SRX096936 Control454 SRP008161 ElmEST cDNA was synthesized using the SMART cDNA library construction kit (Clontech, CA, USA). First-strand cDNA was synthesized for each library from 0.5-1.0 µg of total RNA in a 10-*l reaction as described in the kit protocol using the SMART IV primer (AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG), a modified oligo(dT) primer (TAGAGACCGAGGCGGCCGACATGTTTTGTTTTTTTTT CTTTTTTTTTTVN), where V = A, G, or C and N = A, G, C, or T), and SuperScript II reverse transcriptase (Invitrogen, CA, USA). Double-stranded cDNA was synthesized using the modified oligo(dT) primer and the SMART 5* PCR primer (AAGCAGTGGTATCAA CGCAGAGT) followed by a SfiI digestion as described in the SMART kit protocol. Amplified cDNA was purified using the QIAquick purification kit (Qiagen, CA, USA). All column elutions for a specific library were pooled, and the relative cDNA concentration was estimated running a 1% agarose gel electrophoresis with ethidium bromide staining and comparison to a standard molecular weight ladder. SRS260868 Control Control EST TRANSCRIPTOMIC cDNA 168 0 Technical Read Adapter 1 1 Application Read Forward 5 454 GS 20 SRX096937 F454 SRP008161 ElmEST cDNA was synthesized using the SMART cDNA library construction kit (Clontech, CA, USA). First-strand cDNA was synthesized for each library from 0.5-1.0 µg of total RNA in a 10-*l reaction as described in the kit protocol using the SMART IV primer (AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG), a modified oligo(dT) primer (TAGAGACCGAGGCGGCCGACATGTTTTGTTTTTTTTT CTTTTTTTTTTVN), where V = A, G, or C and N = A, G, C, or T), and SuperScript II reverse transcriptase (Invitrogen, CA, USA). Double-stranded cDNA was synthesized using the modified oligo(dT) primer and the SMART 5* PCR primer (AAGCAGTGGTATCAA CGCAGAGT) followed by a SfiI digestion as described in the SMART kit protocol. Amplified cDNA was purified using the QIAquick purification kit (Qiagen, CA, USA). All column elutions for a specific library were pooled, and the relative cDNA concentration was estimated running a 1% agarose gel electrophoresis with ethidium bromide staining and comparison to a standard molecular weight ladder. SRS260870 F F EST TRANSCRIPTOMIC cDNA 168 0 Technical Read Adapter 1 1 Application Read Forward 5 454 GS 20 SRX096938 454EF SRP008161 ElmEST cDNA was synthesized using the SMART cDNA library construction kit (Clontech, CA, USA). First-strand cDNA was synthesized for each library from 0.5-1.0 µg of total RNA in a 10-*l reaction as described in the kit protocol using the SMART IV primer (AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG), a modified oligo(dT) primer (TAGAGACCGAGGCGGCCGACATGTTTTGTTTTTTTTT CTTTTTTTTTTVN), where V = A, G, or C and N = A, G, C, or T), and SuperScript II reverse transcriptase (Invitrogen, CA, USA). Double-stranded cDNA was synthesized using the modified oligo(dT) primer and the SMART 5* PCR primer (AAGCAGTGGTATCAA CGCAGAGT) followed by a SfiI digestion as described in the SMART kit protocol. Amplified cDNA was purified using the QIAquick purification kit (Qiagen, CA, USA). All column elutions for a specific library were pooled, and the relative cDNA concentration was estimated running a 1% agarose gel electrophoresis with ethidium bromide staining and comparison to a standard molecular weight ladder. SRS260869 EF EF EST TRANSCRIPTOMIC cDNA 168 0 Technical Read Adapter 1 1 Application Read Forward 5 454 GS 20 SRX096939 MeJA454 SRP008161 ElmEST cDNA was synthesized using the SMART cDNA library construction kit (Clontech, CA, USA). First-strand cDNA was synthesized for each library from 0.5-1.0 µg of total RNA in a 10-*l reaction as described in the kit protocol using the SMART IV primer (AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG), a modified oligo(dT) primer (TAGAGACCGAGGCGGCCGACATGTTTTGTTTTTTTTT CTTTTTTTTTTVN), where V = A, G, or C and N = A, G, C, or T), and SuperScript II reverse transcriptase (Invitrogen, CA, USA). Double-stranded cDNA was synthesized using the modified oligo(dT) primer and the SMART 5* PCR primer (AAGCAGTGGTATCAA CGCAGAGT) followed by a SfiI digestion as described in the SMART kit protocol. Amplified cDNA was purified using the QIAquick purification kit (Qiagen, CA, USA). All column elutions for a specific library were pooled, and the relative cDNA concentration was estimated running a 1% agarose gel electrophoresis with ethidium bromide staining and comparison to a standard molecular weight ladder. SRS260871 MeJA MeJA EST TRANSCRIPTOMIC cDNA 168 0 Technical Read Adapter 1 1 Application Read Forward 5 454 GS 20 SRX096940 454E SRP008161 ElmEST cDNA was synthesized using the SMART cDNA library construction kit (Clontech, CA, USA). First-strand cDNA was synthesized for each library from 0.5-1.0 µg of total RNA in a 10-*l reaction as described in the kit protocol using the SMART IV primer (AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG), a modified oligo(dT) primer (TAGAGACCGAGGCGGCCGACATGTTTTGTTTTTTTTT CTTTTTTTTTTVN), where V = A, G, or C and N = A, G, C, or T), and SuperScript II reverse transcriptase (Invitrogen, CA, USA). Double-stranded cDNA was synthesized using the modified oligo(dT) primer and the SMART 5* PCR primer (AAGCAGTGGTATCAA CGCAGAGT) followed by a SfiI digestion as described in the SMART kit protocol. Amplified cDNA was purified using the QIAquick purification kit (Qiagen, CA, USA). All column elutions for a specific library were pooled, and the relative cDNA concentration was estimated running a 1% agarose gel electrophoresis with ethidium bromide staining and comparison to a standard molecular weight ladder. SRS260872 E E EST TRANSCRIPTOMIC cDNA 168 0 Technical Read Adapter 1 1 Application Read Forward 5 454 GS 20 SRX096941 EF_F454 SRP008161 ElmEST For isolation of total RNA, elm leaves without stems of variously treated 3-4 month old elm plants were flash frozen in liquid nitrogen and stored at -80 C°. RNA was extracted by using a modified method developed for polysaccharide rich plant tissue (Ikoma et al. 1996) that employs repeated steps of phenol: chloroform:isoamyl alcohol (PCI; 25:24:1) extractions, and lithiumchloride (LiCl) and ethanol precipitations over night. All glassware was treated with RNase AWAY® (Roth, Germany) and RNAse-free water. Plant material (0.5g) mixed with 10 ml lysis buffer (0.2M Tris-HCL, 0.1M LiCl, 5mM Na2EDTA adjusted to pH 8.2) to which 1% SDS, 0.01% ß-mercaptoethanol, 9% sodium acetate (2M, pH 4) 10ml phenol, 2ml chloroform and 2% polyvinylpolypyrrolidone (PVPP) were added. The tubes were shaken (15min, 250rpm), then centrifugated (10,000 xg, 4°C, 20min), and the RNA was extracted three times with PCI. RNA was precipitatetd with LiCl (2M final concentration) and collected in high speed 30ml KIMBLE glass tubes (Kimble, Glass Inc., Vineland, NJ, USA) by cetrifugation at 13,000 xg for 60min and finally precipitated with three volumes ethanol and 1/10 vol sodium acetate (3M, pH 5.8) in 1.5 plastic tubes. For final purification and removal of genomic DNA, the RNeasy plant mini kit (Qiagen, Germany) including the on-column DNaseI treatment step was used. Aliquots of each purified RNA extract sample were prepared and RNA concentration was determined spectrophotometrically at 260nm. For final quality control and quantification the total RNA samples were analyzed on an Agilent 2100 Bioanalyzer and Nano RNA 6000 chips (Agilent Technologies, Palo Alto, CA, USA) using the Expert Software (Agilent, version B.02.02.SI258). Total RNA extract samples were immediately frozen for long term storage as ethanol precipitates at -80°C cDNA was synthesized using the SMART cDNA library construction kit (Clontech, CA, USA). First-strand cDNA was synthesized for each library from 0.5-1.0 µg of total RNA in a 10-*l reaction as described in the kit protocol using the SMART IV primer (AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG), a modified oligo(dT) primer (TAGAGACCGAGGCGGCCGACATGTTTTGTTTTTTTTT CTTTTTTTTTTVN), where V = A, G, or C and N = A, G, C, or T), and SuperScript II reverse transcriptase (Invitrogen, CA, USA). Double-stranded cDNA was synthesized using the modified oligo(dT) primer and the SMART 5* PCR primer (AAGCAGTGGTATCAA CGCAGAGT) followed by a SfiI digestion as described in the SMART kit protocol. Amplified cDNA was purified using the QIAquick purification kit (Qiagen, CA, USA). All column elutions for a specific library were pooled, and the relative cDNA concentration was estimated running a 1% agarose gel electrophoresis with ethidium bromide staining and comparison to a standard molecular weight ladder. SRS260873 EF F EF F EST TRANSCRIPTOMIC cDNA 168 0 Technical Read Adapter 1 1 Application Read Forward 5 454 GS 20 SRX096942 C_JA_E454 SRP008161 ElmEST For isolation of total RNA, elm leaves without stems of variously treated 3-4 month old elm plants were flash frozen in liquid nitrogen and stored at -80 C°. RNA was extracted by using a modified method developed for polysaccharide rich plant tissue (Ikoma et al. 1996) that employs repeated steps of phenol: chloroform:isoamyl alcohol (PCI; 25:24:1) extractions, and lithiumchloride (LiCl) and ethanol precipitations over night. All glassware was treated with RNase AWAY® (Roth, Germany) and RNAse-free water. Plant material (0.5g) mixed with 10 ml lysis buffer (0.2M Tris-HCL, 0.1M LiCl, 5mM Na2EDTA adjusted to pH 8.2) to which 1% SDS, 0.01% ß-mercaptoethanol, 9% sodium acetate (2M, pH 4) 10ml phenol, 2ml chloroform and 2% polyvinylpolypyrrolidone (PVPP) were added. The tubes were shaken (15min, 250rpm), then centrifugated (10,000 xg, 4°C, 20min), and the RNA was extracted three times with PCI. RNA was precipitatetd with LiCl (2M final concentration) and collected in high speed 30ml KIMBLE glass tubes (Kimble, Glass Inc., Vineland, NJ, USA) by cetrifugation at 13,000 xg for 60min and finally precipitated with three volumes ethanol and 1/10 vol sodium acetate (3M, pH 5.8) in 1.5 plastic tubes. For final purification and removal of genomic DNA, the RNeasy plant mini kit (Qiagen, Germany) including the on-column DNaseI treatment step was used. Aliquots of each purified RNA extract sample were prepared and RNA concentration was determined spectrophotometrically at 260nm. For final quality control and quantification the total RNA samples were analyzed on an Agilent 2100 Bioanalyzer and Nano RNA 6000 chips (Agilent Technologies, Palo Alto, CA, USA) using the Expert Software (Agilent, version B.02.02.SI258). Total RNA extract samples were immediately frozen for long term storage as ethanol precipitates at -80°C cDNA was synthesized using the SMART cDNA library construction kit (Clontech, CA, USA). First-strand cDNA was synthesized for each library from 0.5-1.0 µg of total RNA in a 10-*l reaction as described in the kit protocol using the SMART IV primer (AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG), a modified oligo(dT) primer (TAGAGACCGAGGCGGCCGACATGTTTTGTTTTTTTTT CTTTTTTTTTTVN), where V = A, G, or C and N = A, G, C, or T), and SuperScript II reverse transcriptase (Invitrogen, CA, USA). Double-stranded cDNA was synthesized using the modified oligo(dT) primer and the SMART 5* PCR primer (AAGCAGTGGTATCAA CGCAGAGT) followed by a SfiI digestion as described in the SMART kit protocol. Amplified cDNA was purified using the QIAquick purification kit (Qiagen, CA, USA). All column elutions for a specific library were pooled, and the relative cDNA concentration was estimated running a 1% agarose gel electrophoresis with ethidium bromide staining and comparison to a standard molecular weight ladder. SRS260874 C JA E C_JA_E EST TRANSCRIPTOMIC cDNA 168 0 Technical Read Adapter 1 1 Application Read Forward 5 454 GS 20 SRX096943 AllMix454 SRP008161 ElmEST For isolation of total RNA, elm leaves without stems of variously treated 3-4 month old elm plants were flash frozen in liquid nitrogen and stored at -80 C°. RNA was extracted by using a modified method developed for polysaccharide rich plant tissue (Ikoma et al. 1996) that employs repeated steps of phenol: chloroform:isoamyl alcohol (PCI; 25:24:1) extractions, and lithiumchloride (LiCl) and ethanol precipitations over night. All glassware was treated with RNase AWAY® (Roth, Germany) and RNAse-free water. Plant material (0.5g) mixed with 10 ml lysis buffer (0.2M Tris-HCL, 0.1M LiCl, 5mM Na2EDTA adjusted to pH 8.2) to which 1% SDS, 0.01% ß-mercaptoethanol, 9% sodium acetate (2M, pH 4) 10ml phenol, 2ml chloroform and 2% polyvinylpolypyrrolidone (PVPP) were added. The tubes were shaken (15min, 250rpm), then centrifugated (10,000 xg, 4°C, 20min), and the RNA was extracted three times with PCI. RNA was precipitatetd with LiCl (2M final concentration) and collected in high speed 30ml KIMBLE glass tubes (Kimble, Glass Inc., Vineland, NJ, USA) by cetrifugation at 13,000 xg for 60min and finally precipitated with three volumes ethanol and 1/10 vol sodium acetate (3M, pH 5.8) in 1.5 plastic tubes. For final purification and removal of genomic DNA, the RNeasy plant mini kit (Qiagen, Germany) including the on-column DNaseI treatment step was used. Aliquots of each purified RNA extract sample were prepared and RNA concentration was determined spectrophotometrically at 260nm. For final quality control and quantification the total RNA samples were analyzed on an Agilent 2100 Bioanalyzer and Nano RNA 6000 chips (Agilent Technologies, Palo Alto, CA, USA) using the Expert Software (Agilent, version B.02.02.SI258). Total RNA extract samples were immediately frozen for long term storage as ethanol precipitates at -80°C cDNA was synthesized using the SMART cDNA library construction kit (Clontech, CA, USA). First-strand cDNA was synthesized for each library from 0.5-1.0 µg of total RNA in a 10-*l reaction as described in the kit protocol using the SMART IV primer (AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG), a modified oligo(dT) primer (TAGAGACCGAGGCGGCCGACATGTTTTGTTTTTTTTT CTTTTTTTTTTVN), where V = A, G, or C and N = A, G, C, or T), and SuperScript II reverse transcriptase (Invitrogen, CA, USA). Double-stranded cDNA was synthesized using the modified oligo(dT) primer and the SMART 5* PCR primer (AAGCAGTGGTATCAA CGCAGAGT) followed by a SfiI digestion as described in the SMART kit protocol. Amplified cDNA was purified using the QIAquick purification kit (Qiagen, CA, USA). All column elutions for a specific library were pooled, and the relative cDNA concentration was estimated running a 1% agarose gel electrophoresis with ethidium bromide staining and comparison to a standard molecular weight ladder. SRS260875 MixAll MixAll EST TRANSCRIPTOMIC cDNA 168 0 Technical Read Adapter 1 1 Application Read Forward 5 454 GS 20