SRX268916 H3FVXYK_region1 SRP021184 roth_viral_tethering cells were infected with MLV or mutant variants, genomic DNA harvested and integration site distributions analyzed via 454. SRS414739 SRS414740 barcode rRNA_primer SRS414741 barcode rRNA_primer SRS414742 barcode rRNA_primer SRS414743 barcode rRNA_primer SRS414744 barcode rRNA_primer SRS414745 barcode rRNA_primer SRS414746 barcode rRNA_primer SRS414747 barcode rRNA_primer SRS414748 barcode rRNA_primer SRS414749 barcode rRNA_primer SRS414750 barcode rRNA_primer SRS414751 barcode rRNA_primer H3FVXYK_region1 AMPLICON GENOMIC PCR Each amplicon library was constructed by amplifying the16S rRNA gene using the BSF8 and and the BSR357 primer pair. Primers contained DNA barcode sequences such as those described by Hamady et al. 2008, and the recommended 454 adapter sequences. Amplification conditions are described in McKenna et al 2007, with exception that the polymerase used was AccuPrime (Invitrogen, Carlsbad, CA, USA). 0 Technical Read Adapter TCAG 1 barcode Technical Read BarCode TCAGTCTC TCGTAGCA TCGTCATC TCTCACAC TGACAGTC TGCAGTAC TGCATCGA TGCTGATG TGTGCTGA ACACACTG ACAGTGTC ACTGAGTC 2 rRNA_primer Technical Read Primer TGATTGACTACCCGTCAGCGG 3 Application Read Forward 454 GS FLX Titanium