMEA10145585 506600 chicken gut metagenome Chicken gut metagenomic data from Caecum content; animal CB20.18 from cage CB20 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145585 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CB20_18F1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-06-05 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Caecum content host breed Ross host common name Chicken host diet treatment Control host disease status Campylobacter:NS;Salmonella:NS;Clostridium:NS host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CB20.18 host taxid 9031 host total mass 2639.2 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CB20_18F1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802093 SAMEA10145586 506600 chicken gut metagenome Chicken gut metagenomic data from Ileum content; animal CC03.13 from cage CC03 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145586 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CC03_13C1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-10-14 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Ileum content host breed Cobb host common name Chicken host diet treatment Control host disease status Campylobacter:+;Salmonella:-;Clostridium:- host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CC03.13 host taxid 9031 host total mass 1774.0 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CC03_13C1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802094 SAMEA10145587 506600 chicken gut metagenome Chicken gut metagenomic data from Caecum content; animal CC03.13 from cage CC03 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145587 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CC03_13F1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-10-14 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Caecum content host breed Cobb host common name Chicken host diet treatment Control host disease status Campylobacter:+;Salmonella:-;Clostridium:- host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CC03.13 host taxid 9031 host total mass 1774.0 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CC03_13F1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802095 SAMEA10145588 506600 chicken gut metagenome Chicken gut metagenomic data from Ileum content; animal CC03.14 from cage CC03 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145588 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CC03_14C1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-10-14 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Ileum content host breed Cobb host common name Chicken host diet treatment Control host disease status Campylobacter:+;Salmonella:-;Clostridium:- host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CC03.14 host taxid 9031 host total mass 2274.0 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CC03_14C1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802096 SAMEA10145589 506600 chicken gut metagenome Chicken gut metagenomic data from Caecum content; animal CC03.14 from cage CC03 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145589 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CC03_14F1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-10-14 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Caecum content host breed Cobb host common name Chicken host diet treatment Control host disease status Campylobacter:+;Salmonella:-;Clostridium:- host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CC03.14 host taxid 9031 host total mass 2274.0 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CC03_14F1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802099 SAMEA10145592 506600 chicken gut metagenome Chicken gut metagenomic data from Ileum content; animal CC08.17 from cage CC08 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145592 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CC08_17C1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-10-16 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Ileum content host breed Ross host common name Chicken host diet treatment Control host disease status Campylobacter:+;Salmonella:-;Clostridium:- host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CC08.17 host taxid 9031 host total mass 1134.0 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CC08_17C1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802100 SAMEA10145593 506600 chicken gut metagenome Chicken gut metagenomic data from Caecum content; animal CC08.17 from cage CC08 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145593 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CC08_17F1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-10-16 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Caecum content host breed Ross host common name Chicken host diet treatment Control host disease status Campylobacter:+;Salmonella:-;Clostridium:- host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CC08.17 host taxid 9031 host total mass 1134.0 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CC08_17F1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802101 SAMEA10145594 506600 chicken gut metagenome Chicken gut metagenomic data from Ileum content; animal CC17.15 from cage CC17 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145594 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CC17_15C1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-10-15 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Ileum content host breed Cobb host common name Chicken host diet treatment Control host disease status Campylobacter:+;Salmonella:-;Clostridium:- host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CC17.15 host taxid 9031 host total mass 1748.0 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CC17_15C1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802102 SAMEA10145595 506600 chicken gut metagenome Chicken gut metagenomic data from Caecum content; animal CC17.15 from cage CC17 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145595 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CC17_15F1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-10-15 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Caecum content host breed Cobb host common name Chicken host diet treatment Control host disease status Campylobacter:+;Salmonella:-;Clostridium:- host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CC17.15 host taxid 9031 host total mass 1748.0 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CC17_15F1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802103 SAMEA10145596 506600 chicken gut metagenome Chicken gut metagenomic data from Ileum content; animal CC17.16 from cage CC17 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145596 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CC17_16C1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-10-15 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Ileum content host breed Cobb host common name Chicken host diet treatment Control host disease status Campylobacter:+;Salmonella:-;Clostridium:- host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CC17.16 host taxid 9031 host total mass 2428.0 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CC17_16C1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802104 SAMEA10145597 506600 chicken gut metagenome Chicken gut metagenomic data from Caecum content; animal CC17.16 from cage CC17 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145597 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CC17_16F1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-10-15 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Caecum content host breed Cobb host common name Chicken host diet treatment Control host disease status Campylobacter:+;Salmonella:-;Clostridium:- host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CC17.16 host taxid 9031 host total mass 2428.0 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CC17_16F1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802105 SAMEA10145598 506600 chicken gut metagenome Chicken gut metagenomic data from Ileum content; animal CC19.13 from cage CC19 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145598 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CC19_13C1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-10-14 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Ileum content host breed Ross host common name Chicken host diet treatment Control host disease status Campylobacter:+;Salmonella:-;Clostridium:- host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CC19.13 host taxid 9031 host total mass 1982.0 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CC19_13C1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802106 SAMEA10145599 506600 chicken gut metagenome Chicken gut metagenomic data from Caecum content; animal CC19.13 from cage CC19 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145599 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CC19_13F1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-10-14 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Caecum content host breed Ross host common name Chicken host diet treatment Control host disease status Campylobacter:+;Salmonella:-;Clostridium:- host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CC19.13 host taxid 9031 host total mass 1982.0 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CC19_13F1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802107 SAMEA10145600 506600 chicken gut metagenome Chicken gut metagenomic data from Ileum content; animal CC19.14 from cage CC19 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145600 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CC19_14C1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-10-14 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Ileum content host breed Ross host common name Chicken host diet treatment Control host disease status Campylobacter:+;Salmonella:-;Clostridium:- host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CC19.14 host taxid 9031 host total mass 2124.0 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CC19_14C1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35 ERS7802108 SAMEA10145601 506600 chicken gut metagenome Chicken gut metagenomic data from Caecum content; animal CC19.14 from cage CC19 with treatment CC ENA-FIRST-PUBLIC 2023-03-22 ENA-LAST-UPDATE 2023-03-22 External Id SAMEA10145601 INSDC center alias UNIVERSITY OF COPENHAGEN INSDC center name UNIVERSITY OF COPENHAGEN INSDC first public 2023-03-22T12:21:57Z INSDC last update 2023-03-22T12:21:57Z INSDC status public Submitter Id CC19_14F1a_NTM_metaG adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date 2019-10-14 common name Chicken Gut Metagenome geographic location (country and/or sea) Spain geographic location (latitude) 41.170047 geographic location (longitude) 1.168491 geographic location (region and locality) El Morell; Tarragona host body site Caecum content host breed Ross host common name Chicken host diet treatment Control host disease status Campylobacter:+;Salmonella:-;Clostridium:- host scientific name Gallus gallus host sex male host storage container temperature 21 host subject id CC19.14 host taxid 9031 host total mass 2124.0 library name BEMT library selection PCR nucleic acid extraction D-rex protocol project name HoloFood Chicken - None targeted metabolomic reference host genome for decontamination GCF_000002315.6 sample name CC19_14F1a_NTM_metaG sample storage buffer Shield sample storage container E-matrix 2ml sample storage location UCPH sample storage temperature -20 sample volume or weight for DNA extraction 0.2 scientific_name chicken gut metagenome sequencing method MGISEQ-2000 trial length 35 trial timepoint 35