ERX1828173 E-MTAB-5350:A549_dex_4C-seq_Rep1_p ERP020626 Circularized chromosome conformation capture (4C-seq) in A549 and U2OS cells stably expressing rat GRα ERS1478319 SAMEA30153418 A549_dex_4C-seq_Rep1_p OTHER GENOMIC PCR Cells were cultured to confluency and treated for 90 min with 1μM dexamethasone. 4C experiments were performed as previously described (van de Werken et al., Methods Enzymol, 2012. 513: p. 89-112.), using 5x10^6 cells. 4-bp cutters were used as primary (CviQI, Thermo Fisher Scientific) and secondary (DpnII, Thermo Fisher Scientific) restriction enzymes. For each cell line 4C libraries were generated in two biological replicates. Based on 4C-libraries we amplified a total of 1.2 μg of DNA by inverse-PCR using viewpoint-specific primers (fwd: CTACACGACGCTCTTCCGATCTAATGTTCAGGTGTGGGAGTAC, rev: CAGACGTGTGCTCTTCCGATCTGCCCTCTGCCTCTTGTTAGG), which include adaptors for subsequent high throughput sequencing (Illumina HiSeq2500). 250 0 F Application Read Forward 1 1 R Application Read Reverse 126 NextSeq 500 Experimental Factor: A549 cell line ERX1828174 E-MTAB-5350:A549_dex_4C-seq_Rep2_p ERP020626 Circularized chromosome conformation capture (4C-seq) in A549 and U2OS cells stably expressing rat GRα ERS1478320 SAMEA30154168 A549_dex_4C-seq_Rep2_p OTHER GENOMIC PCR Cells were cultured to confluency and treated for 90 min with 1μM dexamethasone. 4C experiments were performed as previously described (van de Werken et al., Methods Enzymol, 2012. 513: p. 89-112.), using 5x10^6 cells. 4-bp cutters were used as primary (CviQI, Thermo Fisher Scientific) and secondary (DpnII, Thermo Fisher Scientific) restriction enzymes. For each cell line 4C libraries were generated in two biological replicates. Based on 4C-libraries we amplified a total of 1.2 μg of DNA by inverse-PCR using viewpoint-specific primers (fwd: CTACACGACGCTCTTCCGATCTAATGTTCAGGTGTGGGAGTAC, rev: CAGACGTGTGCTCTTCCGATCTGCCCTCTGCCTCTTGTTAGG), which include adaptors for subsequent high throughput sequencing (Illumina HiSeq2500). 250 0 F Application Read Forward 1 1 R Application Read Reverse 126 NextSeq 500 Experimental Factor: A549 cell line ERX1828175 E-MTAB-5350:U2OS_dex_4C-seq_Rep1_p ERP020626 Circularized chromosome conformation capture (4C-seq) in A549 and U2OS cells stably expressing rat GRα ERS1478321 SAMEA30154918 U2OS_dex_4C-seq_Rep1_p OTHER GENOMIC PCR Cells were cultured to confluency and treated for 90 min with 1μM dexamethasone. 4C experiments were performed as previously described (van de Werken et al., Methods Enzymol, 2012. 513: p. 89-112.), using 5x10^6 cells. 4-bp cutters were used as primary (CviQI, Thermo Fisher Scientific) and secondary (DpnII, Thermo Fisher Scientific) restriction enzymes. For each cell line 4C libraries were generated in two biological replicates. Based on 4C-libraries we amplified a total of 1.2 μg of DNA by inverse-PCR using viewpoint-specific primers (fwd: CTACACGACGCTCTTCCGATCTAATGTTCAGGTGTGGGAGTAC, rev: CAGACGTGTGCTCTTCCGATCTGCCCTCTGCCTCTTGTTAGG), which include adaptors for subsequent high throughput sequencing (Illumina HiSeq2500). 250 0 F Application Read Forward 1 1 R Application Read Reverse 126 NextSeq 500 Experimental Factor: U2OS cell line ERX1828176 E-MTAB-5350:U2OS_dex_4C-seq_Rep2_p ERP020626 Circularized chromosome conformation capture (4C-seq) in A549 and U2OS cells stably expressing rat GRα ERS1478322 SAMEA30155668 U2OS_dex_4C-seq_Rep2_p OTHER GENOMIC PCR Cells were cultured to confluency and treated for 90 min with 1μM dexamethasone. 4C experiments were performed as previously described (van de Werken et al., Methods Enzymol, 2012. 513: p. 89-112.), using 5x10^6 cells. 4-bp cutters were used as primary (CviQI, Thermo Fisher Scientific) and secondary (DpnII, Thermo Fisher Scientific) restriction enzymes. For each cell line 4C libraries were generated in two biological replicates. Based on 4C-libraries we amplified a total of 1.2 μg of DNA by inverse-PCR using viewpoint-specific primers (fwd: CTACACGACGCTCTTCCGATCTAATGTTCAGGTGTGGGAGTAC, rev: CAGACGTGTGCTCTTCCGATCTGCCCTCTGCCTCTTGTTAGG), which include adaptors for subsequent high throughput sequencing (Illumina HiSeq2500). 250 0 F Application Read Forward 1 1 R Application Read Reverse 126 NextSeq 500 Experimental Factor: U2OS cell line