SRX249046 454 sequencing of Thelohanellus kitauei spores DNA SRP020474 PRJNA193083 or 454/Roche GS FLX (454 FLX) paired end pyrosequencing, libraries of 8k band were prepared using the manufacturers’standard protocol. SRS406372 SAMN01940900 WGS GENOMIC RANDOM 0 0 Technical Read Adapter 1 1 Application Read Forward 5 2 Technical Read Linker GTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGGTTCCAAC 3 Application Read Forward 454 GS FLX SRX249065 Illumina sequencing of Thelohanellus kitauei spores DNA SRP020474 For Illumina sequencing, the Illumina adapters were ligated onto the genome DNA, then DNA fragments with the size of estimated 0.5kb (for pair-end sequencing) and 3kb (for mate-pair sequencing) were selected using gel-electrophoresis. Libraries were PCR-amplified using Phusion polymerase. Sequencing libraries were denatured with sodium hydroxide and diluted in hybridization buffer. In the end, the prepared libraries were loaded onto a single lane of an Illumina GA flowcell. SRS406372 Myxosporean WGS GENOMIC RANDOM 200 0 Application Read Forward 1 1 Application Read Reverse 101 Illumina Genome Analyzer II