ERX1950942 qiita_ptid_2559:1526.HCanyon0R1 qiita_ptid_2559:1526.HCanyon0R1 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294946 SAMEA4383497 1526.HCanyon0R1 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode GAAATGCTACGT center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950943 qiita_ptid_2559:1526.HCanyon0R2 qiita_ptid_2559:1526.HCanyon0R2 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294947 SAMEA4383498 1526.HCanyon0R2 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode CGCCATTGTGCA center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950944 qiita_ptid_2559:1526.HCanyon0R3 qiita_ptid_2559:1526.HCanyon0R3 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294948 SAMEA4383499 1526.HCanyon0R3 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode AAGACAGCTATC center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950945 qiita_ptid_2559:1526.HCanyon10R1 qiita_ptid_2559:1526.HCanyon10R1 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294949 SAMEA4383500 1526.HCanyon10R1 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode GACTTCATGCGA center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950946 qiita_ptid_2559:1526.HCanyon10R2 qiita_ptid_2559:1526.HCanyon10R2 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294950 SAMEA4383501 1526.HCanyon10R2 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode TGGTTGGTTACG center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950947 qiita_ptid_2559:1526.HCanyon10R3 qiita_ptid_2559:1526.HCanyon10R3 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294951 SAMEA4383502 1526.HCanyon10R3 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode CCGAGGTATAAT center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950948 qiita_ptid_2559:1526.HCanyon11R1 qiita_ptid_2559:1526.HCanyon11R1 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294952 SAMEA4383503 1526.HCanyon11R1 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode GATGCTGCCGTT center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950949 qiita_ptid_2559:1526.HCanyon11R2 qiita_ptid_2559:1526.HCanyon11R2 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294953 SAMEA4383504 1526.HCanyon11R2 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode CTGGGTATCTCG center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950950 qiita_ptid_2559:1526.HCanyon11R3 qiita_ptid_2559:1526.HCanyon11R3 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294954 SAMEA4383505 1526.HCanyon11R3 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode GATCATTCTCTC center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950951 qiita_ptid_2559:1526.HCanyon12R1 qiita_ptid_2559:1526.HCanyon12R1 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294955 SAMEA4383506 1526.HCanyon12R1 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode GGAATCCGATTA center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950952 qiita_ptid_2559:1526.HCanyon12R2 qiita_ptid_2559:1526.HCanyon12R2 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294956 SAMEA4383507 1526.HCanyon12R2 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode AGACAGTAGGAG center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950953 qiita_ptid_2559:1526.HCanyon12R3 qiita_ptid_2559:1526.HCanyon12R3 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294957 SAMEA4383508 1526.HCanyon12R3 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode AGCTGCACCTAA center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950954 qiita_ptid_2559:1526.HCanyon1R1 qiita_ptid_2559:1526.HCanyon1R1 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294958 SAMEA4383509 1526.HCanyon1R1 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode CTCCCTTTGTGT center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950955 qiita_ptid_2559:1526.HCanyon1R2 qiita_ptid_2559:1526.HCanyon1R2 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294959 SAMEA4383510 1526.HCanyon1R2 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode GGTCTCCTACAG center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950956 qiita_ptid_2559:1526.HCanyon1R3 qiita_ptid_2559:1526.HCanyon1R3 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294960 SAMEA4383511 1526.HCanyon1R3 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode AACCAAACTCGA center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950957 qiita_ptid_2559:1526.HCanyon2R1 qiita_ptid_2559:1526.HCanyon2R1 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294961 SAMEA4383512 1526.HCanyon2R1 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode GCGAAGTTGGGA center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950958 qiita_ptid_2559:1526.HCanyon2R2 qiita_ptid_2559:1526.HCanyon2R2 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294962 SAMEA4383513 1526.HCanyon2R2 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode AACTTTCAGGAG center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950959 qiita_ptid_2559:1526.HCanyon2R3 qiita_ptid_2559:1526.HCanyon2R3 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294963 SAMEA4383514 1526.HCanyon2R3 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode GCGTCCATGAAT center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950960 qiita_ptid_2559:1526.HCanyon3R1 qiita_ptid_2559:1526.HCanyon3R1 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294964 SAMEA4383515 1526.HCanyon3R1 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode CCTGTCCTATCT center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950961 qiita_ptid_2559:1526.HCanyon3R2 qiita_ptid_2559:1526.HCanyon3R2 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294965 SAMEA4383516 1526.HCanyon3R2 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode ACCGTGCTCACA center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950962 qiita_ptid_2559:1526.HCanyon3R3 qiita_ptid_2559:1526.HCanyon3R3 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294966 SAMEA4383517 1526.HCanyon3R3 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode ACGTGTAGGCTT center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950963 qiita_ptid_2559:1526.HCanyon4R1 qiita_ptid_2559:1526.HCanyon4R1 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294967 SAMEA4383518 1526.HCanyon4R1 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode ATAGCGAACTCA center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950964 qiita_ptid_2559:1526.HCanyon4R2 qiita_ptid_2559:1526.HCanyon4R2 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294968 SAMEA4383519 1526.HCanyon4R2 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode CTACACAGCACA center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950965 qiita_ptid_2559:1526.HCanyon4R3 qiita_ptid_2559:1526.HCanyon4R3 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294969 SAMEA4383520 1526.HCanyon4R3 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode GCATTCGGCGTT center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950966 qiita_ptid_2559:1526.HCanyon5R1 qiita_ptid_2559:1526.HCanyon5R1 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294970 SAMEA4383521 1526.HCanyon5R1 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode TGCACGTGATAA center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950967 qiita_ptid_2559:1526.HCanyon5R2 qiita_ptid_2559:1526.HCanyon5R2 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294971 SAMEA4383522 1526.HCanyon5R2 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode GTAATGCGTAAC center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950968 qiita_ptid_2559:1526.HCanyon5R3 qiita_ptid_2559:1526.HCanyon5R3 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294972 SAMEA4383523 1526.HCanyon5R3 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode GGTTTAACACGC center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950969 qiita_ptid_2559:1526.HCanyon6R1 qiita_ptid_2559:1526.HCanyon6R1 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294973 SAMEA4383524 1526.HCanyon6R1 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode CACCCGATGGTT center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950970 qiita_ptid_2559:1526.HCanyon6R2 qiita_ptid_2559:1526.HCanyon6R2 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294974 SAMEA4383525 1526.HCanyon6R2 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode GCCACGACTTAC center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950971 qiita_ptid_2559:1526.HCanyon6R3 qiita_ptid_2559:1526.HCanyon6R3 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294975 SAMEA4383526 1526.HCanyon6R3 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode CCTTGACCGATG center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950972 qiita_ptid_2559:1526.HCanyon7R1 qiita_ptid_2559:1526.HCanyon7R1 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294976 SAMEA4383527 1526.HCanyon7R1 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode GTCGTCCAAATG center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950973 qiita_ptid_2559:1526.HCanyon7R2 qiita_ptid_2559:1526.HCanyon7R2 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294977 SAMEA4383528 1526.HCanyon7R2 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode AGCGTAATTAGC center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950974 qiita_ptid_2559:1526.HCanyon7R3 qiita_ptid_2559:1526.HCanyon7R3 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294978 SAMEA4383529 1526.HCanyon7R3 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode TATCACCGGCAC center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950975 qiita_ptid_2559:1526.HCanyon8R1 qiita_ptid_2559:1526.HCanyon8R1 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294979 SAMEA4383530 1526.HCanyon8R1 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode GTAGGTGCTTAC center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950976 qiita_ptid_2559:1526.HCanyon8R2 qiita_ptid_2559:1526.HCanyon8R2 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294980 SAMEA4383531 1526.HCanyon8R2 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode AGCTCTAGAAAC center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950977 qiita_ptid_2559:1526.HCanyon8R3 qiita_ptid_2559:1526.HCanyon8R3 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294981 SAMEA4383532 1526.HCanyon8R3 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode GCCTGTCTGCAA center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950978 qiita_ptid_2559:1526.HCanyon9R1 qiita_ptid_2559:1526.HCanyon9R1 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294982 SAMEA4383533 1526.HCanyon9R1 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode GAGACGTGTTCT center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950979 qiita_ptid_2559:1526.HCanyon9R2 qiita_ptid_2559:1526.HCanyon9R2 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294983 SAMEA4383534 1526.HCanyon9R2 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode CTTAGGCATGTG center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950980 qiita_ptid_2559:1526.HCanyon9R3 qiita_ptid_2559:1526.HCanyon9R3 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294984 SAMEA4383535 1526.HCanyon9R3 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode GAGCGTATCCAT center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950981 qiita_ptid_2559:1526.Halls0R1 qiita_ptid_2559:1526.Halls0R1 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294985 SAMEA4383536 1526.Halls0R1 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode ATCCCTACGGAA center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950982 qiita_ptid_2559:1526.Halls0R2 qiita_ptid_2559:1526.Halls0R2 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294986 SAMEA4383537 1526.Halls0R2 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode GCCGTAAACTTG center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950983 qiita_ptid_2559:1526.Halls10R1 qiita_ptid_2559:1526.Halls10R1 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294987 SAMEA4383538 1526.Halls10R1 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode GACTACCCGTTG center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950984 qiita_ptid_2559:1526.Halls10R2 qiita_ptid_2559:1526.Halls10R2 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294988 SAMEA4383539 1526.Halls10R2 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode AGACATACCGTA center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950985 qiita_ptid_2559:1526.Halls1R1 qiita_ptid_2559:1526.Halls1R1 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294989 SAMEA4383540 1526.Halls1R1 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode GTCTTCAGCAAG center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950986 qiita_ptid_2559:1526.Halls1R2 qiita_ptid_2559:1526.Halls1R2 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294990 SAMEA4383541 1526.Halls1R2 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode CGTAGGTAGAGG center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950987 qiita_ptid_2559:1526.Halls2R1 qiita_ptid_2559:1526.Halls2R1 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294991 SAMEA4383542 1526.Halls2R1 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode CTCGTGAATGAC center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950988 qiita_ptid_2559:1526.Halls2R2 qiita_ptid_2559:1526.Halls2R2 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294992 SAMEA4383543 1526.Halls2R2 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode TATGCCAGAGAT center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950989 qiita_ptid_2559:1526.Halls3R1 qiita_ptid_2559:1526.Halls3R1 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294993 SAMEA4383544 1526.Halls3R1 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode ACTGATGGCCTC center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950990 qiita_ptid_2559:1526.Halls3R2 qiita_ptid_2559:1526.Halls3R2 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294994 SAMEA4383545 1526.Halls3R2 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode CAACGTGCTCCA center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950991 qiita_ptid_2559:1526.Halls4R1 qiita_ptid_2559:1526.Halls4R1 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294995 SAMEA4383546 1526.Halls4R1 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode CGCATTTGGATG center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950992 qiita_ptid_2559:1526.Halls4R2 qiita_ptid_2559:1526.Halls4R2 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294996 SAMEA4383547 1526.Halls4R2 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode TCCATCGACGTG center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950993 qiita_ptid_2559:1526.Halls5R1 qiita_ptid_2559:1526.Halls5R1 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294997 SAMEA4383548 1526.Halls5R1 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode CCAGATATAGCA center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950994 qiita_ptid_2559:1526.Halls5R2 qiita_ptid_2559:1526.Halls5R2 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294998 SAMEA4383549 1526.Halls5R2 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode GATCTCTGGGTA center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950995 qiita_ptid_2559:1526.Halls6R1 qiita_ptid_2559:1526.Halls6R1 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1294999 SAMEA4383550 1526.Halls6R1 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode TCCAACTGCAGA center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950996 qiita_ptid_2559:1526.Halls6R2 qiita_ptid_2559:1526.Halls6R2 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295000 SAMEA4383551 1526.Halls6R2 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode ATTGACCGGTCA center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950997 qiita_ptid_2559:1526.Halls7R1 qiita_ptid_2559:1526.Halls7R1 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295001 SAMEA4383552 1526.Halls7R1 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode CGACTCTAAACG center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950998 qiita_ptid_2559:1526.Halls7R2 qiita_ptid_2559:1526.Halls7R2 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295002 SAMEA4383553 1526.Halls7R2 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode TTCCTAGGCCAG center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1950999 qiita_ptid_2559:1526.Halls8R1 qiita_ptid_2559:1526.Halls8R1 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295003 SAMEA4383554 1526.Halls8R1 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode TTCTCCATCACA center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1951000 qiita_ptid_2559:1526.Halls8R2 qiita_ptid_2559:1526.Halls8R2 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295004 SAMEA4383555 1526.Halls8R2 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode CTATCATCCTCA center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1951001 qiita_ptid_2559:1526.Halls9R1 qiita_ptid_2559:1526.Halls9R1 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295005 SAMEA4383556 1526.Halls9R1 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode TTCTGAGAGGTA center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1951002 qiita_ptid_2559:1526.Halls9R2 qiita_ptid_2559:1526.Halls9R2 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295006 SAMEA4383557 1526.Halls9R2 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode ATTGTTCCTACC center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1951003 qiita_ptid_2559:1526.Stillton0R1 qiita_ptid_2559:1526.Stillton0R1 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295007 SAMEA4383558 1526.Stillton0R1 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode GAACGGGACGTA center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1951004 qiita_ptid_2559:1526.Stillton0R2 qiita_ptid_2559:1526.Stillton0R2 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295008 SAMEA4383559 1526.Stillton0R2 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode TACGGATTATGG center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1951005 qiita_ptid_2559:1526.Stillton0R3 qiita_ptid_2559:1526.Stillton0R3 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295009 SAMEA4383560 1526.Stillton0R3 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode CTTGAGAAATCG center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1951006 qiita_ptid_2559:1526.Stillton10R1 qiita_ptid_2559:1526.Stillton10R1 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295010 SAMEA4383561 1526.Stillton10R1 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode AGATGATCAGTC center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1951007 qiita_ptid_2559:1526.Stillton10R2 qiita_ptid_2559:1526.Stillton10R2 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295011 SAMEA4383562 1526.Stillton10R2 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode AATGACCTCGTG center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1951008 qiita_ptid_2559:1526.Stillton10R3 qiita_ptid_2559:1526.Stillton10R3 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295012 SAMEA4383563 1526.Stillton10R3 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode ACAGCTCAAACA center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1951009 qiita_ptid_2559:1526.Stillton11R1 qiita_ptid_2559:1526.Stillton11R1 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295013 SAMEA4383564 1526.Stillton11R1 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode ACCTTACACCTT center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1951010 qiita_ptid_2559:1526.Stillton11R3 qiita_ptid_2559:1526.Stillton11R3 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295014 SAMEA4383565 1526.Stillton11R3 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode CCAGACCGCTAT center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1951011 qiita_ptid_2559:1526.Stillton1R1 qiita_ptid_2559:1526.Stillton1R1 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295015 SAMEA4383566 1526.Stillton1R1 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode GAGAGTCCACTT center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1951012 qiita_ptid_2559:1526.Stillton1R2 qiita_ptid_2559:1526.Stillton1R2 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295016 SAMEA4383567 1526.Stillton1R2 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode CATCATACGGGT center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1951013 qiita_ptid_2559:1526.Stillton2R1 qiita_ptid_2559:1526.Stillton2R1 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295017 SAMEA4383568 1526.Stillton2R1 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode ATAACATGTGCG center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1951014 qiita_ptid_2559:1526.Stillton2R2 qiita_ptid_2559:1526.Stillton2R2 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295018 SAMEA4383569 1526.Stillton2R2 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode CGATGTGTGGTT center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1951015 qiita_ptid_2559:1526.Stillton2R3 qiita_ptid_2559:1526.Stillton2R3 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295019 SAMEA4383570 1526.Stillton2R3 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode TTCGATGCCGCA center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1951016 qiita_ptid_2559:1526.Stillton3R1 qiita_ptid_2559:1526.Stillton3R1 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295020 SAMEA4383571 1526.Stillton3R1 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode TACACAAGTCGC center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1951017 qiita_ptid_2559:1526.Stillton3R2 qiita_ptid_2559:1526.Stillton3R2 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295021 SAMEA4383572 1526.Stillton3R2 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode AGGTGAGTTCTA center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1951018 qiita_ptid_2559:1526.Stillton3R3 qiita_ptid_2559:1526.Stillton3R3 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295022 SAMEA4383573 1526.Stillton3R3 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode AGGTCCAAATCA center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1951019 qiita_ptid_2559:1526.Stillton4R1 qiita_ptid_2559:1526.Stillton4R1 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295023 SAMEA4383574 1526.Stillton4R1 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode GCAGATTTCCAG center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1951020 qiita_ptid_2559:1526.Stillton4R2 qiita_ptid_2559:1526.Stillton4R2 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295024 SAMEA4383575 1526.Stillton4R2 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode CGATAGGCCTTA center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1951021 qiita_ptid_2559:1526.Stillton4R3 qiita_ptid_2559:1526.Stillton4R3 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295025 SAMEA4383576 1526.Stillton4R3 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode TGGCTTTCTATC center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1951022 qiita_ptid_2559:1526.Stillton5R2 qiita_ptid_2559:1526.Stillton5R2 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295026 SAMEA4383577 1526.Stillton5R2 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode GGTTCCATTAGG center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1951023 qiita_ptid_2559:1526.Stillton6R1 qiita_ptid_2559:1526.Stillton6R1 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295027 SAMEA4383578 1526.Stillton6R1 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode GATCCTCATGCG center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1951024 qiita_ptid_2559:1526.Stillton6R2 qiita_ptid_2559:1526.Stillton6R2 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295028 SAMEA4383579 1526.Stillton6R2 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode CGGATAACCTCC center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1951025 qiita_ptid_2559:1526.Stillton6R3 qiita_ptid_2559:1526.Stillton6R3 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295029 SAMEA4383580 1526.Stillton6R3 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode ATTTAGGACGAC center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1951026 qiita_ptid_2559:1526.Stillton7R1 qiita_ptid_2559:1526.Stillton7R1 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295030 SAMEA4383581 1526.Stillton7R1 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode ACTCTAGCCGGT center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1951027 qiita_ptid_2559:1526.Stillton7R2 qiita_ptid_2559:1526.Stillton7R2 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295031 SAMEA4383582 1526.Stillton7R2 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode ATTAAGCCTGGA center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1951028 qiita_ptid_2559:1526.Stillton7R3 qiita_ptid_2559:1526.Stillton7R3 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295032 SAMEA4383583 1526.Stillton7R3 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode GCGTTGCAAACT center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1951029 qiita_ptid_2559:1526.Stillton8R1 qiita_ptid_2559:1526.Stillton8R1 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295033 SAMEA4383584 1526.Stillton8R1 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode AACCGCATAAGT center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1951030 qiita_ptid_2559:1526.Stillton8R3 qiita_ptid_2559:1526.Stillton8R3 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295034 SAMEA4383585 1526.Stillton8R3 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode ATTATCGTCCCT center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1951031 qiita_ptid_2559:1526.Stillton9R1 qiita_ptid_2559:1526.Stillton9R1 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295035 SAMEA4383586 1526.Stillton9R1 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode AGGGTGACTTTA center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1951032 qiita_ptid_2559:1526.Stillton9R2 qiita_ptid_2559:1526.Stillton9R2 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295036 SAMEA4383587 1526.Stillton9R2 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode GGATAGCCAAGG center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA ERX1951033 qiita_ptid_2559:1526.Stillton9R3 qiita_ptid_2559:1526.Stillton9R3 ERP016869 In 1963 the Glen Canyon Dam was completed and Lake Powell began to fill. After recent, successive years of drought in the Colorado River upper basin the water level in Lake Powell has been steadily declining, and is now approximately 100 ft below the high water line. Here we present a survey of soil microbial communities at three sites in Glen Canyon, each spanning a transect from just below the current water level to above the high water line in steps of 10 vertical feet. Approximately 100 samples were collected, and archaeal and bacterial 16S rRNA was sequenced on the Illumina HiSeq2000 platform to a median sampling depth of approximately 81,000 sequences per sample. We show that the phylogenetic composition of the submerged and exposed soil microbial communities are distinct, and that with time since reemergence microbial communities of exposed soils have become more similar to those of biological soil crusts, which typify undisturbed soils of the area. Our results suggest that as the water level of Lake Powell recedes, the microbial communities of Glen Canyon soils are dynamically recovering from flood disturbance. ERS1295037 SAMEA4383588 1526.Stillton9R3 OTHER METAGENOMIC PCR EMP 18S protocol Illumina HiSeq 2000 barcode GTGTTCCCAGAA center_name CCME center_project_name Glen_Canyon_Soils illumina_technology HiSeq linker CG pcr_primers FWD:GTACACACCGCCCGTC; TGATCCTTCTGCAGGTTCACCTAC primer CGGTACACACCGCCCGTC run_center CGS-GL run_date 5/28/11 samp_size .1,g sample_center CCME sequencing_meth sequencing by synthesis target_gene 18S rRNA target_subfragment 18S rRNA