SRX079016 EpiSC1-8.73-s4 SRP007273 EpiSCvsES miRNAs Total RNA was extracted using Trizol (Invitrogen) and submitted to Bioanalyser for quality assessment. 18-30nt small RNAs were cloned using the DGE-Small RNA Sample Prep Kit and the Small RNA Sample Prep v1.5 Conversion Kit from Illumina, following manufacturer instructions. Sequence of 3' adapter: ATCTCGTATGCCGTCTTCTGCTT SRS212445 EpiSC1 EpiSC1-8.73-s6 RNA-Seq TRANSCRIPTOMIC size fractionation 36 0 Application Read Forward 1 Illumina Genome Analyzer II SRX079085 EpiSC2-9.73-s7 SRP007273 EpiSCvsES miRNAs Total RNA was extracted using Trizol (Invitrogen) and submitted to Bioanalyser for quality assessment. 18-30nt small RNAs were cloned using the DGE-Small RNA Sample Prep Kit and the Small RNA Sample Prep v1.5 Conversion Kit from Illumina, following manufacturer instructions. Sequence of 3' adapter: ATCTCGTATGCCGTCTTCTGCTT SRS212446 EpiSC2 EpiSC2-9.73-s7 RNA-Seq TRANSCRIPTOMIC size fractionation 36 0 Application Read Forward 1 Illumina Genome Analyzer II SRX079086 EpiSC3-3.83-s4 SRP007273 EpiSCvsES miRNAs Total RNA was extracted using Trizol (Invitrogen) and submitted to Bioanalyser for quality assessment. 18-30nt small RNAs were cloned using the DGE-Small RNA Sample Prep Kit and the Small RNA Sample Prep v1.5 Conversion Kit from Illumina, following manufacturer instructions. Sequence of 3' adapter: ATCTCGTATGCCGTCTTCTGCTT SRS212447 EpiSC3 EpiSC3-3.83-s4 RNA-Seq TRANSCRIPTOMIC size fractionation 36 0 Application Read Forward 1 Illumina Genome Analyzer II SRX079087 ESC1-s1.miRNAs SRP007273 EpiSCvsES miRNAs Total RNA was extracted using Trizol (Invitrogen) and submitted to Bioanalyser for quality assessment. 18-30nt small RNAs were cloned using the DGE-Small RNA Sample Prep Kit and the Small RNA Sample Prep v1.5 Conversion Kit from Illumina, following manufacturer instructions. Sequence of 3' adapter: ATCTCGTATGCCGTCTTCTGCTT SRS212448 ES1 ESC1-s1 RNA-Seq TRANSCRIPTOMIC size fractionation 36 0 Application Read Forward 1 Illumina Genome Analyzer II SRX079088 ESC2-s2.miRNAs SRP007273 EpiSCvsES miRNAs Total RNA was extracted using Trizol (Invitrogen) and submitted to Bioanalyser for quality assessment. 18-30nt small RNAs were cloned using the DGE-Small RNA Sample Prep Kit and the Small RNA Sample Prep v1.5 Conversion Kit from Illumina, following manufacturer instructions. Sequence of 3' adapter: ATCTCGTATGCCGTCTTCTGCTT SRS212449 ES2 ESC1-s2 RNA-Seq TRANSCRIPTOMIC size fractionation 36 0 Application Read Forward 1 Illumina Genome Analyzer II