ERS1478319 SAMEA30153418 9606 Homo sapiens Protocols: Cells were cultured to confluency and treated for 90 min with 1μM dexamethasone. 4C experiments were performed as previously described (van de Werken et al., Methods Enzymol, 2012. 513: p. 89-112.), using 5x10^6 cells. 4-bp cutters were used as primary (CviQI, Thermo Fisher Scientific) and secondary (DpnII, Thermo Fisher Scientific) restriction enzymes. For each cell line 4C libraries were generated in two biological replicates. Based on 4C-libraries we amplified a total of 1.2 μg of DNA by inverse-PCR using viewpoint-specific primers (fwd: CTACACGACGCTCTTCCGATCTAATGTTCAGGTGTGGGAGTAC, rev: CAGACGTGTGCTCTTCCGATCTGCCCTCTGCCTCTTGTTAGG), which include adaptors for subsequent high throughput sequencing (Illumina HiSeq2500). ENA first public 2017-12-31 ENA last update 2016-12-19 External Id SAMEA30153418 INSDC center alias Abt Vingron Max Planck Institute for Molecular Genetics INSDC center name Abt Vingron Max Planck Institute for Molecular Genetics INSDC first public 2017-12-31T17:02:35Z INSDC last update 2016-12-19T17:53:50Z INSDC status public Submitter Id E-MTAB-5350:A549_dex_4C-seq_Rep1 broker name ArrayExpress cell line A549 common name human genotype wild type genotype sample name E-MTAB-5350:A549_dex_4C-seq_Rep1 stimulus dexamethasone ERS1478320 SAMEA30154168 9606 Homo sapiens Protocols: Cells were cultured to confluency and treated for 90 min with 1μM dexamethasone. 4C experiments were performed as previously described (van de Werken et al., Methods Enzymol, 2012. 513: p. 89-112.), using 5x10^6 cells. 4-bp cutters were used as primary (CviQI, Thermo Fisher Scientific) and secondary (DpnII, Thermo Fisher Scientific) restriction enzymes. For each cell line 4C libraries were generated in two biological replicates. Based on 4C-libraries we amplified a total of 1.2 μg of DNA by inverse-PCR using viewpoint-specific primers (fwd: CTACACGACGCTCTTCCGATCTAATGTTCAGGTGTGGGAGTAC, rev: CAGACGTGTGCTCTTCCGATCTGCCCTCTGCCTCTTGTTAGG), which include adaptors for subsequent high throughput sequencing (Illumina HiSeq2500). ENA first public 2017-12-31 ENA last update 2016-12-19 External Id SAMEA30154168 INSDC center alias Abt Vingron Max Planck Institute for Molecular Genetics INSDC center name Abt Vingron Max Planck Institute for Molecular Genetics INSDC first public 2017-12-31T17:02:35Z INSDC last update 2016-12-19T17:53:50Z INSDC status public Submitter Id E-MTAB-5350:A549_dex_4C-seq_Rep2 broker name ArrayExpress cell line A549 common name human genotype wild type genotype sample name E-MTAB-5350:A549_dex_4C-seq_Rep2 stimulus dexamethasone ERS1478321 SAMEA30154918 9606 Homo sapiens Protocols: Cells were cultured to confluency and treated for 90 min with 1μM dexamethasone. 4C experiments were performed as previously described (van de Werken et al., Methods Enzymol, 2012. 513: p. 89-112.), using 5x10^6 cells. 4-bp cutters were used as primary (CviQI, Thermo Fisher Scientific) and secondary (DpnII, Thermo Fisher Scientific) restriction enzymes. For each cell line 4C libraries were generated in two biological replicates. Based on 4C-libraries we amplified a total of 1.2 μg of DNA by inverse-PCR using viewpoint-specific primers (fwd: CTACACGACGCTCTTCCGATCTAATGTTCAGGTGTGGGAGTAC, rev: CAGACGTGTGCTCTTCCGATCTGCCCTCTGCCTCTTGTTAGG), which include adaptors for subsequent high throughput sequencing (Illumina HiSeq2500). ENA first public 2017-12-31 ENA last update 2016-12-19 External Id SAMEA30154918 INSDC center alias Abt Vingron Max Planck Institute for Molecular Genetics INSDC center name Abt Vingron Max Planck Institute for Molecular Genetics INSDC first public 2017-12-31T17:02:35Z INSDC last update 2016-12-19T17:53:50Z INSDC status public Submitter Id E-MTAB-5350:U2OS_dex_4C-seq_Rep1 broker name ArrayExpress cell line U2OS common name human genotype wild type genotype sample name E-MTAB-5350:U2OS_dex_4C-seq_Rep1 stimulus dexamethasone ERS1478322 SAMEA30155668 9606 Homo sapiens Protocols: Cells were cultured to confluency and treated for 90 min with 1μM dexamethasone. 4C experiments were performed as previously described (van de Werken et al., Methods Enzymol, 2012. 513: p. 89-112.), using 5x10^6 cells. 4-bp cutters were used as primary (CviQI, Thermo Fisher Scientific) and secondary (DpnII, Thermo Fisher Scientific) restriction enzymes. For each cell line 4C libraries were generated in two biological replicates. Based on 4C-libraries we amplified a total of 1.2 μg of DNA by inverse-PCR using viewpoint-specific primers (fwd: CTACACGACGCTCTTCCGATCTAATGTTCAGGTGTGGGAGTAC, rev: CAGACGTGTGCTCTTCCGATCTGCCCTCTGCCTCTTGTTAGG), which include adaptors for subsequent high throughput sequencing (Illumina HiSeq2500). ENA first public 2017-12-31 ENA last update 2016-12-19 External Id SAMEA30155668 INSDC center alias Abt Vingron Max Planck Institute for Molecular Genetics INSDC center name Abt Vingron Max Planck Institute for Molecular Genetics INSDC first public 2017-12-31T17:02:35Z INSDC last update 2016-12-19T17:53:50Z INSDC status public Submitter Id E-MTAB-5350:U2OS_dex_4C-seq_Rep2 broker name ArrayExpress cell line U2OS common name human genotype wild type genotype sample name E-MTAB-5350:U2OS_dex_4C-seq_Rep2 stimulus dexamethasone