ERS8197485 SAMEA10545486 408172 marine metagenome Reef1_Herthas Flak_US_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545486 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:922-12606 collection date 2020-08-10 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 26 geographic location (latitude) 57.658333 geographic location (longitude) 10.866667 investigation type mimarks-survey multiplex identifiers P20262_1208 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:922-12606 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197486 SAMEA10545487 408172 marine metagenome Reef1_Herthas Flak_US_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545487 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:923-12607 collection date 2020-08-10 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 26 geographic location (latitude) 57.658333 geographic location (longitude) 10.866667 investigation type mimarks-survey multiplex identifiers P20262_1209 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:923-12607 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197487 SAMEA10545488 408172 marine metagenome Reef1_Herthas Flak_Reef_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545488 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:923-12608 collection date 2020-08-10 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 15 geographic location (latitude) 57.641333 geographic location (longitude) 10.8655 investigation type mimarks-survey multiplex identifiers P20262_1210 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:923-12608 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197488 SAMEA10545489 408172 marine metagenome Reef1_Herthas Flak_Reef_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545489 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:923-12609 collection date 2020-08-10 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 15 geographic location (latitude) 57.641333 geographic location (longitude) 10.8655 investigation type mimarks-survey multiplex identifiers P20262_1211 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:923-12609 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197489 SAMEA10545490 408172 marine metagenome Reef1_Herthas Flak_DS_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545490 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:923-12610 collection date 2020-08-10 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 25 geographic location (latitude) 57.625 geographic location (longitude) 10.866667 investigation type mimarks-survey multiplex identifiers P20262_1212 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:923-12610 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197490 SAMEA10545491 408172 marine metagenome Reef1_Herthas Flak_DS_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545491 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:923-12611 collection date 2020-08-10 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 25 geographic location (latitude) 57.625 geographic location (longitude) 10.866667 investigation type mimarks-survey multiplex identifiers P20262_1213 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:923-12611 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197491 SAMEA10545492 408172 marine metagenome Reef2_Per Nilen_US_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545492 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:923-12612 collection date 2020-08-11 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 15 geographic location (latitude) 57.341667 geographic location (longitude) 11.13 investigation type mimarks-survey multiplex identifiers P20262_1214 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:923-12612 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197492 SAMEA10545493 408172 marine metagenome Reef2_Per Nilen_US_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545493 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:923-12613 collection date 2020-08-11 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 15 geographic location (latitude) 57.341667 geographic location (longitude) 11.13 investigation type mimarks-survey multiplex identifiers P20262_1215 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:923-12613 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197493 SAMEA10545494 408172 marine metagenome Reef2_Per Nilen_Reef_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545494 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:923-12614 collection date 2020-08-11 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 10 geographic location (latitude) 57.379 geographic location (longitude) 11.043333 investigation type mimarks-survey multiplex identifiers P20262_1216 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:923-12614 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197494 SAMEA10545495 408172 marine metagenome Reef2_Per Nilen_Reef_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545495 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:924-12615 collection date 2020-08-11 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 10 geographic location (latitude) 57.379 geographic location (longitude) 11.043333 investigation type mimarks-survey multiplex identifiers P20262_1217 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:924-12615 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197495 SAMEA10545496 408172 marine metagenome Reef2_Per Nilen_DS_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545496 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:924-12616 collection date 2020-08-11 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 7 geographic location (latitude) 57.386667 geographic location (longitude) 11.033333 investigation type mimarks-survey multiplex identifiers P20262_1218 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:924-12616 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197496 SAMEA10545497 408172 marine metagenome Reef2_Per Nilen_DS_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545497 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:924-12617 collection date 2020-08-11 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 7 geographic location (latitude) 57.386667 geographic location (longitude) 11.033333 investigation type mimarks-survey multiplex identifiers P20262_1219 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:924-12617 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197497 SAMEA10545498 408172 marine metagenome Reef3_Tonneberg Banke_US_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545498 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:924-12618 collection date 2020-08-12 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 27 geographic location (latitude) 57.408333 geographic location (longitude) 11.266667 investigation type mimarks-survey multiplex identifiers P20262_1220 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:924-12618 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197498 SAMEA10545499 408172 marine metagenome Reef3_Tonneberg Banke_US_B ENA-FIRST-PUBLIC 2021-10-29T00:29:30Z ENA-LAST-UPDATE 2021-10-29T00:29:30Z External Id SAMEA10545499 INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:924-12619 collection date 2020-08-12 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 27 geographic location (latitude) 57.408333 geographic location (longitude) 11.266667 investigation type mimarks-survey multiplex identifiers P20262_1221 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:924-12619 scientific_name marine metagenome sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197499 SAMEA10545500 408172 marine metagenome Reef3_Tonneberg Banke_Reef_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545500 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:924-12620 collection date 2020-08-12 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 12 geographic location (latitude) 57.4715 geographic location (longitude) 11.270833 investigation type mimarks-survey multiplex identifiers P20262_1222 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:924-12620 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197500 SAMEA10545501 408172 marine metagenome Reef3_Tonneberg Banke_Reef_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545501 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:924-12621 collection date 2020-08-12 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 12 geographic location (latitude) 57.4715 geographic location (longitude) 11.270833 investigation type mimarks-survey multiplex identifiers P20262_1223 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:924-12621 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197501 SAMEA10545502 408172 marine metagenome Reef3_Tonneberg Banke_DS_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545502 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:924-12622 collection date 2020-08-12 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 17 geographic location (latitude) 57.491667 geographic location (longitude) 11.266667 investigation type mimarks-survey multiplex identifiers P20262_1224 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:924-12622 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197502 SAMEA10545503 408172 marine metagenome Reef3_Tonneberg Banke_DS_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545503 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:924-12623 collection date 2020-08-12 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 17 geographic location (latitude) 57.491667 geographic location (longitude) 11.266667 investigation type mimarks-survey multiplex identifiers P20262_1225 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:924-12623 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197503 SAMEA10545504 408172 marine metagenome Reef4_Kims Top_US_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545504 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:925-12624 collection date 2020-08-13 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 20 geographic location (latitude) 56.982667 geographic location (longitude) 11.589667 investigation type mimarks-survey multiplex identifiers P20262_1226 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:925-12624 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197504 SAMEA10545505 408172 marine metagenome Reef4_Kims Top_US_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545505 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:925-12625 collection date 2020-08-13 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 20 geographic location (latitude) 56.982667 geographic location (longitude) 11.589667 investigation type mimarks-survey multiplex identifiers P20262_1227 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:925-12625 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197505 SAMEA10545506 408172 marine metagenome Reef4_Kims Top_Reef_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545506 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:925-12626 collection date 2020-08-13 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 14 geographic location (latitude) 57.012667 geographic location (longitude) 11.5905 investigation type mimarks-survey multiplex identifiers P20262_1228 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:925-12626 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197506 SAMEA10545507 408172 marine metagenome Reef4_Kims Top_Reef_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545507 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:925-12627 collection date 2020-08-13 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 14 geographic location (latitude) 57.012667 geographic location (longitude) 11.5905 investigation type mimarks-survey multiplex identifiers P20262_1229 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:925-12627 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197507 SAMEA10545508 408172 marine metagenome Reef4_Kims Top_DS_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545508 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:925-12628 collection date 2020-08-13 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 25 geographic location (latitude) 57.025167 geographic location (longitude) 11.595 investigation type mimarks-survey multiplex identifiers P20262_1230 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:925-12628 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197508 SAMEA10545509 408172 marine metagenome Reef4_Kims Top_DS_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545509 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:925-12629 collection date 2020-08-13 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 25 geographic location (latitude) 57.025167 geographic location (longitude) 11.595 investigation type mimarks-survey multiplex identifiers P20262_1231 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:925-12629 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197509 SAMEA10545510 408172 marine metagenome Reef5_Briseis Flak_US_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545510 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:925-12630 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 20 geographic location (latitude) 56.326333 geographic location (longitude) 11.233333 investigation type mimarks-survey multiplex identifiers P20262_1232 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:925-12630 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197510 SAMEA10545511 408172 marine metagenome Reef5_Briseis Flak_US_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545511 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:925-12631 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 20 geographic location (latitude) 56.326333 geographic location (longitude) 11.233333 investigation type mimarks-survey multiplex identifiers P20262_1233 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:925-12631 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197511 SAMEA10545512 408172 marine metagenome Reef5_Briseis Flak_Reef_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545512 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:925-12632 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 7 geographic location (latitude) 56.326333 geographic location (longitude) 11.326167 investigation type mimarks-survey multiplex identifiers P20262_1234 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:925-12632 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197512 SAMEA10545513 408172 marine metagenome Reef5_Briseis Flak_Reef_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545513 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:925-12633 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 7 geographic location (latitude) 56.326333 geographic location (longitude) 11.326167 investigation type mimarks-survey multiplex identifiers P20262_1235 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:925-12633 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197513 SAMEA10545514 408172 marine metagenome Reef5_Briseis Flak_DS_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545514 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:926-12634 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 19 geographic location (latitude) 56.3 geographic location (longitude) 11.333333 investigation type mimarks-survey multiplex identifiers P20262_1236 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:926-12634 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197514 SAMEA10545515 408172 marine metagenome Reef5_Briseis Flak_DS_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545515 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:926-12635 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 19 geographic location (latitude) 56.3 geographic location (longitude) 11.333333 investigation type mimarks-survey multiplex identifiers P20262_1237 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:926-12635 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197515 SAMEA10545516 408172 marine metagenome Reef6_Schultzs grund_US_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545516 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:926-12636 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 24 geographic location (latitude) 56.120667 geographic location (longitude) 11.1445 investigation type mimarks-survey multiplex identifiers P20262_1238 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:926-12636 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197516 SAMEA10545517 408172 marine metagenome Reef6_Schultzs grund_US_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545517 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:926-12637 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 24 geographic location (latitude) 56.120667 geographic location (longitude) 11.1445 investigation type mimarks-survey multiplex identifiers P20262_1239 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:926-12637 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197517 SAMEA10545518 408172 marine metagenome Reef6_Schultzs grund_Reef_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545518 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:926-12638 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 18 geographic location (latitude) 56.1255 geographic location (longitude) 11.131833 investigation type mimarks-survey multiplex identifiers P20262_1240 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:926-12638 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197518 SAMEA10545519 408172 marine metagenome Reef6_Schultzs grund_Reef_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545519 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:926-12639 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 18 geographic location (latitude) 56.1255 geographic location (longitude) 11.131833 investigation type mimarks-survey multiplex identifiers P20262_1241 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:926-12639 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197519 SAMEA10545520 408172 marine metagenome Reef6_Schultzs grund_DS_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545520 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:926-12640 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 25 geographic location (latitude) 56.142167 geographic location (longitude) 11.1635 investigation type mimarks-survey multiplex identifiers P20262_1242 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:926-12640 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197520 SAMEA10545521 408172 marine metagenome Reef6_Schultzs grund_DS_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545521 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:926-12641 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 25 geographic location (latitude) 56.142167 geographic location (longitude) 11.1635 investigation type mimarks-survey multiplex identifiers P20262_1243 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:926-12641 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197521 SAMEA10545522 408172 marine metagenome Reef7_Stalegrund Banke_US_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545522 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:926-12642 collection date 2020-08-17 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 10 geographic location (latitude) 54.984333 geographic location (longitude) 11.313167 investigation type mimarks-survey multiplex identifiers P20262_1244 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:926-12642 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197522 SAMEA10545523 408172 marine metagenome Reef7_Stalegrund Banke_US_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545523 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:927-12643 collection date 2020-08-17 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 10 geographic location (latitude) 54.984333 geographic location (longitude) 11.313167 investigation type mimarks-survey multiplex identifiers P20262_1245 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:927-12643 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197523 SAMEA10545524 408172 marine metagenome Reef7_Stalegrund Banke_Reef_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545524 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:927-12644 collection date 2020-08-17 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 8 geographic location (latitude) 54.985667 geographic location (longitude) 11.317333 investigation type mimarks-survey multiplex identifiers P20262_1246 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:927-12644 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197524 SAMEA10545525 408172 marine metagenome Reef7_Stalegrund Banke_Reef_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545525 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:30Z INSDC last update 2021-10-29T00:29:30Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:927-12645 collection date 2020-08-17 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 8 geographic location (latitude) 54.985667 geographic location (longitude) 11.317333 investigation type mimarks-survey multiplex identifiers P20262_1247 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:927-12645 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197525 SAMEA10545526 408172 marine metagenome Reef7_Stalegrund Banke_DS_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545526 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:927-12646 collection date 2020-08-17 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 12 geographic location (latitude) 54.9865 geographic location (longitude) 11.32 investigation type mimarks-survey multiplex identifiers P20262_1248 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:927-12646 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197526 SAMEA10545527 408172 marine metagenome Reef7_Stalegrund Banke_DS_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545527 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:927-12647 collection date 2020-08-17 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 12 geographic location (latitude) 54.9865 geographic location (longitude) 11.32 investigation type mimarks-survey multiplex identifiers P20262_1249 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:927-12647 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197527 SAMEA10545528 408172 marine metagenome Reef8_Kirkegrund_US_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545528 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:927-12648 collection date 2020-08-17 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 12 geographic location (latitude) 55.111167 geographic location (longitude) 11.389333 investigation type mimarks-survey multiplex identifiers P20262_1250 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:927-12648 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197528 SAMEA10545529 408172 marine metagenome Reef8_Kirkegrund_US_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545529 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:927-12649 collection date 2020-08-17 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 12 geographic location (latitude) 55.111167 geographic location (longitude) 11.389333 investigation type mimarks-survey multiplex identifiers P20262_1251 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:927-12649 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197529 SAMEA10545530 408172 marine metagenome Reef8_Kirkegrund_Reef_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545530 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:927-12650 collection date 2020-08-17 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 6 geographic location (latitude) 55.114 geographic location (longitude) 11.371 investigation type mimarks-survey multiplex identifiers P20262_1252 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:927-12650 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197530 SAMEA10545531 408172 marine metagenome Reef8_Kirkegrund_Reef_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545531 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:927-12651 collection date 2020-08-17 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 6 geographic location (latitude) 55.114 geographic location (longitude) 11.371 investigation type mimarks-survey multiplex identifiers P20262_1253 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:927-12651 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197531 SAMEA10545532 408172 marine metagenome Reef8_Kirkegrund_DS_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545532 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:927-12652 collection date 2020-08-17 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 12 geographic location (latitude) 55.120167 geographic location (longitude) 11.376 investigation type mimarks-survey multiplex identifiers P20262_1254 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:927-12652 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197532 SAMEA10545533 408172 marine metagenome Reef8_Kirkegrund_DS_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545533 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:928-12653 collection date 2020-08-17 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 12 geographic location (latitude) 55.120167 geographic location (longitude) 11.376 investigation type mimarks-survey multiplex identifiers P20262_1255 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:928-12653 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197533 SAMEA10545534 408172 marine metagenome Reef9_Mons Klint_US_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545534 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:928-12654 collection date 2020-08-18 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 12 geographic location (latitude) 54.937333 geographic location (longitude) 12.5455 investigation type mimarks-survey multiplex identifiers P20262_1256 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:928-12654 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197534 SAMEA10545535 408172 marine metagenome Reef9_Mons Klint_US_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545535 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:928-12655 collection date 2020-08-18 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 12 geographic location (latitude) 54.937333 geographic location (longitude) 12.5455 investigation type mimarks-survey multiplex identifiers P20262_1257 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:928-12655 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197535 SAMEA10545536 408172 marine metagenome Reef9_Mons Klint_Reef_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545536 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:928-12656 collection date 2020-08-18 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 5 geographic location (latitude) 54.957167 geographic location (longitude) 12.557667 investigation type mimarks-survey multiplex identifiers P20262_1258 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:928-12656 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197536 SAMEA10545537 408172 marine metagenome Reef9_Mons Klint_Reef_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545537 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:928-12657 collection date 2020-08-18 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 5 geographic location (latitude) 54.957167 geographic location (longitude) 12.557667 investigation type mimarks-survey multiplex identifiers P20262_1259 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:928-12657 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197537 SAMEA10545538 408172 marine metagenome Reef9_Mons Klint_DS_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545538 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:928-12658 collection date 2020-08-18 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 20 geographic location (latitude) 54.983 geographic location (longitude) 12.5825 investigation type mimarks-survey multiplex identifiers P20262_1260 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:928-12658 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197538 SAMEA10545539 408172 marine metagenome Reef9_Mons Klint_DS_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545539 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:928-12659 collection date 2020-08-18 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 20 geographic location (latitude) 54.983 geographic location (longitude) 12.5825 investigation type mimarks-survey multiplex identifiers P20262_1261 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:928-12659 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197539 SAMEA10545540 408172 marine metagenome PosCtrl_invertebrate mock_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545540 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:928-12660 collection date 2020-10-12 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 0 geographic location (latitude) 0 geographic location (longitude) 0 investigation type mimarks-survey multiplex identifiers P20262_1262 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:928-12660 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197540 SAMEA10545541 408172 marine metagenome PosCtrl_Fish mock_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545541 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:928-12661 collection date 2020-10-12 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 0 geographic location (latitude) 0 geographic location (longitude) 0 investigation type mimarks-survey multiplex identifiers P20262_1263 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:928-12661 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197541 SAMEA10545542 408172 marine metagenome NegCtrl_Herthas Flak_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545542 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:929-12662 collection date 2020-08-10 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 0 geographic location (latitude) 57.641333 geographic location (longitude) 10.8655 investigation type mimarks-survey multiplex identifiers P20262_1264 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:929-12662 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197542 SAMEA10545543 408172 marine metagenome NegCtrl_Per Nilen_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545543 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:929-12663 collection date 2020-08-11 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 0 geographic location (latitude) 57.379 geographic location (longitude) 11.043333 investigation type mimarks-survey multiplex identifiers P20262_1265 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:929-12663 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197543 SAMEA10545544 408172 marine metagenome NegCtrl_Kims Top_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545544 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:929-12664 collection date 2020-08-13 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 0 geographic location (latitude) 57.012667 geographic location (longitude) 11.5905 investigation type mimarks-survey multiplex identifiers P20262_1266 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:929-12664 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197544 SAMEA10545545 408172 marine metagenome NegCtrl_Briseis Flak_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545545 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:929-12665 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 0 geographic location (latitude) 56.326333 geographic location (longitude) 11.326167 investigation type mimarks-survey multiplex identifiers P20262_1267 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:929-12665 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197545 SAMEA10545546 408172 marine metagenome NegCtrl_Lab_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545546 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:929-12666 collection date 2020-10-12 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 0 geographic location (latitude) 0 geographic location (longitude) 0 investigation type mimarks-survey multiplex identifiers P20262_1268 pcr primers MiFish-F (GTCGGTAAAACTCGTGCCAGC) and MiFish-R (CATAGTGGGGTATCTAATCCCAGTTTG) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:929-12666 sequencing method Sequencing by synthesis (Illumina) target gene 12S rRNA water environmental package water ERS8197546 SAMEA10545547 408172 marine metagenome Reef1_Herthas Flak_US_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545547 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:929-12667 collection date 2020-08-10 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 26 geographic location (latitude) 57.658333 geographic location (longitude) 10.866667 investigation type mimarks-survey multiplex identifiers P20262_1269 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:929-12667 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197547 SAMEA10545548 408172 marine metagenome Reef1_Herthas Flak_US_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545548 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:929-12668 collection date 2020-08-10 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 26 geographic location (latitude) 57.658333 geographic location (longitude) 10.866667 investigation type mimarks-survey multiplex identifiers P20262_1270 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:929-12668 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197548 SAMEA10545549 408172 marine metagenome Reef1_Herthas Flak_Reef_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545549 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:929-12669 collection date 2020-08-10 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 15 geographic location (latitude) 57.641333 geographic location (longitude) 10.8655 investigation type mimarks-survey multiplex identifiers P20262_1271 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:929-12669 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197549 SAMEA10545550 408172 marine metagenome Reef1_Herthas Flak_Reef_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545550 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:929-12670 collection date 2020-08-10 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 15 geographic location (latitude) 57.641333 geographic location (longitude) 10.8655 investigation type mimarks-survey multiplex identifiers P20262_1272 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:929-12670 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197550 SAMEA10545551 408172 marine metagenome Reef1_Herthas Flak_DS_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545551 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:929-12671 collection date 2020-08-10 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 25 geographic location (latitude) 57.625 geographic location (longitude) 10.866667 investigation type mimarks-survey multiplex identifiers P20262_1273 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:929-12671 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197551 SAMEA10545552 408172 marine metagenome Reef1_Herthas Flak_DS_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545552 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:930-12672 collection date 2020-08-10 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 25 geographic location (latitude) 57.625 geographic location (longitude) 10.866667 investigation type mimarks-survey multiplex identifiers P20262_1274 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:930-12672 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197552 SAMEA10545553 408172 marine metagenome Reef2_Per Nilen_US_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545553 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:930-12673 collection date 2020-08-11 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 15 geographic location (latitude) 57.341667 geographic location (longitude) 11.13 investigation type mimarks-survey multiplex identifiers P20262_1275 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:930-12673 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197553 SAMEA10545554 408172 marine metagenome Reef2_Per Nilen_US_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545554 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:930-12674 collection date 2020-08-11 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 15 geographic location (latitude) 57.341667 geographic location (longitude) 11.13 investigation type mimarks-survey multiplex identifiers P20262_1276 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:930-12674 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197554 SAMEA10545555 408172 marine metagenome Reef2_Per Nilen_Reef_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545555 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:930-12675 collection date 2020-08-11 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 10 geographic location (latitude) 57.379 geographic location (longitude) 11.043333 investigation type mimarks-survey multiplex identifiers P20262_1277 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:930-12675 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197555 SAMEA10545556 408172 marine metagenome Reef2_Per Nilen_Reef_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545556 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:930-12676 collection date 2020-08-11 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 10 geographic location (latitude) 57.379 geographic location (longitude) 11.043333 investigation type mimarks-survey multiplex identifiers P20262_1278 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:930-12676 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197556 SAMEA10545557 408172 marine metagenome Reef2_Per Nilen_DS_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545557 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:930-12677 collection date 2020-08-11 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 7 geographic location (latitude) 57.386667 geographic location (longitude) 11.033333 investigation type mimarks-survey multiplex identifiers P20262_1279 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:930-12677 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197557 SAMEA10545558 408172 marine metagenome Reef2_Per Nilen_DS_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545558 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:930-12678 collection date 2020-08-11 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 7 geographic location (latitude) 57.386667 geographic location (longitude) 11.033333 investigation type mimarks-survey multiplex identifiers P20262_1280 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:930-12678 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197558 SAMEA10545559 408172 marine metagenome Reef3_Tonneberg Banke_US_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545559 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:930-12679 collection date 2020-08-12 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 27 geographic location (latitude) 57.408333 geographic location (longitude) 11.266667 investigation type mimarks-survey multiplex identifiers P20262_1281 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:930-12679 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197559 SAMEA10545560 408172 marine metagenome Reef3_Tonneberg Banke_US_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545560 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:930-12680 collection date 2020-08-12 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 27 geographic location (latitude) 57.408333 geographic location (longitude) 11.266667 investigation type mimarks-survey multiplex identifiers P20262_1282 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:930-12680 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197560 SAMEA10545561 408172 marine metagenome Reef3_Tonneberg Banke_Reef_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545561 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:931-12681 collection date 2020-08-12 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 12 geographic location (latitude) 57.4715 geographic location (longitude) 11.270833 investigation type mimarks-survey multiplex identifiers P20262_1283 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:931-12681 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197561 SAMEA10545562 408172 marine metagenome Reef3_Tonneberg Banke_Reef_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545562 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:931-12682 collection date 2020-08-12 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 12 geographic location (latitude) 57.4715 geographic location (longitude) 11.270833 investigation type mimarks-survey multiplex identifiers P20262_1284 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:931-12682 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197562 SAMEA10545563 408172 marine metagenome Reef3_Tonneberg Banke_DS_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545563 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:931-12683 collection date 2020-08-12 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 17 geographic location (latitude) 57.491667 geographic location (longitude) 11.266667 investigation type mimarks-survey multiplex identifiers P20262_1285 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:931-12683 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197563 SAMEA10545564 408172 marine metagenome Reef3_Tonneberg Banke_DS_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545564 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:931-12684 collection date 2020-08-12 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 17 geographic location (latitude) 57.491667 geographic location (longitude) 11.266667 investigation type mimarks-survey multiplex identifiers P20262_1286 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:931-12684 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197564 SAMEA10545565 408172 marine metagenome Reef4_Kims Top_US_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545565 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:931-12685 collection date 2020-08-13 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 20 geographic location (latitude) 56.982667 geographic location (longitude) 11.589667 investigation type mimarks-survey multiplex identifiers P20262_1287 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:931-12685 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197565 SAMEA10545566 408172 marine metagenome Reef4_Kims Top_US_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545566 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:931-12686 collection date 2020-08-13 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 20 geographic location (latitude) 56.982667 geographic location (longitude) 11.589667 investigation type mimarks-survey multiplex identifiers P20262_1288 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:931-12686 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197566 SAMEA10545567 408172 marine metagenome Reef4_Kims Top_Reef_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545567 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:931-12687 collection date 2020-08-13 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 14 geographic location (latitude) 57.012667 geographic location (longitude) 11.5905 investigation type mimarks-survey multiplex identifiers P20262_1289 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:931-12687 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197567 SAMEA10545568 408172 marine metagenome Reef4_Kims Top_Reef_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545568 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:931-12688 collection date 2020-08-13 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 14 geographic location (latitude) 57.012667 geographic location (longitude) 11.5905 investigation type mimarks-survey multiplex identifiers P20262_1290 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:931-12688 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197568 SAMEA10545569 408172 marine metagenome Reef4_Kims Top_DS_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545569 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:931-12689 collection date 2020-08-13 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 25 geographic location (latitude) 57.025167 geographic location (longitude) 11.595 investigation type mimarks-survey multiplex identifiers P20262_1291 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:931-12689 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197569 SAMEA10545570 408172 marine metagenome Reef4_Kims Top_DS_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545570 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:931-12690 collection date 2020-08-13 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 25 geographic location (latitude) 57.025167 geographic location (longitude) 11.595 investigation type mimarks-survey multiplex identifiers P20262_1292 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:931-12690 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197570 SAMEA10545571 408172 marine metagenome Reef5_Briseis Flak_US_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545571 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:932-12691 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 20 geographic location (latitude) 56.326333 geographic location (longitude) 11.233333 investigation type mimarks-survey multiplex identifiers P20262_1293 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:932-12691 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197571 SAMEA10545572 408172 marine metagenome Reef5_Briseis Flak_US_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545572 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:932-12692 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 20 geographic location (latitude) 56.326333 geographic location (longitude) 11.233333 investigation type mimarks-survey multiplex identifiers P20262_1294 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:932-12692 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197572 SAMEA10545573 408172 marine metagenome Reef5_Briseis Flak_Reef_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545573 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:932-12693 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 7 geographic location (latitude) 56.326333 geographic location (longitude) 11.326167 investigation type mimarks-survey multiplex identifiers P20262_1295 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:932-12693 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197573 SAMEA10545574 408172 marine metagenome Reef5_Briseis Flak_Reef_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545574 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:932-12694 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 7 geographic location (latitude) 56.326333 geographic location (longitude) 11.326167 investigation type mimarks-survey multiplex identifiers P20262_1296 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:932-12694 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197574 SAMEA10545575 408172 marine metagenome Reef5_Briseis Flak_DS_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545575 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:932-12695 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 19 geographic location (latitude) 56.3 geographic location (longitude) 11.333333 investigation type mimarks-survey multiplex identifiers P20262_1297 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:932-12695 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197575 SAMEA10545576 408172 marine metagenome Reef5_Briseis Flak_DS_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545576 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:932-12696 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 19 geographic location (latitude) 56.3 geographic location (longitude) 11.333333 investigation type mimarks-survey multiplex identifiers P20262_1298 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:932-12696 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197576 SAMEA10545577 408172 marine metagenome Reef6_Schultzs grund_US_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545577 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:932-12697 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 24 geographic location (latitude) 56.120667 geographic location (longitude) 11.1445 investigation type mimarks-survey multiplex identifiers P20262_1299 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:932-12697 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197577 SAMEA10545578 408172 marine metagenome Reef6_Schultzs grund_US_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545578 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:932-12698 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 24 geographic location (latitude) 56.120667 geographic location (longitude) 11.1445 investigation type mimarks-survey multiplex identifiers P20262_1300 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:932-12698 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197578 SAMEA10545579 408172 marine metagenome Reef6_Schultzs grund_Reef_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545579 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:932-12699 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 18 geographic location (latitude) 56.1255 geographic location (longitude) 11.131833 investigation type mimarks-survey multiplex identifiers P20262_1301 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:932-12699 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197579 SAMEA10545580 408172 marine metagenome Reef6_Schultzs grund_Reef_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545580 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:933-12700 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 18 geographic location (latitude) 56.1255 geographic location (longitude) 11.131833 investigation type mimarks-survey multiplex identifiers P20262_1302 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:933-12700 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197580 SAMEA10545581 408172 marine metagenome Reef6_Schultzs grund_DS_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545581 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:933-12701 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 25 geographic location (latitude) 56.142167 geographic location (longitude) 11.1635 investigation type mimarks-survey multiplex identifiers P20262_1303 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:933-12701 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197581 SAMEA10545582 408172 marine metagenome Reef6_Schultzs grund_DS_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545582 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:933-12702 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 25 geographic location (latitude) 56.142167 geographic location (longitude) 11.1635 investigation type mimarks-survey multiplex identifiers P20262_1304 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:933-12702 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197582 SAMEA10545583 408172 marine metagenome Reef7_Stalegrund Banke_US_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545583 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:933-12703 collection date 2020-08-17 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 10 geographic location (latitude) 54.984333 geographic location (longitude) 11.313167 investigation type mimarks-survey multiplex identifiers P20262_1305 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:933-12703 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197583 SAMEA10545584 408172 marine metagenome Reef7_Stalegrund Banke_US_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545584 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:933-12704 collection date 2020-08-17 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 10 geographic location (latitude) 54.984333 geographic location (longitude) 11.313167 investigation type mimarks-survey multiplex identifiers P20262_1306 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:933-12704 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197584 SAMEA10545585 408172 marine metagenome Reef7_Stalegrund Banke_Reef_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545585 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:933-12705 collection date 2020-08-17 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 8 geographic location (latitude) 54.985667 geographic location (longitude) 11.317333 investigation type mimarks-survey multiplex identifiers P20262_1307 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:933-12705 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197585 SAMEA10545586 408172 marine metagenome Reef7_Stalegrund Banke_Reef_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545586 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:933-12706 collection date 2020-08-17 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 8 geographic location (latitude) 54.985667 geographic location (longitude) 11.317333 investigation type mimarks-survey multiplex identifiers P20262_1308 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:933-12706 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197586 SAMEA10545587 408172 marine metagenome Reef7_Stalegrund Banke_DS_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545587 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:933-12707 collection date 2020-08-17 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 12 geographic location (latitude) 54.9865 geographic location (longitude) 11.32 investigation type mimarks-survey multiplex identifiers P20262_1309 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:933-12707 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197587 SAMEA10545588 408172 marine metagenome Reef7_Stalegrund Banke_DS_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545588 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:933-12708 collection date 2020-08-17 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 12 geographic location (latitude) 54.9865 geographic location (longitude) 11.32 investigation type mimarks-survey multiplex identifiers P20262_1310 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:933-12708 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197588 SAMEA10545589 408172 marine metagenome Reef8_Kirkegrund_US_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545589 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:934-12709 collection date 2020-08-17 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 12 geographic location (latitude) 55.111167 geographic location (longitude) 11.389333 investigation type mimarks-survey multiplex identifiers P20262_1311 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:934-12709 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197589 SAMEA10545590 408172 marine metagenome Reef8_Kirkegrund_US_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545590 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:934-12710 collection date 2020-08-17 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 12 geographic location (latitude) 55.111167 geographic location (longitude) 11.389333 investigation type mimarks-survey multiplex identifiers P20262_1312 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:934-12710 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197590 SAMEA10545591 408172 marine metagenome Reef8_Kirkegrund_Reef_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545591 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:934-12711 collection date 2020-08-17 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 6 geographic location (latitude) 55.114 geographic location (longitude) 11.371 investigation type mimarks-survey multiplex identifiers P20262_1313 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:934-12711 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197591 SAMEA10545592 408172 marine metagenome Reef8_Kirkegrund_Reef_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545592 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:934-12712 collection date 2020-08-17 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 6 geographic location (latitude) 55.114 geographic location (longitude) 11.371 investigation type mimarks-survey multiplex identifiers P20262_1314 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:934-12712 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197592 SAMEA10545593 408172 marine metagenome Reef8_Kirkegrund_DS_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545593 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:934-12713 collection date 2020-08-17 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 12 geographic location (latitude) 55.120167 geographic location (longitude) 11.376 investigation type mimarks-survey multiplex identifiers P20262_1315 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:934-12713 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197593 SAMEA10545594 408172 marine metagenome Reef8_Kirkegrund_DS_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545594 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:934-12714 collection date 2020-08-17 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 12 geographic location (latitude) 55.120167 geographic location (longitude) 11.376 investigation type mimarks-survey multiplex identifiers P20262_1316 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:934-12714 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197594 SAMEA10545595 408172 marine metagenome Reef9_Mons Klint_US_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545595 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:934-12715 collection date 2020-08-18 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 12 geographic location (latitude) 54.937333 geographic location (longitude) 12.5455 investigation type mimarks-survey multiplex identifiers P20262_1317 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:934-12715 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197595 SAMEA10545596 408172 marine metagenome Reef9_Mons Klint_US_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545596 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:934-12716 collection date 2020-08-18 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 12 geographic location (latitude) 54.937333 geographic location (longitude) 12.5455 investigation type mimarks-survey multiplex identifiers P20262_1318 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:934-12716 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197596 SAMEA10545597 408172 marine metagenome Reef9_Mons Klint_Reef_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545597 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:934-12717 collection date 2020-08-18 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 5 geographic location (latitude) 54.957167 geographic location (longitude) 12.557667 investigation type mimarks-survey multiplex identifiers P20262_1319 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:934-12717 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197597 SAMEA10545598 408172 marine metagenome Reef9_Mons Klint_Reef_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545598 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:935-12718 collection date 2020-08-18 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 5 geographic location (latitude) 54.957167 geographic location (longitude) 12.557667 investigation type mimarks-survey multiplex identifiers P20262_1320 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:935-12718 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197598 SAMEA10545599 408172 marine metagenome Reef9_Mons Klint_DS_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545599 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:935-12719 collection date 2020-08-18 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 20 geographic location (latitude) 54.983 geographic location (longitude) 12.5825 investigation type mimarks-survey multiplex identifiers P20262_1321 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:935-12719 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197599 SAMEA10545600 408172 marine metagenome Reef9_Mons Klint_DS_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545600 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:935-12720 collection date 2020-08-18 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 20 geographic location (latitude) 54.983 geographic location (longitude) 12.5825 investigation type mimarks-survey multiplex identifiers P20262_1322 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:935-12720 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197600 SAMEA10545601 408172 marine metagenome PosCtrl_invertebrate mock_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545601 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:937-12721 collection date 2020-10-12 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 0 geographic location (latitude) 0 geographic location (longitude) 0 investigation type mimarks-survey multiplex identifiers P20262_1323 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:937-12721 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197601 SAMEA10545602 408172 marine metagenome PosCtrl_fish mock_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545602 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:937-12722 collection date 2020-10-12 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 0 geographic location (latitude) 0 geographic location (longitude) 0 investigation type mimarks-survey multiplex identifiers P20262_1324 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:937-12722 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197602 SAMEA10545603 408172 marine metagenome NegCtrl_Herthas Flak_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545603 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:938-12723 collection date 2020-08-10 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 0 geographic location (latitude) 57.641333 geographic location (longitude) 10.8655 investigation type mimarks-survey multiplex identifiers P20262_1325 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:938-12723 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197603 SAMEA10545604 408172 marine metagenome NegCtrl_Per Nilen_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545604 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:938-12724 collection date 2020-08-11 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 0 geographic location (latitude) 57.379 geographic location (longitude) 11.043333 investigation type mimarks-survey multiplex identifiers P20262_1326 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:938-12724 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197604 SAMEA10545605 408172 marine metagenome NegCtrl_Kims Top_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545605 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:938-12725 collection date 2020-08-13 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 0 geographic location (latitude) 57.012667 geographic location (longitude) 11.5905 investigation type mimarks-survey multiplex identifiers P20262_1327 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:938-12725 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197605 SAMEA10545606 408172 marine metagenome NegCtrl_Briseis Flak_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545606 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:938-12726 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 0 geographic location (latitude) 56.326333 geographic location (longitude) 11.326167 investigation type mimarks-survey multiplex identifiers P20262_1328 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:938-12726 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197606 SAMEA10545607 408172 marine metagenome NegCtrl_Lab_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545607 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:938-12727 collection date 2020-10-12 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 0 geographic location (latitude) 0 geographic location (longitude) 0 investigation type mimarks-survey multiplex identifiers P20262_1329 pcr primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R22 (GCCTGCTGCCTTCCTTGGA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:938-12727 sequencing method Sequencing by synthesis (Illumina) target gene 18S rRNA water environmental package water ERS8197607 SAMEA10545608 408172 marine metagenome Reef1_Herthas Flak_US_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545608 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:938-12728 collection date 2020-08-10 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 26 geographic location (latitude) 57.658333 geographic location (longitude) 10.866667 investigation type mimarks-survey multiplex identifiers P20262_1330 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:938-12728 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197608 SAMEA10545609 408172 marine metagenome Reef1_Herthas Flak_US_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545609 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:938-12729 collection date 2020-08-10 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 26 geographic location (latitude) 57.658333 geographic location (longitude) 10.866667 investigation type mimarks-survey multiplex identifiers P20262_1331 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:938-12729 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197609 SAMEA10545610 408172 marine metagenome Reef1_Herthas Flak_Reef_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545610 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:938-12730 collection date 2020-08-10 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 15 geographic location (latitude) 57.641333 geographic location (longitude) 10.8655 investigation type mimarks-survey multiplex identifiers P20262_1332 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:938-12730 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197610 SAMEA10545611 408172 marine metagenome Reef1_Herthas Flak_Reef_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545611 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:938-12731 collection date 2020-08-10 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 15 geographic location (latitude) 57.641333 geographic location (longitude) 10.8655 investigation type mimarks-survey multiplex identifiers P20262_1333 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:938-12731 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197611 SAMEA10545612 408172 marine metagenome Reef1_Herthas Flak_DS_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545612 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:939-12732 collection date 2020-08-10 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 25 geographic location (latitude) 57.625 geographic location (longitude) 10.866667 investigation type mimarks-survey multiplex identifiers P20262_1334 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:939-12732 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197612 SAMEA10545613 408172 marine metagenome Reef1_Herthas Flak_DS_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545613 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:939-12733 collection date 2020-08-10 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 25 geographic location (latitude) 57.625 geographic location (longitude) 10.866667 investigation type mimarks-survey multiplex identifiers P20262_1335 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:939-12733 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197613 SAMEA10545614 408172 marine metagenome Reef2_Per Nilen_US_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545614 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:939-12734 collection date 2020-08-11 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 15 geographic location (latitude) 57.341667 geographic location (longitude) 11.13 investigation type mimarks-survey multiplex identifiers P20262_1336 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:939-12734 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197614 SAMEA10545615 408172 marine metagenome Reef2_Per Nilen_US_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545615 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:939-12735 collection date 2020-08-11 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 15 geographic location (latitude) 57.341667 geographic location (longitude) 11.13 investigation type mimarks-survey multiplex identifiers P20262_1337 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:939-12735 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197615 SAMEA10545616 408172 marine metagenome Reef2_Per Nilen_Reef_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545616 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:939-12736 collection date 2020-08-11 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 10 geographic location (latitude) 57.379 geographic location (longitude) 11.043333 investigation type mimarks-survey multiplex identifiers P20262_1338 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:939-12736 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197616 SAMEA10545617 408172 marine metagenome Reef2_Per Nilen_Reef_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545617 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:939-12737 collection date 2020-08-11 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 10 geographic location (latitude) 57.379 geographic location (longitude) 11.043333 investigation type mimarks-survey multiplex identifiers P20262_1339 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:939-12737 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197617 SAMEA10545618 408172 marine metagenome Reef2_Per Nilen_DS_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545618 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:939-12738 collection date 2020-08-11 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 7 geographic location (latitude) 57.386667 geographic location (longitude) 11.033333 investigation type mimarks-survey multiplex identifiers P20262_1340 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:939-12738 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197618 SAMEA10545619 408172 marine metagenome Reef2_Per Nilen_DS_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545619 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:939-12739 collection date 2020-08-11 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 7 geographic location (latitude) 57.386667 geographic location (longitude) 11.033333 investigation type mimarks-survey multiplex identifiers P20262_1341 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:939-12739 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197619 SAMEA10545620 408172 marine metagenome Reef3_Tonneberg Banke_US_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545620 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:939-12740 collection date 2020-08-12 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 27 geographic location (latitude) 57.408333 geographic location (longitude) 11.266667 investigation type mimarks-survey multiplex identifiers P20262_1342 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:939-12740 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197620 SAMEA10545621 408172 marine metagenome Reef3_Tonneberg Banke_US_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545621 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:939-12741 collection date 2020-08-12 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 27 geographic location (latitude) 57.408333 geographic location (longitude) 11.266667 investigation type mimarks-survey multiplex identifiers P20262_1343 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:939-12741 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197621 SAMEA10545622 408172 marine metagenome Reef3_Tonneberg Banke_Reef_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545622 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:940-12742 collection date 2020-08-12 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 12 geographic location (latitude) 57.4715 geographic location (longitude) 11.270833 investigation type mimarks-survey multiplex identifiers P20262_1344 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:940-12742 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197622 SAMEA10545623 408172 marine metagenome Reef3_Tonneberg Banke_Reef_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545623 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:940-12743 collection date 2020-08-12 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 12 geographic location (latitude) 57.4715 geographic location (longitude) 11.270833 investigation type mimarks-survey multiplex identifiers P20262_1345 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:940-12743 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197623 SAMEA10545624 408172 marine metagenome Reef3_Tonneberg Banke_DS_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545624 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:940-12744 collection date 2020-08-12 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 17 geographic location (latitude) 57.491667 geographic location (longitude) 11.266667 investigation type mimarks-survey multiplex identifiers P20262_1346 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:940-12744 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197624 SAMEA10545625 408172 marine metagenome Reef3_Tonneberg Banke_DS_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545625 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:940-12745 collection date 2020-08-12 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 17 geographic location (latitude) 57.491667 geographic location (longitude) 11.266667 investigation type mimarks-survey multiplex identifiers P20262_1347 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:940-12745 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197625 SAMEA10545626 408172 marine metagenome Reef4_Kims Top_US_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545626 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:940-12746 collection date 2020-08-13 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 20 geographic location (latitude) 56.982667 geographic location (longitude) 11.589667 investigation type mimarks-survey multiplex identifiers P20262_1348 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:940-12746 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197626 SAMEA10545627 408172 marine metagenome Reef4_Kims Top_US_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545627 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:940-12747 collection date 2020-08-13 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 20 geographic location (latitude) 56.982667 geographic location (longitude) 11.589667 investigation type mimarks-survey multiplex identifiers P20262_1349 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:940-12747 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197627 SAMEA10545628 408172 marine metagenome Reef4_Kims Top_Reef_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545628 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:940-12748 collection date 2020-08-13 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 14 geographic location (latitude) 57.012667 geographic location (longitude) 11.5905 investigation type mimarks-survey multiplex identifiers P20262_1350 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:940-12748 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197628 SAMEA10545629 408172 marine metagenome Reef4_Kims Top_Reef_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545629 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:940-12749 collection date 2020-08-13 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 14 geographic location (latitude) 57.012667 geographic location (longitude) 11.5905 investigation type mimarks-survey multiplex identifiers P20262_1351 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:940-12749 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197629 SAMEA10545630 408172 marine metagenome Reef4_Kims Top_DS_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545630 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:940-12750 collection date 2020-08-13 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 25 geographic location (latitude) 57.025167 geographic location (longitude) 11.595 investigation type mimarks-survey multiplex identifiers P20262_1352 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:940-12750 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197630 SAMEA10545631 408172 marine metagenome Reef4_Kims Top_DS_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545631 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:941-12751 collection date 2020-08-13 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 25 geographic location (latitude) 57.025167 geographic location (longitude) 11.595 investigation type mimarks-survey multiplex identifiers P20262_1353 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:941-12751 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197631 SAMEA10545632 408172 marine metagenome Reef5_Briseis Flak_US_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545632 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:941-12752 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 20 geographic location (latitude) 56.326333 geographic location (longitude) 11.233333 investigation type mimarks-survey multiplex identifiers P20262_1354 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:941-12752 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197632 SAMEA10545633 408172 marine metagenome Reef5_Briseis Flak_US_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545633 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:941-12753 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 20 geographic location (latitude) 56.326333 geographic location (longitude) 11.233333 investigation type mimarks-survey multiplex identifiers P20262_1355 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:941-12753 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197633 SAMEA10545634 408172 marine metagenome Reef5_Briseis Flak_Reef_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545634 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:941-12754 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 7 geographic location (latitude) 56.326333 geographic location (longitude) 11.326167 investigation type mimarks-survey multiplex identifiers P20262_1356 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:941-12754 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197634 SAMEA10545635 408172 marine metagenome Reef5_Briseis Flak_Reef_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545635 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:941-12755 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 7 geographic location (latitude) 56.326333 geographic location (longitude) 11.326167 investigation type mimarks-survey multiplex identifiers P20262_1357 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:941-12755 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197635 SAMEA10545636 408172 marine metagenome Reef5_Briseis Flak_DS_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545636 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:941-12756 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 19 geographic location (latitude) 56.3 geographic location (longitude) 11.333333 investigation type mimarks-survey multiplex identifiers P20262_1358 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:941-12756 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197636 SAMEA10545637 408172 marine metagenome Reef5_Briseis Flak_DS_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545637 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:941-12757 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 19 geographic location (latitude) 56.3 geographic location (longitude) 11.333333 investigation type mimarks-survey multiplex identifiers P20262_1359 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:941-12757 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197637 SAMEA10545638 408172 marine metagenome Reef6_Schultzs grund_US_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545638 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:941-12758 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 24 geographic location (latitude) 56.120667 geographic location (longitude) 11.1445 investigation type mimarks-survey multiplex identifiers P20262_1360 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:941-12758 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197638 SAMEA10545639 408172 marine metagenome Reef6_Schultzs grund_US_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545639 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:941-12759 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 24 geographic location (latitude) 56.120667 geographic location (longitude) 11.1445 investigation type mimarks-survey multiplex identifiers P20262_1361 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:941-12759 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197639 SAMEA10545640 408172 marine metagenome Reef6_Schultzs grund_Reef_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545640 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:941-12760 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 18 geographic location (latitude) 56.1255 geographic location (longitude) 11.131833 investigation type mimarks-survey multiplex identifiers P20262_1362 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:941-12760 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197640 SAMEA10545641 408172 marine metagenome Reef6_Schultzs grund_Reef_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545641 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:942-12761 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 18 geographic location (latitude) 56.1255 geographic location (longitude) 11.131833 investigation type mimarks-survey multiplex identifiers P20262_1363 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:942-12761 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197641 SAMEA10545642 408172 marine metagenome Reef6_Schultzs grund_DS_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545642 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:942-12762 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 25 geographic location (latitude) 56.142167 geographic location (longitude) 11.1635 investigation type mimarks-survey multiplex identifiers P20262_1364 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:942-12762 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197642 SAMEA10545643 408172 marine metagenome Reef6_Schultzs grund_DS_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545643 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:942-12763 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 25 geographic location (latitude) 56.142167 geographic location (longitude) 11.1635 investigation type mimarks-survey multiplex identifiers P20262_1365 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:942-12763 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197643 SAMEA10545644 408172 marine metagenome Reef7_Stalegrund Banke_US_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545644 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:942-12764 collection date 2020-08-17 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 10 geographic location (latitude) 54.984333 geographic location (longitude) 11.313167 investigation type mimarks-survey multiplex identifiers P20262_1366 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:942-12764 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197644 SAMEA10545645 408172 marine metagenome Reef7_Stalegrund Banke_US_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545645 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:942-12765 collection date 2020-08-17 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 10 geographic location (latitude) 54.984333 geographic location (longitude) 11.313167 investigation type mimarks-survey multiplex identifiers P20262_1367 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:942-12765 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197645 SAMEA10545646 408172 marine metagenome Reef7_Stalegrund Banke_Reef_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545646 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:942-12766 collection date 2020-08-17 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 8 geographic location (latitude) 54.985667 geographic location (longitude) 11.317333 investigation type mimarks-survey multiplex identifiers P20262_1368 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:942-12766 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197646 SAMEA10545647 408172 marine metagenome Reef7_Stalegrund Banke_Reef_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545647 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:942-12767 collection date 2020-08-17 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 8 geographic location (latitude) 54.985667 geographic location (longitude) 11.317333 investigation type mimarks-survey multiplex identifiers P20262_1369 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:942-12767 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197647 SAMEA10545648 408172 marine metagenome Reef7_Stalegrund Banke_DS_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545648 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:942-12768 collection date 2020-08-17 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 12 geographic location (latitude) 54.9865 geographic location (longitude) 11.32 investigation type mimarks-survey multiplex identifiers P20262_1370 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:942-12768 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197648 SAMEA10545649 408172 marine metagenome Reef7_Stalegrund Banke_DS_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545649 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:942-12769 collection date 2020-08-17 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 12 geographic location (latitude) 54.9865 geographic location (longitude) 11.32 investigation type mimarks-survey multiplex identifiers P20262_1371 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:942-12769 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197649 SAMEA10545650 408172 marine metagenome Reef8_Kirkegrund_US_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545650 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:943-12770 collection date 2020-08-17 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 12 geographic location (latitude) 55.111167 geographic location (longitude) 11.389333 investigation type mimarks-survey multiplex identifiers P20262_1372 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:943-12770 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197650 SAMEA10545651 408172 marine metagenome Reef8_Kirkegrund_US_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545651 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:943-12771 collection date 2020-08-17 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 12 geographic location (latitude) 55.111167 geographic location (longitude) 11.389333 investigation type mimarks-survey multiplex identifiers P20262_1373 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:943-12771 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197651 SAMEA10545652 408172 marine metagenome Reef8_Kirkegrund_Reef_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545652 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:943-12772 collection date 2020-08-17 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 6 geographic location (latitude) 55.114 geographic location (longitude) 11.371 investigation type mimarks-survey multiplex identifiers P20262_1374 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:943-12772 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197652 SAMEA10545653 408172 marine metagenome Reef8_Kirkegrund_Reef_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545653 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:943-12773 collection date 2020-08-17 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 6 geographic location (latitude) 55.114 geographic location (longitude) 11.371 investigation type mimarks-survey multiplex identifiers P20262_1375 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:943-12773 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197653 SAMEA10545654 408172 marine metagenome Reef8_Kirkegrund_DS_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545654 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:943-12774 collection date 2020-08-17 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 12 geographic location (latitude) 55.120167 geographic location (longitude) 11.376 investigation type mimarks-survey multiplex identifiers P20262_1376 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:943-12774 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197654 SAMEA10545655 408172 marine metagenome Reef8_Kirkegrund_DS_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545655 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:943-12775 collection date 2020-08-17 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 12 geographic location (latitude) 55.120167 geographic location (longitude) 11.376 investigation type mimarks-survey multiplex identifiers P20262_1377 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:943-12775 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197657 SAMEA10545658 408172 marine metagenome Reef9_Mons Klint_Reef_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545658 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:943-12778 collection date 2020-08-18 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 5 geographic location (latitude) 54.957167 geographic location (longitude) 12.557667 investigation type mimarks-survey multiplex identifiers P20262_1380 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:943-12778 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197658 SAMEA10545659 408172 marine metagenome Reef9_Mons Klint_Reef_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545659 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:943-12779 collection date 2020-08-18 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 5 geographic location (latitude) 54.957167 geographic location (longitude) 12.557667 investigation type mimarks-survey multiplex identifiers P20262_1381 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:943-12779 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197659 SAMEA10545660 408172 marine metagenome Reef9_Mons Klint_DS_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545660 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:944-12780 collection date 2020-08-18 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 20 geographic location (latitude) 54.983 geographic location (longitude) 12.5825 investigation type mimarks-survey multiplex identifiers P20262_1382 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:944-12780 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197660 SAMEA10545661 408172 marine metagenome Reef9_Mons Klint_DS_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545661 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:944-12781 collection date 2020-08-18 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 20 geographic location (latitude) 54.983 geographic location (longitude) 12.5825 investigation type mimarks-survey multiplex identifiers P20262_1383 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:944-12781 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197661 SAMEA10545662 408172 marine metagenome PosCtrl_invertebrate mock_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545662 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:944-12782 collection date 2020-10-12 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 0 geographic location (latitude) 0 geographic location (longitude) 0 investigation type mimarks-survey multiplex identifiers P20262_1384 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:944-12782 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197662 SAMEA10545663 408172 marine metagenome PosCtrl_fish mock_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545663 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:944-12783 collection date 2020-10-12 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 0 geographic location (latitude) 0 geographic location (longitude) 0 investigation type mimarks-survey multiplex identifiers P20262_1385 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:944-12783 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197663 SAMEA10545664 408172 marine metagenome NegCtrl_Herthas Flak_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545664 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:944-12784 collection date 2020-08-10 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 0 geographic location (latitude) 57.641333 geographic location (longitude) 10.8655 investigation type mimarks-survey multiplex identifiers P20262_1386 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:944-12784 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197664 SAMEA10545665 408172 marine metagenome NegCtrl_Per Nilen_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545665 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:944-12785 collection date 2020-08-11 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 0 geographic location (latitude) 57.379 geographic location (longitude) 11.043333 investigation type mimarks-survey multiplex identifiers P20262_1387 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:944-12785 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197665 SAMEA10545666 408172 marine metagenome NegCtrl_Kims Top_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545666 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:944-12786 collection date 2020-08-13 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 0 geographic location (latitude) 57.012667 geographic location (longitude) 11.5905 investigation type mimarks-survey multiplex identifiers P20262_1388 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:944-12786 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197666 SAMEA10545667 408172 marine metagenome NegCtrl_Briseis Flak_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545667 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:944-12787 collection date 2020-08-15 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 0 geographic location (latitude) 56.326333 geographic location (longitude) 11.326167 investigation type mimarks-survey multiplex identifiers P20262_1389 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:944-12787 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197667 SAMEA10545668 408172 marine metagenome NegCtrl_Lab_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545668 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:944-12788 collection date 2020-10-12 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 0 geographic location (latitude) 0 geographic location (longitude) 0 investigation type mimarks-survey multiplex identifiers P20262_1390 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:944-12788 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197655 SAMEA10545656 408172 marine metagenome Reef9_Mons Klint_US_A ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545656 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:943-12776 collection date 2020-08-18 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 12 geographic location (latitude) 54.937333 geographic location (longitude) 12.5455 investigation type mimarks-survey multiplex identifiers P20262_1378 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:943-12776 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water ERS8197656 SAMEA10545657 408172 marine metagenome Reef9_Mons Klint_US_B ENA first public 2021-10-29 ENA last update 2021-10-29 External Id SAMEA10545657 INSDC center alias UNIVERSITY OF GOTHENBURG INSDC center name UNIVERSITY OF GOTHENBURG INSDC first public 2021-10-29T00:29:29Z INSDC last update 2021-10-29T00:29:29Z INSDC status public Submitter Id ena-SAMPLE-TAB-28-10-2021-16:40:16:943-12777 collection date 2020-08-18 environment (biome) marine water body (ENVO:00001999) environment (feature) marine sub-littoral zone (ENVO:01000126) environment (material) sea water (ENVO:00002149) geographic location (country and/or sea) Denmark geographic location (depth) 12 geographic location (latitude) 54.937333 geographic location (longitude) 12.5455 investigation type mimarks-survey multiplex identifiers P20262_1379 pcr primers mICOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and dgHCO2198 (TAAACTTCAGGGTGACCAAARAAYCA) project name Environmental DNA monitoring of biodiversity hot-spots in Danish marine waters sample name ena-SAMPLE-TAB-28-10-2021-16:40:16:943-12777 sequencing method Sequencing by synthesis (Illumina) target gene Cytochrome c oxidase I (CO1) water environmental package water