Alleviation of non-alcoholic fatty liver disease (NAFLD) and modulation of gut microbiota in rats with an herbal formula

SRX062803 TCM for NAFLD Alleviation of non-alcoholic fatty liver disease (NAFLD) and modulation of gut microbiota in rats with an herbal formula SRP006782 TCM for NAFLD SRS193108 TCM for NAFLD TCM for NAFLD AMPLICON METAGENOMIC unspecified 400 0 Technical Read Adapter 1 1 Application Read Forward 5 2 Technical Read Linker GTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGGTTCCAAC 3 Application Read Forward 454 GS FLX