<?xml version="1.0" encoding="UTF-8"?>
<EXPERIMENT_SET xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance">
  <EXPERIMENT alias="GSM5482341" accession="SRX11588494">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX11588494</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM5482341</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM5482341: Ribo-seq_Control_rep1; Mus musculus; OTHER</TITLE>
    <STUDY_REF accession="SRP330265" refname="GSE181040">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP330265</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS9622974">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS9622974</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM5482341</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>OTHER</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>other</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <SINGLE/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>For cell lysates, at least four 10 cm dishes of cells were harvested in 400 µl ice-cold polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2). Cells were then disrupted by vortexing six times for 20s using lysing matrix D (Fisher), followed by a 40 s interval each time on ice, then centrifuged at 12,000g, 4 °C for 10 min. Samples were then subjected to sucrose gradient sedimentation. Sucrose solutions were prepared in polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2 and 2% Triton X-100). A 15%-45% (w/v) sucrose density gradients were freshly prepared in SW41 ultracentrifuge tubes (Backman) using a Gradient Master (BioComp Instruments). 500 µl of supernatant from cell lysates prepared as described above was loaded onto sucrose gradients followed by centrifugation for 2.5 hr at 32,000 rpm, 4 °C in a SW41 rotor. Separated samples were fractionated at 1.5 ml min-1 through an automated fractionation system (Isco) that continually monitors OD254 values. Ribosome fractions separated by sucrose gradient sedimentation were pooled and digested with E. coli RNase I (Ambion, 750 U per 100 A260 units) by incubation at 4 °C for 1 hr. SUPERase•In (50 U per 100 U RNase I) was then added into the reaction mixture to stop the digestion. Total RNA was extracted using TRIzol LS reagent. Fragmented RNAs were separated on a 15% polyacrylamide TBE-urea gel (Invitrogen) and visualized using SYBR Gold (Invitrogen). Selected regions of the gel corresponding to 20-70 nt (for 40S-seq and eIF3-seq) or 25-35 nt (for Ribo-seq) were excised. The gel slices were disrupted by using centrifugation through the holes at the bottom of the tube. RNA fragments were dissolved by soaking overnight in 400 µl RNA gel elution buffer (300 mM NaOAc pH 5.5, 1 mM EDTA, 0.1 U/µl SUPERase•In). The gel debris was removed using a Spin-X column (Corning), followed by ethanol precipitation.   Purified RNA fragments were re-suspended in Nuclease-free water, then dephosphorylated for 1 hr at 37 °C in a 15 µl reaction (1× T4 polynucleotide kinase buffer, 10 U SUPERase•In and 20 U T4 polynucleotide kinase). Dephosphorylated RNA fragments were precipitated using ethanol and re-suspended in Nuclease-free water. 0.15 μg linker (rApp/NNNNCTGTAGGCACCATCAAT/3ddC) then was added to the RNA fragments, heated at 70 °C for 90 s and then cooled to room temperature, followed by ligation for 3 hr at at 22 °C in a 20 µl reaction (1× T4 Rnl2 reaction buffer, 10 U SUPERase•In, 15% PEG8000 and 20 U T4 RNA ligase 2 truncated). The reaction was heat inactivated at 80 °C for 10 min and the products were separated on a 10% polyacrylamide TBE-urea gel and selected regions in the gel corresponding to 45-95 nt (for 40S-seq and eIF3-seq) or 60-70 nt (for Ribo-seq) were excised. RNA fragments were dissolved by soaking overnight in 400 μl RNA gel elution buffer. RNA fragments were purified from RNA gel elution buffer as described earlier and re-suspended in Nuclease-free water. For reverse transcription, the following oligos containing barcodes were used:   (Phos)CTANNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)AGCNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)ATTNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)CCGNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  where Phos represents phosphorylation, NNN represents random sequence, SpC18 represents Hexa-ethyleneglycol spacer.  The linker ligated RNA sample was mixed with 0.5 mM dNTP and 2.5 mM synthesized primer and incubated at 75 ° C for 3 min, followed by incubation on ice for at least 1 min. The reaction master mix was then added with 20 mM Tris (pH 8.4), 50 mM KCl, 5 mM MgCl2, 10 mM DTT, 40 U RNaseOUT and 200 U SuperScript III. Reverse transcription reaction was performed according to the manufacturer's instruction. Reverse transcription products were separated on a 10% polyacrylamide TBE-urea gel. Corresponding region was excised, which was expected to be approximately 200 nt. The first-strand cDNA products were recovered in DNA gel elution buffer (300 mM NaCl, 1 mM EDTA), then purified and re-suspended in Nuclease-free water as described earlier.  cDNA products were circularized in 20 μl of reaction containing 1×CircLigase buffer, 2.5 mM MnCl2, 1M Betaine and 100 U CircLigase II (Epicentre). Circularization was performed at 60 °C for 1 hr and the reaction was heat inactivated at 80 °C for 10 min.</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>Illumina HiSeq 2500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>305482341</ID>
          <LABEL>GSM5482341</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
    <EXPERIMENT_ATTRIBUTES>
      <EXPERIMENT_ATTRIBUTE>
        <TAG>GEO Accession</TAG>
        <VALUE>GSM5482341</VALUE>
      </EXPERIMENT_ATTRIBUTE>
    </EXPERIMENT_ATTRIBUTES>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM5482342" accession="SRX11588495">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX11588495</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM5482342</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM5482342: Ribo-seq_Control_rep2; Mus musculus; OTHER</TITLE>
    <STUDY_REF accession="SRP330265" refname="GSE181040">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP330265</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS9622973">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS9622973</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM5482342</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>OTHER</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>other</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <SINGLE/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>For cell lysates, at least four 10 cm dishes of cells were harvested in 400 µl ice-cold polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2). Cells were then disrupted by vortexing six times for 20s using lysing matrix D (Fisher), followed by a 40 s interval each time on ice, then centrifuged at 12,000g, 4 °C for 10 min. Samples were then subjected to sucrose gradient sedimentation. Sucrose solutions were prepared in polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2 and 2% Triton X-100). A 15%-45% (w/v) sucrose density gradients were freshly prepared in SW41 ultracentrifuge tubes (Backman) using a Gradient Master (BioComp Instruments). 500 µl of supernatant from cell lysates prepared as described above was loaded onto sucrose gradients followed by centrifugation for 2.5 hr at 32,000 rpm, 4 °C in a SW41 rotor. Separated samples were fractionated at 1.5 ml min-1 through an automated fractionation system (Isco) that continually monitors OD254 values. Ribosome fractions separated by sucrose gradient sedimentation were pooled and digested with E. coli RNase I (Ambion, 750 U per 100 A260 units) by incubation at 4 °C for 1 hr. SUPERase•In (50 U per 100 U RNase I) was then added into the reaction mixture to stop the digestion. Total RNA was extracted using TRIzol LS reagent. Fragmented RNAs were separated on a 15% polyacrylamide TBE-urea gel (Invitrogen) and visualized using SYBR Gold (Invitrogen). Selected regions of the gel corresponding to 20-70 nt (for 40S-seq and eIF3-seq) or 25-35 nt (for Ribo-seq) were excised. The gel slices were disrupted by using centrifugation through the holes at the bottom of the tube. RNA fragments were dissolved by soaking overnight in 400 µl RNA gel elution buffer (300 mM NaOAc pH 5.5, 1 mM EDTA, 0.1 U/µl SUPERase•In). The gel debris was removed using a Spin-X column (Corning), followed by ethanol precipitation.   Purified RNA fragments were re-suspended in Nuclease-free water, then dephosphorylated for 1 hr at 37 °C in a 15 µl reaction (1× T4 polynucleotide kinase buffer, 10 U SUPERase•In and 20 U T4 polynucleotide kinase). Dephosphorylated RNA fragments were precipitated using ethanol and re-suspended in Nuclease-free water. 0.15 μg linker (rApp/NNNNCTGTAGGCACCATCAAT/3ddC) then was added to the RNA fragments, heated at 70 °C for 90 s and then cooled to room temperature, followed by ligation for 3 hr at at 22 °C in a 20 µl reaction (1× T4 Rnl2 reaction buffer, 10 U SUPERase•In, 15% PEG8000 and 20 U T4 RNA ligase 2 truncated). The reaction was heat inactivated at 80 °C for 10 min and the products were separated on a 10% polyacrylamide TBE-urea gel and selected regions in the gel corresponding to 45-95 nt (for 40S-seq and eIF3-seq) or 60-70 nt (for Ribo-seq) were excised. RNA fragments were dissolved by soaking overnight in 400 μl RNA gel elution buffer. RNA fragments were purified from RNA gel elution buffer as described earlier and re-suspended in Nuclease-free water. For reverse transcription, the following oligos containing barcodes were used:   (Phos)CTANNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)AGCNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)ATTNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)CCGNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  where Phos represents phosphorylation, NNN represents random sequence, SpC18 represents Hexa-ethyleneglycol spacer.  The linker ligated RNA sample was mixed with 0.5 mM dNTP and 2.5 mM synthesized primer and incubated at 75 ° C for 3 min, followed by incubation on ice for at least 1 min. The reaction master mix was then added with 20 mM Tris (pH 8.4), 50 mM KCl, 5 mM MgCl2, 10 mM DTT, 40 U RNaseOUT and 200 U SuperScript III. Reverse transcription reaction was performed according to the manufacturer's instruction. Reverse transcription products were separated on a 10% polyacrylamide TBE-urea gel. Corresponding region was excised, which was expected to be approximately 200 nt. The first-strand cDNA products were recovered in DNA gel elution buffer (300 mM NaCl, 1 mM EDTA), then purified and re-suspended in Nuclease-free water as described earlier.  cDNA products were circularized in 20 μl of reaction containing 1×CircLigase buffer, 2.5 mM MnCl2, 1M Betaine and 100 U CircLigase II (Epicentre). Circularization was performed at 60 °C for 1 hr and the reaction was heat inactivated at 80 °C for 10 min.</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>Illumina HiSeq 2500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>305482342</ID>
          <LABEL>GSM5482342</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
    <EXPERIMENT_ATTRIBUTES>
      <EXPERIMENT_ATTRIBUTE>
        <TAG>GEO Accession</TAG>
        <VALUE>GSM5482342</VALUE>
      </EXPERIMENT_ATTRIBUTE>
    </EXPERIMENT_ATTRIBUTES>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM5482343" accession="SRX11588496">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX11588496</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM5482343</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM5482343: Ribo-seq_Starvation_rep1; Mus musculus; OTHER</TITLE>
    <STUDY_REF accession="SRP330265" refname="GSE181040">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP330265</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS9622975">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS9622975</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM5482343</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>OTHER</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>other</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <SINGLE/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>For cell lysates, at least four 10 cm dishes of cells were harvested in 400 µl ice-cold polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2). Cells were then disrupted by vortexing six times for 20s using lysing matrix D (Fisher), followed by a 40 s interval each time on ice, then centrifuged at 12,000g, 4 °C for 10 min. Samples were then subjected to sucrose gradient sedimentation. Sucrose solutions were prepared in polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2 and 2% Triton X-100). A 15%-45% (w/v) sucrose density gradients were freshly prepared in SW41 ultracentrifuge tubes (Backman) using a Gradient Master (BioComp Instruments). 500 µl of supernatant from cell lysates prepared as described above was loaded onto sucrose gradients followed by centrifugation for 2.5 hr at 32,000 rpm, 4 °C in a SW41 rotor. Separated samples were fractionated at 1.5 ml min-1 through an automated fractionation system (Isco) that continually monitors OD254 values. Ribosome fractions separated by sucrose gradient sedimentation were pooled and digested with E. coli RNase I (Ambion, 750 U per 100 A260 units) by incubation at 4 °C for 1 hr. SUPERase•In (50 U per 100 U RNase I) was then added into the reaction mixture to stop the digestion. Total RNA was extracted using TRIzol LS reagent. Fragmented RNAs were separated on a 15% polyacrylamide TBE-urea gel (Invitrogen) and visualized using SYBR Gold (Invitrogen). Selected regions of the gel corresponding to 20-70 nt (for 40S-seq and eIF3-seq) or 25-35 nt (for Ribo-seq) were excised. The gel slices were disrupted by using centrifugation through the holes at the bottom of the tube. RNA fragments were dissolved by soaking overnight in 400 µl RNA gel elution buffer (300 mM NaOAc pH 5.5, 1 mM EDTA, 0.1 U/µl SUPERase•In). The gel debris was removed using a Spin-X column (Corning), followed by ethanol precipitation.   Purified RNA fragments were re-suspended in Nuclease-free water, then dephosphorylated for 1 hr at 37 °C in a 15 µl reaction (1× T4 polynucleotide kinase buffer, 10 U SUPERase•In and 20 U T4 polynucleotide kinase). Dephosphorylated RNA fragments were precipitated using ethanol and re-suspended in Nuclease-free water. 0.15 μg linker (rApp/NNNNCTGTAGGCACCATCAAT/3ddC) then was added to the RNA fragments, heated at 70 °C for 90 s and then cooled to room temperature, followed by ligation for 3 hr at at 22 °C in a 20 µl reaction (1× T4 Rnl2 reaction buffer, 10 U SUPERase•In, 15% PEG8000 and 20 U T4 RNA ligase 2 truncated). The reaction was heat inactivated at 80 °C for 10 min and the products were separated on a 10% polyacrylamide TBE-urea gel and selected regions in the gel corresponding to 45-95 nt (for 40S-seq and eIF3-seq) or 60-70 nt (for Ribo-seq) were excised. RNA fragments were dissolved by soaking overnight in 400 μl RNA gel elution buffer. RNA fragments were purified from RNA gel elution buffer as described earlier and re-suspended in Nuclease-free water. For reverse transcription, the following oligos containing barcodes were used:   (Phos)CTANNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)AGCNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)ATTNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)CCGNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  where Phos represents phosphorylation, NNN represents random sequence, SpC18 represents Hexa-ethyleneglycol spacer.  The linker ligated RNA sample was mixed with 0.5 mM dNTP and 2.5 mM synthesized primer and incubated at 75 ° C for 3 min, followed by incubation on ice for at least 1 min. The reaction master mix was then added with 20 mM Tris (pH 8.4), 50 mM KCl, 5 mM MgCl2, 10 mM DTT, 40 U RNaseOUT and 200 U SuperScript III. Reverse transcription reaction was performed according to the manufacturer's instruction. Reverse transcription products were separated on a 10% polyacrylamide TBE-urea gel. Corresponding region was excised, which was expected to be approximately 200 nt. The first-strand cDNA products were recovered in DNA gel elution buffer (300 mM NaCl, 1 mM EDTA), then purified and re-suspended in Nuclease-free water as described earlier.  cDNA products were circularized in 20 μl of reaction containing 1×CircLigase buffer, 2.5 mM MnCl2, 1M Betaine and 100 U CircLigase II (Epicentre). Circularization was performed at 60 °C for 1 hr and the reaction was heat inactivated at 80 °C for 10 min.</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>Illumina HiSeq 2500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>305482343</ID>
          <LABEL>GSM5482343</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
    <EXPERIMENT_ATTRIBUTES>
      <EXPERIMENT_ATTRIBUTE>
        <TAG>GEO Accession</TAG>
        <VALUE>GSM5482343</VALUE>
      </EXPERIMENT_ATTRIBUTE>
    </EXPERIMENT_ATTRIBUTES>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM5482344" accession="SRX11588497">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX11588497</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM5482344</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM5482344: Ribo-seq_Starvation_rep2; Mus musculus; OTHER</TITLE>
    <STUDY_REF accession="SRP330265" refname="GSE181040">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP330265</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS9622976">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS9622976</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM5482344</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>OTHER</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>other</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <SINGLE/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>For cell lysates, at least four 10 cm dishes of cells were harvested in 400 µl ice-cold polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2). Cells were then disrupted by vortexing six times for 20s using lysing matrix D (Fisher), followed by a 40 s interval each time on ice, then centrifuged at 12,000g, 4 °C for 10 min. Samples were then subjected to sucrose gradient sedimentation. Sucrose solutions were prepared in polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2 and 2% Triton X-100). A 15%-45% (w/v) sucrose density gradients were freshly prepared in SW41 ultracentrifuge tubes (Backman) using a Gradient Master (BioComp Instruments). 500 µl of supernatant from cell lysates prepared as described above was loaded onto sucrose gradients followed by centrifugation for 2.5 hr at 32,000 rpm, 4 °C in a SW41 rotor. Separated samples were fractionated at 1.5 ml min-1 through an automated fractionation system (Isco) that continually monitors OD254 values. Ribosome fractions separated by sucrose gradient sedimentation were pooled and digested with E. coli RNase I (Ambion, 750 U per 100 A260 units) by incubation at 4 °C for 1 hr. SUPERase•In (50 U per 100 U RNase I) was then added into the reaction mixture to stop the digestion. Total RNA was extracted using TRIzol LS reagent. Fragmented RNAs were separated on a 15% polyacrylamide TBE-urea gel (Invitrogen) and visualized using SYBR Gold (Invitrogen). Selected regions of the gel corresponding to 20-70 nt (for 40S-seq and eIF3-seq) or 25-35 nt (for Ribo-seq) were excised. The gel slices were disrupted by using centrifugation through the holes at the bottom of the tube. RNA fragments were dissolved by soaking overnight in 400 µl RNA gel elution buffer (300 mM NaOAc pH 5.5, 1 mM EDTA, 0.1 U/µl SUPERase•In). The gel debris was removed using a Spin-X column (Corning), followed by ethanol precipitation.   Purified RNA fragments were re-suspended in Nuclease-free water, then dephosphorylated for 1 hr at 37 °C in a 15 µl reaction (1× T4 polynucleotide kinase buffer, 10 U SUPERase•In and 20 U T4 polynucleotide kinase). Dephosphorylated RNA fragments were precipitated using ethanol and re-suspended in Nuclease-free water. 0.15 μg linker (rApp/NNNNCTGTAGGCACCATCAAT/3ddC) then was added to the RNA fragments, heated at 70 °C for 90 s and then cooled to room temperature, followed by ligation for 3 hr at at 22 °C in a 20 µl reaction (1× T4 Rnl2 reaction buffer, 10 U SUPERase•In, 15% PEG8000 and 20 U T4 RNA ligase 2 truncated). The reaction was heat inactivated at 80 °C for 10 min and the products were separated on a 10% polyacrylamide TBE-urea gel and selected regions in the gel corresponding to 45-95 nt (for 40S-seq and eIF3-seq) or 60-70 nt (for Ribo-seq) were excised. RNA fragments were dissolved by soaking overnight in 400 μl RNA gel elution buffer. RNA fragments were purified from RNA gel elution buffer as described earlier and re-suspended in Nuclease-free water. For reverse transcription, the following oligos containing barcodes were used:   (Phos)CTANNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)AGCNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)ATTNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)CCGNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  where Phos represents phosphorylation, NNN represents random sequence, SpC18 represents Hexa-ethyleneglycol spacer.  The linker ligated RNA sample was mixed with 0.5 mM dNTP and 2.5 mM synthesized primer and incubated at 75 ° C for 3 min, followed by incubation on ice for at least 1 min. The reaction master mix was then added with 20 mM Tris (pH 8.4), 50 mM KCl, 5 mM MgCl2, 10 mM DTT, 40 U RNaseOUT and 200 U SuperScript III. Reverse transcription reaction was performed according to the manufacturer's instruction. Reverse transcription products were separated on a 10% polyacrylamide TBE-urea gel. Corresponding region was excised, which was expected to be approximately 200 nt. The first-strand cDNA products were recovered in DNA gel elution buffer (300 mM NaCl, 1 mM EDTA), then purified and re-suspended in Nuclease-free water as described earlier.  cDNA products were circularized in 20 μl of reaction containing 1×CircLigase buffer, 2.5 mM MnCl2, 1M Betaine and 100 U CircLigase II (Epicentre). Circularization was performed at 60 °C for 1 hr and the reaction was heat inactivated at 80 °C for 10 min.</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>Illumina HiSeq 2500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>305482344</ID>
          <LABEL>GSM5482344</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
    <EXPERIMENT_ATTRIBUTES>
      <EXPERIMENT_ATTRIBUTE>
        <TAG>GEO Accession</TAG>
        <VALUE>GSM5482344</VALUE>
      </EXPERIMENT_ATTRIBUTE>
    </EXPERIMENT_ATTRIBUTES>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM5482345" accession="SRX11588498">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX11588498</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM5482345</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM5482345: Ribo-seq_OGT_KO_rep1; Mus musculus; OTHER</TITLE>
    <STUDY_REF accession="SRP330265" refname="GSE181040">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP330265</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS9622977">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS9622977</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM5482345</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>OTHER</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>other</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <SINGLE/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>For cell lysates, at least four 10 cm dishes of cells were harvested in 400 µl ice-cold polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2). Cells were then disrupted by vortexing six times for 20s using lysing matrix D (Fisher), followed by a 40 s interval each time on ice, then centrifuged at 12,000g, 4 °C for 10 min. Samples were then subjected to sucrose gradient sedimentation. Sucrose solutions were prepared in polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2 and 2% Triton X-100). A 15%-45% (w/v) sucrose density gradients were freshly prepared in SW41 ultracentrifuge tubes (Backman) using a Gradient Master (BioComp Instruments). 500 µl of supernatant from cell lysates prepared as described above was loaded onto sucrose gradients followed by centrifugation for 2.5 hr at 32,000 rpm, 4 °C in a SW41 rotor. Separated samples were fractionated at 1.5 ml min-1 through an automated fractionation system (Isco) that continually monitors OD254 values. Ribosome fractions separated by sucrose gradient sedimentation were pooled and digested with E. coli RNase I (Ambion, 750 U per 100 A260 units) by incubation at 4 °C for 1 hr. SUPERase•In (50 U per 100 U RNase I) was then added into the reaction mixture to stop the digestion. Total RNA was extracted using TRIzol LS reagent. Fragmented RNAs were separated on a 15% polyacrylamide TBE-urea gel (Invitrogen) and visualized using SYBR Gold (Invitrogen). Selected regions of the gel corresponding to 20-70 nt (for 40S-seq and eIF3-seq) or 25-35 nt (for Ribo-seq) were excised. The gel slices were disrupted by using centrifugation through the holes at the bottom of the tube. RNA fragments were dissolved by soaking overnight in 400 µl RNA gel elution buffer (300 mM NaOAc pH 5.5, 1 mM EDTA, 0.1 U/µl SUPERase•In). The gel debris was removed using a Spin-X column (Corning), followed by ethanol precipitation.   Purified RNA fragments were re-suspended in Nuclease-free water, then dephosphorylated for 1 hr at 37 °C in a 15 µl reaction (1× T4 polynucleotide kinase buffer, 10 U SUPERase•In and 20 U T4 polynucleotide kinase). Dephosphorylated RNA fragments were precipitated using ethanol and re-suspended in Nuclease-free water. 0.15 μg linker (rApp/NNNNCTGTAGGCACCATCAAT/3ddC) then was added to the RNA fragments, heated at 70 °C for 90 s and then cooled to room temperature, followed by ligation for 3 hr at at 22 °C in a 20 µl reaction (1× T4 Rnl2 reaction buffer, 10 U SUPERase•In, 15% PEG8000 and 20 U T4 RNA ligase 2 truncated). The reaction was heat inactivated at 80 °C for 10 min and the products were separated on a 10% polyacrylamide TBE-urea gel and selected regions in the gel corresponding to 45-95 nt (for 40S-seq and eIF3-seq) or 60-70 nt (for Ribo-seq) were excised. RNA fragments were dissolved by soaking overnight in 400 μl RNA gel elution buffer. RNA fragments were purified from RNA gel elution buffer as described earlier and re-suspended in Nuclease-free water. For reverse transcription, the following oligos containing barcodes were used:   (Phos)CTANNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)AGCNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)ATTNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)CCGNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  where Phos represents phosphorylation, NNN represents random sequence, SpC18 represents Hexa-ethyleneglycol spacer.  The linker ligated RNA sample was mixed with 0.5 mM dNTP and 2.5 mM synthesized primer and incubated at 75 ° C for 3 min, followed by incubation on ice for at least 1 min. The reaction master mix was then added with 20 mM Tris (pH 8.4), 50 mM KCl, 5 mM MgCl2, 10 mM DTT, 40 U RNaseOUT and 200 U SuperScript III. Reverse transcription reaction was performed according to the manufacturer's instruction. Reverse transcription products were separated on a 10% polyacrylamide TBE-urea gel. Corresponding region was excised, which was expected to be approximately 200 nt. The first-strand cDNA products were recovered in DNA gel elution buffer (300 mM NaCl, 1 mM EDTA), then purified and re-suspended in Nuclease-free water as described earlier.  cDNA products were circularized in 20 μl of reaction containing 1×CircLigase buffer, 2.5 mM MnCl2, 1M Betaine and 100 U CircLigase II (Epicentre). Circularization was performed at 60 °C for 1 hr and the reaction was heat inactivated at 80 °C for 10 min.</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>Illumina HiSeq 2500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>305482345</ID>
          <LABEL>GSM5482345</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
    <EXPERIMENT_ATTRIBUTES>
      <EXPERIMENT_ATTRIBUTE>
        <TAG>GEO Accession</TAG>
        <VALUE>GSM5482345</VALUE>
      </EXPERIMENT_ATTRIBUTE>
    </EXPERIMENT_ATTRIBUTES>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM5482346" accession="SRX11588499">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX11588499</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM5482346</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM5482346: Ribo-seq_OGT_KO_rep2; Mus musculus; OTHER</TITLE>
    <STUDY_REF accession="SRP330265" refname="GSE181040">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP330265</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS9622979">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS9622979</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM5482346</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>OTHER</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>other</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <SINGLE/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>For cell lysates, at least four 10 cm dishes of cells were harvested in 400 µl ice-cold polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2). Cells were then disrupted by vortexing six times for 20s using lysing matrix D (Fisher), followed by a 40 s interval each time on ice, then centrifuged at 12,000g, 4 °C for 10 min. Samples were then subjected to sucrose gradient sedimentation. Sucrose solutions were prepared in polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2 and 2% Triton X-100). A 15%-45% (w/v) sucrose density gradients were freshly prepared in SW41 ultracentrifuge tubes (Backman) using a Gradient Master (BioComp Instruments). 500 µl of supernatant from cell lysates prepared as described above was loaded onto sucrose gradients followed by centrifugation for 2.5 hr at 32,000 rpm, 4 °C in a SW41 rotor. Separated samples were fractionated at 1.5 ml min-1 through an automated fractionation system (Isco) that continually monitors OD254 values. Ribosome fractions separated by sucrose gradient sedimentation were pooled and digested with E. coli RNase I (Ambion, 750 U per 100 A260 units) by incubation at 4 °C for 1 hr. SUPERase•In (50 U per 100 U RNase I) was then added into the reaction mixture to stop the digestion. Total RNA was extracted using TRIzol LS reagent. Fragmented RNAs were separated on a 15% polyacrylamide TBE-urea gel (Invitrogen) and visualized using SYBR Gold (Invitrogen). Selected regions of the gel corresponding to 20-70 nt (for 40S-seq and eIF3-seq) or 25-35 nt (for Ribo-seq) were excised. The gel slices were disrupted by using centrifugation through the holes at the bottom of the tube. RNA fragments were dissolved by soaking overnight in 400 µl RNA gel elution buffer (300 mM NaOAc pH 5.5, 1 mM EDTA, 0.1 U/µl SUPERase•In). The gel debris was removed using a Spin-X column (Corning), followed by ethanol precipitation.   Purified RNA fragments were re-suspended in Nuclease-free water, then dephosphorylated for 1 hr at 37 °C in a 15 µl reaction (1× T4 polynucleotide kinase buffer, 10 U SUPERase•In and 20 U T4 polynucleotide kinase). Dephosphorylated RNA fragments were precipitated using ethanol and re-suspended in Nuclease-free water. 0.15 μg linker (rApp/NNNNCTGTAGGCACCATCAAT/3ddC) then was added to the RNA fragments, heated at 70 °C for 90 s and then cooled to room temperature, followed by ligation for 3 hr at at 22 °C in a 20 µl reaction (1× T4 Rnl2 reaction buffer, 10 U SUPERase•In, 15% PEG8000 and 20 U T4 RNA ligase 2 truncated). The reaction was heat inactivated at 80 °C for 10 min and the products were separated on a 10% polyacrylamide TBE-urea gel and selected regions in the gel corresponding to 45-95 nt (for 40S-seq and eIF3-seq) or 60-70 nt (for Ribo-seq) were excised. RNA fragments were dissolved by soaking overnight in 400 μl RNA gel elution buffer. RNA fragments were purified from RNA gel elution buffer as described earlier and re-suspended in Nuclease-free water. For reverse transcription, the following oligos containing barcodes were used:   (Phos)CTANNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)AGCNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)ATTNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)CCGNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  where Phos represents phosphorylation, NNN represents random sequence, SpC18 represents Hexa-ethyleneglycol spacer.  The linker ligated RNA sample was mixed with 0.5 mM dNTP and 2.5 mM synthesized primer and incubated at 75 ° C for 3 min, followed by incubation on ice for at least 1 min. The reaction master mix was then added with 20 mM Tris (pH 8.4), 50 mM KCl, 5 mM MgCl2, 10 mM DTT, 40 U RNaseOUT and 200 U SuperScript III. Reverse transcription reaction was performed according to the manufacturer's instruction. Reverse transcription products were separated on a 10% polyacrylamide TBE-urea gel. Corresponding region was excised, which was expected to be approximately 200 nt. The first-strand cDNA products were recovered in DNA gel elution buffer (300 mM NaCl, 1 mM EDTA), then purified and re-suspended in Nuclease-free water as described earlier.  cDNA products were circularized in 20 μl of reaction containing 1×CircLigase buffer, 2.5 mM MnCl2, 1M Betaine and 100 U CircLigase II (Epicentre). Circularization was performed at 60 °C for 1 hr and the reaction was heat inactivated at 80 °C for 10 min.</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>Illumina HiSeq 2500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>305482346</ID>
          <LABEL>GSM5482346</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
    <EXPERIMENT_ATTRIBUTES>
      <EXPERIMENT_ATTRIBUTE>
        <TAG>GEO Accession</TAG>
        <VALUE>GSM5482346</VALUE>
      </EXPERIMENT_ATTRIBUTE>
    </EXPERIMENT_ATTRIBUTES>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM5482347" accession="SRX11588500">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX11588500</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM5482347</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM5482347: Ribo-seq_OGT_KO_Starvation_rep1; Mus musculus; OTHER</TITLE>
    <STUDY_REF accession="SRP330265" refname="GSE181040">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP330265</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS9622978">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS9622978</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM5482347</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>OTHER</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>other</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <SINGLE/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>For cell lysates, at least four 10 cm dishes of cells were harvested in 400 µl ice-cold polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2). Cells were then disrupted by vortexing six times for 20s using lysing matrix D (Fisher), followed by a 40 s interval each time on ice, then centrifuged at 12,000g, 4 °C for 10 min. Samples were then subjected to sucrose gradient sedimentation. Sucrose solutions were prepared in polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2 and 2% Triton X-100). A 15%-45% (w/v) sucrose density gradients were freshly prepared in SW41 ultracentrifuge tubes (Backman) using a Gradient Master (BioComp Instruments). 500 µl of supernatant from cell lysates prepared as described above was loaded onto sucrose gradients followed by centrifugation for 2.5 hr at 32,000 rpm, 4 °C in a SW41 rotor. Separated samples were fractionated at 1.5 ml min-1 through an automated fractionation system (Isco) that continually monitors OD254 values. Ribosome fractions separated by sucrose gradient sedimentation were pooled and digested with E. coli RNase I (Ambion, 750 U per 100 A260 units) by incubation at 4 °C for 1 hr. SUPERase•In (50 U per 100 U RNase I) was then added into the reaction mixture to stop the digestion. Total RNA was extracted using TRIzol LS reagent. Fragmented RNAs were separated on a 15% polyacrylamide TBE-urea gel (Invitrogen) and visualized using SYBR Gold (Invitrogen). Selected regions of the gel corresponding to 20-70 nt (for 40S-seq and eIF3-seq) or 25-35 nt (for Ribo-seq) were excised. The gel slices were disrupted by using centrifugation through the holes at the bottom of the tube. RNA fragments were dissolved by soaking overnight in 400 µl RNA gel elution buffer (300 mM NaOAc pH 5.5, 1 mM EDTA, 0.1 U/µl SUPERase•In). The gel debris was removed using a Spin-X column (Corning), followed by ethanol precipitation.   Purified RNA fragments were re-suspended in Nuclease-free water, then dephosphorylated for 1 hr at 37 °C in a 15 µl reaction (1× T4 polynucleotide kinase buffer, 10 U SUPERase•In and 20 U T4 polynucleotide kinase). Dephosphorylated RNA fragments were precipitated using ethanol and re-suspended in Nuclease-free water. 0.15 μg linker (rApp/NNNNCTGTAGGCACCATCAAT/3ddC) then was added to the RNA fragments, heated at 70 °C for 90 s and then cooled to room temperature, followed by ligation for 3 hr at at 22 °C in a 20 µl reaction (1× T4 Rnl2 reaction buffer, 10 U SUPERase•In, 15% PEG8000 and 20 U T4 RNA ligase 2 truncated). The reaction was heat inactivated at 80 °C for 10 min and the products were separated on a 10% polyacrylamide TBE-urea gel and selected regions in the gel corresponding to 45-95 nt (for 40S-seq and eIF3-seq) or 60-70 nt (for Ribo-seq) were excised. RNA fragments were dissolved by soaking overnight in 400 μl RNA gel elution buffer. RNA fragments were purified from RNA gel elution buffer as described earlier and re-suspended in Nuclease-free water. For reverse transcription, the following oligos containing barcodes were used:   (Phos)CTANNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)AGCNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)ATTNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)CCGNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  where Phos represents phosphorylation, NNN represents random sequence, SpC18 represents Hexa-ethyleneglycol spacer.  The linker ligated RNA sample was mixed with 0.5 mM dNTP and 2.5 mM synthesized primer and incubated at 75 ° C for 3 min, followed by incubation on ice for at least 1 min. The reaction master mix was then added with 20 mM Tris (pH 8.4), 50 mM KCl, 5 mM MgCl2, 10 mM DTT, 40 U RNaseOUT and 200 U SuperScript III. Reverse transcription reaction was performed according to the manufacturer's instruction. Reverse transcription products were separated on a 10% polyacrylamide TBE-urea gel. Corresponding region was excised, which was expected to be approximately 200 nt. The first-strand cDNA products were recovered in DNA gel elution buffer (300 mM NaCl, 1 mM EDTA), then purified and re-suspended in Nuclease-free water as described earlier.  cDNA products were circularized in 20 μl of reaction containing 1×CircLigase buffer, 2.5 mM MnCl2, 1M Betaine and 100 U CircLigase II (Epicentre). Circularization was performed at 60 °C for 1 hr and the reaction was heat inactivated at 80 °C for 10 min.</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>Illumina HiSeq 2500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>305482347</ID>
          <LABEL>GSM5482347</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
    <EXPERIMENT_ATTRIBUTES>
      <EXPERIMENT_ATTRIBUTE>
        <TAG>GEO Accession</TAG>
        <VALUE>GSM5482347</VALUE>
      </EXPERIMENT_ATTRIBUTE>
    </EXPERIMENT_ATTRIBUTES>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM5482348" accession="SRX11588501">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX11588501</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM5482348</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM5482348: Ribo-seq_OGT_KO_Starvation_rep2; Mus musculus; OTHER</TITLE>
    <STUDY_REF accession="SRP330265" refname="GSE181040">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP330265</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS9622980">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS9622980</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM5482348</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>OTHER</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>other</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <SINGLE/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>For cell lysates, at least four 10 cm dishes of cells were harvested in 400 µl ice-cold polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2). Cells were then disrupted by vortexing six times for 20s using lysing matrix D (Fisher), followed by a 40 s interval each time on ice, then centrifuged at 12,000g, 4 °C for 10 min. Samples were then subjected to sucrose gradient sedimentation. Sucrose solutions were prepared in polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2 and 2% Triton X-100). A 15%-45% (w/v) sucrose density gradients were freshly prepared in SW41 ultracentrifuge tubes (Backman) using a Gradient Master (BioComp Instruments). 500 µl of supernatant from cell lysates prepared as described above was loaded onto sucrose gradients followed by centrifugation for 2.5 hr at 32,000 rpm, 4 °C in a SW41 rotor. Separated samples were fractionated at 1.5 ml min-1 through an automated fractionation system (Isco) that continually monitors OD254 values. Ribosome fractions separated by sucrose gradient sedimentation were pooled and digested with E. coli RNase I (Ambion, 750 U per 100 A260 units) by incubation at 4 °C for 1 hr. SUPERase•In (50 U per 100 U RNase I) was then added into the reaction mixture to stop the digestion. Total RNA was extracted using TRIzol LS reagent. Fragmented RNAs were separated on a 15% polyacrylamide TBE-urea gel (Invitrogen) and visualized using SYBR Gold (Invitrogen). Selected regions of the gel corresponding to 20-70 nt (for 40S-seq and eIF3-seq) or 25-35 nt (for Ribo-seq) were excised. The gel slices were disrupted by using centrifugation through the holes at the bottom of the tube. RNA fragments were dissolved by soaking overnight in 400 µl RNA gel elution buffer (300 mM NaOAc pH 5.5, 1 mM EDTA, 0.1 U/µl SUPERase•In). The gel debris was removed using a Spin-X column (Corning), followed by ethanol precipitation.   Purified RNA fragments were re-suspended in Nuclease-free water, then dephosphorylated for 1 hr at 37 °C in a 15 µl reaction (1× T4 polynucleotide kinase buffer, 10 U SUPERase•In and 20 U T4 polynucleotide kinase). Dephosphorylated RNA fragments were precipitated using ethanol and re-suspended in Nuclease-free water. 0.15 μg linker (rApp/NNNNCTGTAGGCACCATCAAT/3ddC) then was added to the RNA fragments, heated at 70 °C for 90 s and then cooled to room temperature, followed by ligation for 3 hr at at 22 °C in a 20 µl reaction (1× T4 Rnl2 reaction buffer, 10 U SUPERase•In, 15% PEG8000 and 20 U T4 RNA ligase 2 truncated). The reaction was heat inactivated at 80 °C for 10 min and the products were separated on a 10% polyacrylamide TBE-urea gel and selected regions in the gel corresponding to 45-95 nt (for 40S-seq and eIF3-seq) or 60-70 nt (for Ribo-seq) were excised. RNA fragments were dissolved by soaking overnight in 400 μl RNA gel elution buffer. RNA fragments were purified from RNA gel elution buffer as described earlier and re-suspended in Nuclease-free water. For reverse transcription, the following oligos containing barcodes were used:   (Phos)CTANNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)AGCNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)ATTNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)CCGNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  where Phos represents phosphorylation, NNN represents random sequence, SpC18 represents Hexa-ethyleneglycol spacer.  The linker ligated RNA sample was mixed with 0.5 mM dNTP and 2.5 mM synthesized primer and incubated at 75 ° C for 3 min, followed by incubation on ice for at least 1 min. The reaction master mix was then added with 20 mM Tris (pH 8.4), 50 mM KCl, 5 mM MgCl2, 10 mM DTT, 40 U RNaseOUT and 200 U SuperScript III. Reverse transcription reaction was performed according to the manufacturer's instruction. Reverse transcription products were separated on a 10% polyacrylamide TBE-urea gel. Corresponding region was excised, which was expected to be approximately 200 nt. The first-strand cDNA products were recovered in DNA gel elution buffer (300 mM NaCl, 1 mM EDTA), then purified and re-suspended in Nuclease-free water as described earlier.  cDNA products were circularized in 20 μl of reaction containing 1×CircLigase buffer, 2.5 mM MnCl2, 1M Betaine and 100 U CircLigase II (Epicentre). Circularization was performed at 60 °C for 1 hr and the reaction was heat inactivated at 80 °C for 10 min.</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>Illumina HiSeq 2500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>305482348</ID>
          <LABEL>GSM5482348</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
    <EXPERIMENT_ATTRIBUTES>
      <EXPERIMENT_ATTRIBUTE>
        <TAG>GEO Accession</TAG>
        <VALUE>GSM5482348</VALUE>
      </EXPERIMENT_ATTRIBUTE>
    </EXPERIMENT_ATTRIBUTES>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM5482349" accession="SRX11588502">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX11588502</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM5482349</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM5482349: Ribo-seq_ThiametG_rep1; Mus musculus; OTHER</TITLE>
    <STUDY_REF accession="SRP330265" refname="GSE181040">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP330265</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS9622981">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS9622981</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM5482349</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>OTHER</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>other</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <SINGLE/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>For cell lysates, at least four 10 cm dishes of cells were harvested in 400 µl ice-cold polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2). Cells were then disrupted by vortexing six times for 20s using lysing matrix D (Fisher), followed by a 40 s interval each time on ice, then centrifuged at 12,000g, 4 °C for 10 min. Samples were then subjected to sucrose gradient sedimentation. Sucrose solutions were prepared in polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2 and 2% Triton X-100). A 15%-45% (w/v) sucrose density gradients were freshly prepared in SW41 ultracentrifuge tubes (Backman) using a Gradient Master (BioComp Instruments). 500 µl of supernatant from cell lysates prepared as described above was loaded onto sucrose gradients followed by centrifugation for 2.5 hr at 32,000 rpm, 4 °C in a SW41 rotor. Separated samples were fractionated at 1.5 ml min-1 through an automated fractionation system (Isco) that continually monitors OD254 values. Ribosome fractions separated by sucrose gradient sedimentation were pooled and digested with E. coli RNase I (Ambion, 750 U per 100 A260 units) by incubation at 4 °C for 1 hr. SUPERase•In (50 U per 100 U RNase I) was then added into the reaction mixture to stop the digestion. Total RNA was extracted using TRIzol LS reagent. Fragmented RNAs were separated on a 15% polyacrylamide TBE-urea gel (Invitrogen) and visualized using SYBR Gold (Invitrogen). Selected regions of the gel corresponding to 20-70 nt (for 40S-seq and eIF3-seq) or 25-35 nt (for Ribo-seq) were excised. The gel slices were disrupted by using centrifugation through the holes at the bottom of the tube. RNA fragments were dissolved by soaking overnight in 400 µl RNA gel elution buffer (300 mM NaOAc pH 5.5, 1 mM EDTA, 0.1 U/µl SUPERase•In). The gel debris was removed using a Spin-X column (Corning), followed by ethanol precipitation.   Purified RNA fragments were re-suspended in Nuclease-free water, then dephosphorylated for 1 hr at 37 °C in a 15 µl reaction (1× T4 polynucleotide kinase buffer, 10 U SUPERase•In and 20 U T4 polynucleotide kinase). Dephosphorylated RNA fragments were precipitated using ethanol and re-suspended in Nuclease-free water. 0.15 μg linker (rApp/NNNNCTGTAGGCACCATCAAT/3ddC) then was added to the RNA fragments, heated at 70 °C for 90 s and then cooled to room temperature, followed by ligation for 3 hr at at 22 °C in a 20 µl reaction (1× T4 Rnl2 reaction buffer, 10 U SUPERase•In, 15% PEG8000 and 20 U T4 RNA ligase 2 truncated). The reaction was heat inactivated at 80 °C for 10 min and the products were separated on a 10% polyacrylamide TBE-urea gel and selected regions in the gel corresponding to 45-95 nt (for 40S-seq and eIF3-seq) or 60-70 nt (for Ribo-seq) were excised. RNA fragments were dissolved by soaking overnight in 400 μl RNA gel elution buffer. RNA fragments were purified from RNA gel elution buffer as described earlier and re-suspended in Nuclease-free water. For reverse transcription, the following oligos containing barcodes were used:   (Phos)CTANNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)AGCNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)ATTNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)CCGNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  where Phos represents phosphorylation, NNN represents random sequence, SpC18 represents Hexa-ethyleneglycol spacer.  The linker ligated RNA sample was mixed with 0.5 mM dNTP and 2.5 mM synthesized primer and incubated at 75 ° C for 3 min, followed by incubation on ice for at least 1 min. The reaction master mix was then added with 20 mM Tris (pH 8.4), 50 mM KCl, 5 mM MgCl2, 10 mM DTT, 40 U RNaseOUT and 200 U SuperScript III. Reverse transcription reaction was performed according to the manufacturer's instruction. Reverse transcription products were separated on a 10% polyacrylamide TBE-urea gel. Corresponding region was excised, which was expected to be approximately 200 nt. The first-strand cDNA products were recovered in DNA gel elution buffer (300 mM NaCl, 1 mM EDTA), then purified and re-suspended in Nuclease-free water as described earlier.  cDNA products were circularized in 20 μl of reaction containing 1×CircLigase buffer, 2.5 mM MnCl2, 1M Betaine and 100 U CircLigase II (Epicentre). Circularization was performed at 60 °C for 1 hr and the reaction was heat inactivated at 80 °C for 10 min.</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>Illumina HiSeq 2500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>305482349</ID>
          <LABEL>GSM5482349</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
    <EXPERIMENT_ATTRIBUTES>
      <EXPERIMENT_ATTRIBUTE>
        <TAG>GEO Accession</TAG>
        <VALUE>GSM5482349</VALUE>
      </EXPERIMENT_ATTRIBUTE>
    </EXPERIMENT_ATTRIBUTES>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM5482350" accession="SRX11588503">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX11588503</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM5482350</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM5482350: Ribo-seq_ThiametG_rep2; Mus musculus; OTHER</TITLE>
    <STUDY_REF accession="SRP330265" refname="GSE181040">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP330265</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS9622982">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS9622982</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM5482350</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>OTHER</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>other</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <SINGLE/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>For cell lysates, at least four 10 cm dishes of cells were harvested in 400 µl ice-cold polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2). Cells were then disrupted by vortexing six times for 20s using lysing matrix D (Fisher), followed by a 40 s interval each time on ice, then centrifuged at 12,000g, 4 °C for 10 min. Samples were then subjected to sucrose gradient sedimentation. Sucrose solutions were prepared in polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2 and 2% Triton X-100). A 15%-45% (w/v) sucrose density gradients were freshly prepared in SW41 ultracentrifuge tubes (Backman) using a Gradient Master (BioComp Instruments). 500 µl of supernatant from cell lysates prepared as described above was loaded onto sucrose gradients followed by centrifugation for 2.5 hr at 32,000 rpm, 4 °C in a SW41 rotor. Separated samples were fractionated at 1.5 ml min-1 through an automated fractionation system (Isco) that continually monitors OD254 values. Ribosome fractions separated by sucrose gradient sedimentation were pooled and digested with E. coli RNase I (Ambion, 750 U per 100 A260 units) by incubation at 4 °C for 1 hr. SUPERase•In (50 U per 100 U RNase I) was then added into the reaction mixture to stop the digestion. Total RNA was extracted using TRIzol LS reagent. Fragmented RNAs were separated on a 15% polyacrylamide TBE-urea gel (Invitrogen) and visualized using SYBR Gold (Invitrogen). Selected regions of the gel corresponding to 20-70 nt (for 40S-seq and eIF3-seq) or 25-35 nt (for Ribo-seq) were excised. The gel slices were disrupted by using centrifugation through the holes at the bottom of the tube. RNA fragments were dissolved by soaking overnight in 400 µl RNA gel elution buffer (300 mM NaOAc pH 5.5, 1 mM EDTA, 0.1 U/µl SUPERase•In). The gel debris was removed using a Spin-X column (Corning), followed by ethanol precipitation.   Purified RNA fragments were re-suspended in Nuclease-free water, then dephosphorylated for 1 hr at 37 °C in a 15 µl reaction (1× T4 polynucleotide kinase buffer, 10 U SUPERase•In and 20 U T4 polynucleotide kinase). Dephosphorylated RNA fragments were precipitated using ethanol and re-suspended in Nuclease-free water. 0.15 μg linker (rApp/NNNNCTGTAGGCACCATCAAT/3ddC) then was added to the RNA fragments, heated at 70 °C for 90 s and then cooled to room temperature, followed by ligation for 3 hr at at 22 °C in a 20 µl reaction (1× T4 Rnl2 reaction buffer, 10 U SUPERase•In, 15% PEG8000 and 20 U T4 RNA ligase 2 truncated). The reaction was heat inactivated at 80 °C for 10 min and the products were separated on a 10% polyacrylamide TBE-urea gel and selected regions in the gel corresponding to 45-95 nt (for 40S-seq and eIF3-seq) or 60-70 nt (for Ribo-seq) were excised. RNA fragments were dissolved by soaking overnight in 400 μl RNA gel elution buffer. RNA fragments were purified from RNA gel elution buffer as described earlier and re-suspended in Nuclease-free water. For reverse transcription, the following oligos containing barcodes were used:   (Phos)CTANNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)AGCNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)ATTNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)CCGNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  where Phos represents phosphorylation, NNN represents random sequence, SpC18 represents Hexa-ethyleneglycol spacer.  The linker ligated RNA sample was mixed with 0.5 mM dNTP and 2.5 mM synthesized primer and incubated at 75 ° C for 3 min, followed by incubation on ice for at least 1 min. The reaction master mix was then added with 20 mM Tris (pH 8.4), 50 mM KCl, 5 mM MgCl2, 10 mM DTT, 40 U RNaseOUT and 200 U SuperScript III. Reverse transcription reaction was performed according to the manufacturer's instruction. Reverse transcription products were separated on a 10% polyacrylamide TBE-urea gel. Corresponding region was excised, which was expected to be approximately 200 nt. The first-strand cDNA products were recovered in DNA gel elution buffer (300 mM NaCl, 1 mM EDTA), then purified and re-suspended in Nuclease-free water as described earlier.  cDNA products were circularized in 20 μl of reaction containing 1×CircLigase buffer, 2.5 mM MnCl2, 1M Betaine and 100 U CircLigase II (Epicentre). Circularization was performed at 60 °C for 1 hr and the reaction was heat inactivated at 80 °C for 10 min.</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>Illumina HiSeq 2500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>305482350</ID>
          <LABEL>GSM5482350</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
    <EXPERIMENT_ATTRIBUTES>
      <EXPERIMENT_ATTRIBUTE>
        <TAG>GEO Accession</TAG>
        <VALUE>GSM5482350</VALUE>
      </EXPERIMENT_ATTRIBUTE>
    </EXPERIMENT_ATTRIBUTES>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM5482351" accession="SRX11588504">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX11588504</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM5482351</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM5482351: Ribo-seq_ThiametG_Starvation_rep1; Mus musculus; OTHER</TITLE>
    <STUDY_REF accession="SRP330265" refname="GSE181040">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP330265</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS9622983">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS9622983</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM5482351</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>OTHER</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>other</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <SINGLE/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>For cell lysates, at least four 10 cm dishes of cells were harvested in 400 µl ice-cold polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2). Cells were then disrupted by vortexing six times for 20s using lysing matrix D (Fisher), followed by a 40 s interval each time on ice, then centrifuged at 12,000g, 4 °C for 10 min. Samples were then subjected to sucrose gradient sedimentation. Sucrose solutions were prepared in polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2 and 2% Triton X-100). A 15%-45% (w/v) sucrose density gradients were freshly prepared in SW41 ultracentrifuge tubes (Backman) using a Gradient Master (BioComp Instruments). 500 µl of supernatant from cell lysates prepared as described above was loaded onto sucrose gradients followed by centrifugation for 2.5 hr at 32,000 rpm, 4 °C in a SW41 rotor. Separated samples were fractionated at 1.5 ml min-1 through an automated fractionation system (Isco) that continually monitors OD254 values. Ribosome fractions separated by sucrose gradient sedimentation were pooled and digested with E. coli RNase I (Ambion, 750 U per 100 A260 units) by incubation at 4 °C for 1 hr. SUPERase•In (50 U per 100 U RNase I) was then added into the reaction mixture to stop the digestion. Total RNA was extracted using TRIzol LS reagent. Fragmented RNAs were separated on a 15% polyacrylamide TBE-urea gel (Invitrogen) and visualized using SYBR Gold (Invitrogen). Selected regions of the gel corresponding to 20-70 nt (for 40S-seq and eIF3-seq) or 25-35 nt (for Ribo-seq) were excised. The gel slices were disrupted by using centrifugation through the holes at the bottom of the tube. RNA fragments were dissolved by soaking overnight in 400 µl RNA gel elution buffer (300 mM NaOAc pH 5.5, 1 mM EDTA, 0.1 U/µl SUPERase•In). The gel debris was removed using a Spin-X column (Corning), followed by ethanol precipitation.   Purified RNA fragments were re-suspended in Nuclease-free water, then dephosphorylated for 1 hr at 37 °C in a 15 µl reaction (1× T4 polynucleotide kinase buffer, 10 U SUPERase•In and 20 U T4 polynucleotide kinase). Dephosphorylated RNA fragments were precipitated using ethanol and re-suspended in Nuclease-free water. 0.15 μg linker (rApp/NNNNCTGTAGGCACCATCAAT/3ddC) then was added to the RNA fragments, heated at 70 °C for 90 s and then cooled to room temperature, followed by ligation for 3 hr at at 22 °C in a 20 µl reaction (1× T4 Rnl2 reaction buffer, 10 U SUPERase•In, 15% PEG8000 and 20 U T4 RNA ligase 2 truncated). The reaction was heat inactivated at 80 °C for 10 min and the products were separated on a 10% polyacrylamide TBE-urea gel and selected regions in the gel corresponding to 45-95 nt (for 40S-seq and eIF3-seq) or 60-70 nt (for Ribo-seq) were excised. RNA fragments were dissolved by soaking overnight in 400 μl RNA gel elution buffer. RNA fragments were purified from RNA gel elution buffer as described earlier and re-suspended in Nuclease-free water. For reverse transcription, the following oligos containing barcodes were used:   (Phos)CTANNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)AGCNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)ATTNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)CCGNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  where Phos represents phosphorylation, NNN represents random sequence, SpC18 represents Hexa-ethyleneglycol spacer.  The linker ligated RNA sample was mixed with 0.5 mM dNTP and 2.5 mM synthesized primer and incubated at 75 ° C for 3 min, followed by incubation on ice for at least 1 min. The reaction master mix was then added with 20 mM Tris (pH 8.4), 50 mM KCl, 5 mM MgCl2, 10 mM DTT, 40 U RNaseOUT and 200 U SuperScript III. Reverse transcription reaction was performed according to the manufacturer's instruction. Reverse transcription products were separated on a 10% polyacrylamide TBE-urea gel. Corresponding region was excised, which was expected to be approximately 200 nt. The first-strand cDNA products were recovered in DNA gel elution buffer (300 mM NaCl, 1 mM EDTA), then purified and re-suspended in Nuclease-free water as described earlier.  cDNA products were circularized in 20 μl of reaction containing 1×CircLigase buffer, 2.5 mM MnCl2, 1M Betaine and 100 U CircLigase II (Epicentre). Circularization was performed at 60 °C for 1 hr and the reaction was heat inactivated at 80 °C for 10 min.</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>Illumina HiSeq 2500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>305482351</ID>
          <LABEL>GSM5482351</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
    <EXPERIMENT_ATTRIBUTES>
      <EXPERIMENT_ATTRIBUTE>
        <TAG>GEO Accession</TAG>
        <VALUE>GSM5482351</VALUE>
      </EXPERIMENT_ATTRIBUTE>
    </EXPERIMENT_ATTRIBUTES>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM5482352" accession="SRX11588505">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX11588505</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM5482352</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM5482352: Ribo-seq_ThiametG_Starvation_rep2; Mus musculus; OTHER</TITLE>
    <STUDY_REF accession="SRP330265" refname="GSE181040">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP330265</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS9622984">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS9622984</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM5482352</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>OTHER</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>other</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <SINGLE/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>For cell lysates, at least four 10 cm dishes of cells were harvested in 400 µl ice-cold polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2). Cells were then disrupted by vortexing six times for 20s using lysing matrix D (Fisher), followed by a 40 s interval each time on ice, then centrifuged at 12,000g, 4 °C for 10 min. Samples were then subjected to sucrose gradient sedimentation. Sucrose solutions were prepared in polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2 and 2% Triton X-100). A 15%-45% (w/v) sucrose density gradients were freshly prepared in SW41 ultracentrifuge tubes (Backman) using a Gradient Master (BioComp Instruments). 500 µl of supernatant from cell lysates prepared as described above was loaded onto sucrose gradients followed by centrifugation for 2.5 hr at 32,000 rpm, 4 °C in a SW41 rotor. Separated samples were fractionated at 1.5 ml min-1 through an automated fractionation system (Isco) that continually monitors OD254 values. Ribosome fractions separated by sucrose gradient sedimentation were pooled and digested with E. coli RNase I (Ambion, 750 U per 100 A260 units) by incubation at 4 °C for 1 hr. SUPERase•In (50 U per 100 U RNase I) was then added into the reaction mixture to stop the digestion. Total RNA was extracted using TRIzol LS reagent. Fragmented RNAs were separated on a 15% polyacrylamide TBE-urea gel (Invitrogen) and visualized using SYBR Gold (Invitrogen). Selected regions of the gel corresponding to 20-70 nt (for 40S-seq and eIF3-seq) or 25-35 nt (for Ribo-seq) were excised. The gel slices were disrupted by using centrifugation through the holes at the bottom of the tube. RNA fragments were dissolved by soaking overnight in 400 µl RNA gel elution buffer (300 mM NaOAc pH 5.5, 1 mM EDTA, 0.1 U/µl SUPERase•In). The gel debris was removed using a Spin-X column (Corning), followed by ethanol precipitation.   Purified RNA fragments were re-suspended in Nuclease-free water, then dephosphorylated for 1 hr at 37 °C in a 15 µl reaction (1× T4 polynucleotide kinase buffer, 10 U SUPERase•In and 20 U T4 polynucleotide kinase). Dephosphorylated RNA fragments were precipitated using ethanol and re-suspended in Nuclease-free water. 0.15 μg linker (rApp/NNNNCTGTAGGCACCATCAAT/3ddC) then was added to the RNA fragments, heated at 70 °C for 90 s and then cooled to room temperature, followed by ligation for 3 hr at at 22 °C in a 20 µl reaction (1× T4 Rnl2 reaction buffer, 10 U SUPERase•In, 15% PEG8000 and 20 U T4 RNA ligase 2 truncated). The reaction was heat inactivated at 80 °C for 10 min and the products were separated on a 10% polyacrylamide TBE-urea gel and selected regions in the gel corresponding to 45-95 nt (for 40S-seq and eIF3-seq) or 60-70 nt (for Ribo-seq) were excised. RNA fragments were dissolved by soaking overnight in 400 μl RNA gel elution buffer. RNA fragments were purified from RNA gel elution buffer as described earlier and re-suspended in Nuclease-free water. For reverse transcription, the following oligos containing barcodes were used:   (Phos)CTANNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)AGCNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)ATTNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)CCGNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  where Phos represents phosphorylation, NNN represents random sequence, SpC18 represents Hexa-ethyleneglycol spacer.  The linker ligated RNA sample was mixed with 0.5 mM dNTP and 2.5 mM synthesized primer and incubated at 75 ° C for 3 min, followed by incubation on ice for at least 1 min. The reaction master mix was then added with 20 mM Tris (pH 8.4), 50 mM KCl, 5 mM MgCl2, 10 mM DTT, 40 U RNaseOUT and 200 U SuperScript III. Reverse transcription reaction was performed according to the manufacturer's instruction. Reverse transcription products were separated on a 10% polyacrylamide TBE-urea gel. Corresponding region was excised, which was expected to be approximately 200 nt. The first-strand cDNA products were recovered in DNA gel elution buffer (300 mM NaCl, 1 mM EDTA), then purified and re-suspended in Nuclease-free water as described earlier.  cDNA products were circularized in 20 μl of reaction containing 1×CircLigase buffer, 2.5 mM MnCl2, 1M Betaine and 100 U CircLigase II (Epicentre). Circularization was performed at 60 °C for 1 hr and the reaction was heat inactivated at 80 °C for 10 min.</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>Illumina HiSeq 2500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>305482352</ID>
          <LABEL>GSM5482352</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
    <EXPERIMENT_ATTRIBUTES>
      <EXPERIMENT_ATTRIBUTE>
        <TAG>GEO Accession</TAG>
        <VALUE>GSM5482352</VALUE>
      </EXPERIMENT_ATTRIBUTE>
    </EXPERIMENT_ATTRIBUTES>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM5482353" accession="SRX11588506">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX11588506</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM5482353</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM5482353: eIF3-80S_Control_rep1; Mus musculus; OTHER</TITLE>
    <STUDY_REF accession="SRP330265" refname="GSE181040">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP330265</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS9622985">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS9622985</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM5482353</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>OTHER</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>other</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <SINGLE/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>For cell lysates, at least four 10 cm dishes of cells were harvested in 400 µl ice-cold polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2). Cells were then disrupted by vortexing six times for 20s using lysing matrix D (Fisher), followed by a 40 s interval each time on ice, then centrifuged at 12,000g, 4 °C for 10 min. Samples were then subjected to sucrose gradient sedimentation. Sucrose solutions were prepared in polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2 and 2% Triton X-100). A 15%-45% (w/v) sucrose density gradients were freshly prepared in SW41 ultracentrifuge tubes (Backman) using a Gradient Master (BioComp Instruments). 500 µl of supernatant from cell lysates prepared as described above was loaded onto sucrose gradients followed by centrifugation for 2.5 hr at 32,000 rpm, 4 °C in a SW41 rotor. Separated samples were fractionated at 1.5 ml min-1 through an automated fractionation system (Isco) that continually monitors OD254 values. Ribosome fractions separated by sucrose gradient sedimentation were pooled and digested with E. coli RNase I (Ambion, 750 U per 100 A260 units) by incubation at 4 °C for 1 hr. SUPERase•In (50 U per 100 U RNase I) was then added into the reaction mixture to stop the digestion. Total RNA was extracted using TRIzol LS reagent. Fragmented RNAs were separated on a 15% polyacrylamide TBE-urea gel (Invitrogen) and visualized using SYBR Gold (Invitrogen). Selected regions of the gel corresponding to 20-70 nt (for 40S-seq and eIF3-seq) or 25-35 nt (for Ribo-seq) were excised. The gel slices were disrupted by using centrifugation through the holes at the bottom of the tube. RNA fragments were dissolved by soaking overnight in 400 µl RNA gel elution buffer (300 mM NaOAc pH 5.5, 1 mM EDTA, 0.1 U/µl SUPERase•In). The gel debris was removed using a Spin-X column (Corning), followed by ethanol precipitation.   Purified RNA fragments were re-suspended in Nuclease-free water, then dephosphorylated for 1 hr at 37 °C in a 15 µl reaction (1× T4 polynucleotide kinase buffer, 10 U SUPERase•In and 20 U T4 polynucleotide kinase). Dephosphorylated RNA fragments were precipitated using ethanol and re-suspended in Nuclease-free water. 0.15 μg linker (rApp/NNNNCTGTAGGCACCATCAAT/3ddC) then was added to the RNA fragments, heated at 70 °C for 90 s and then cooled to room temperature, followed by ligation for 3 hr at at 22 °C in a 20 µl reaction (1× T4 Rnl2 reaction buffer, 10 U SUPERase•In, 15% PEG8000 and 20 U T4 RNA ligase 2 truncated). The reaction was heat inactivated at 80 °C for 10 min and the products were separated on a 10% polyacrylamide TBE-urea gel and selected regions in the gel corresponding to 45-95 nt (for 40S-seq and eIF3-seq) or 60-70 nt (for Ribo-seq) were excised. RNA fragments were dissolved by soaking overnight in 400 μl RNA gel elution buffer. RNA fragments were purified from RNA gel elution buffer as described earlier and re-suspended in Nuclease-free water. For reverse transcription, the following oligos containing barcodes were used:   (Phos)CTANNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)AGCNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)ATTNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)CCGNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  where Phos represents phosphorylation, NNN represents random sequence, SpC18 represents Hexa-ethyleneglycol spacer.  The linker ligated RNA sample was mixed with 0.5 mM dNTP and 2.5 mM synthesized primer and incubated at 75 ° C for 3 min, followed by incubation on ice for at least 1 min. The reaction master mix was then added with 20 mM Tris (pH 8.4), 50 mM KCl, 5 mM MgCl2, 10 mM DTT, 40 U RNaseOUT and 200 U SuperScript III. Reverse transcription reaction was performed according to the manufacturer's instruction. Reverse transcription products were separated on a 10% polyacrylamide TBE-urea gel. Corresponding region was excised, which was expected to be approximately 200 nt. The first-strand cDNA products were recovered in DNA gel elution buffer (300 mM NaCl, 1 mM EDTA), then purified and re-suspended in Nuclease-free water as described earlier.  cDNA products were circularized in 20 μl of reaction containing 1×CircLigase buffer, 2.5 mM MnCl2, 1M Betaine and 100 U CircLigase II (Epicentre). Circularization was performed at 60 °C for 1 hr and the reaction was heat inactivated at 80 °C for 10 min.</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>Illumina HiSeq 2500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>305482353</ID>
          <LABEL>GSM5482353</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
    <EXPERIMENT_ATTRIBUTES>
      <EXPERIMENT_ATTRIBUTE>
        <TAG>GEO Accession</TAG>
        <VALUE>GSM5482353</VALUE>
      </EXPERIMENT_ATTRIBUTE>
    </EXPERIMENT_ATTRIBUTES>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM5482354" accession="SRX11588507">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX11588507</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM5482354</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM5482354: eIF3-80S_Control_rep2; Mus musculus; OTHER</TITLE>
    <STUDY_REF accession="SRP330265" refname="GSE181040">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP330265</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS9622986">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS9622986</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM5482354</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>OTHER</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>other</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <SINGLE/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>For cell lysates, at least four 10 cm dishes of cells were harvested in 400 µl ice-cold polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2). Cells were then disrupted by vortexing six times for 20s using lysing matrix D (Fisher), followed by a 40 s interval each time on ice, then centrifuged at 12,000g, 4 °C for 10 min. Samples were then subjected to sucrose gradient sedimentation. Sucrose solutions were prepared in polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2 and 2% Triton X-100). A 15%-45% (w/v) sucrose density gradients were freshly prepared in SW41 ultracentrifuge tubes (Backman) using a Gradient Master (BioComp Instruments). 500 µl of supernatant from cell lysates prepared as described above was loaded onto sucrose gradients followed by centrifugation for 2.5 hr at 32,000 rpm, 4 °C in a SW41 rotor. Separated samples were fractionated at 1.5 ml min-1 through an automated fractionation system (Isco) that continually monitors OD254 values. Ribosome fractions separated by sucrose gradient sedimentation were pooled and digested with E. coli RNase I (Ambion, 750 U per 100 A260 units) by incubation at 4 °C for 1 hr. SUPERase•In (50 U per 100 U RNase I) was then added into the reaction mixture to stop the digestion. Total RNA was extracted using TRIzol LS reagent. Fragmented RNAs were separated on a 15% polyacrylamide TBE-urea gel (Invitrogen) and visualized using SYBR Gold (Invitrogen). Selected regions of the gel corresponding to 20-70 nt (for 40S-seq and eIF3-seq) or 25-35 nt (for Ribo-seq) were excised. The gel slices were disrupted by using centrifugation through the holes at the bottom of the tube. RNA fragments were dissolved by soaking overnight in 400 µl RNA gel elution buffer (300 mM NaOAc pH 5.5, 1 mM EDTA, 0.1 U/µl SUPERase•In). The gel debris was removed using a Spin-X column (Corning), followed by ethanol precipitation.   Purified RNA fragments were re-suspended in Nuclease-free water, then dephosphorylated for 1 hr at 37 °C in a 15 µl reaction (1× T4 polynucleotide kinase buffer, 10 U SUPERase•In and 20 U T4 polynucleotide kinase). Dephosphorylated RNA fragments were precipitated using ethanol and re-suspended in Nuclease-free water. 0.15 μg linker (rApp/NNNNCTGTAGGCACCATCAAT/3ddC) then was added to the RNA fragments, heated at 70 °C for 90 s and then cooled to room temperature, followed by ligation for 3 hr at at 22 °C in a 20 µl reaction (1× T4 Rnl2 reaction buffer, 10 U SUPERase•In, 15% PEG8000 and 20 U T4 RNA ligase 2 truncated). The reaction was heat inactivated at 80 °C for 10 min and the products were separated on a 10% polyacrylamide TBE-urea gel and selected regions in the gel corresponding to 45-95 nt (for 40S-seq and eIF3-seq) or 60-70 nt (for Ribo-seq) were excised. RNA fragments were dissolved by soaking overnight in 400 μl RNA gel elution buffer. RNA fragments were purified from RNA gel elution buffer as described earlier and re-suspended in Nuclease-free water. For reverse transcription, the following oligos containing barcodes were used:   (Phos)CTANNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)AGCNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)ATTNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)CCGNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  where Phos represents phosphorylation, NNN represents random sequence, SpC18 represents Hexa-ethyleneglycol spacer.  The linker ligated RNA sample was mixed with 0.5 mM dNTP and 2.5 mM synthesized primer and incubated at 75 ° C for 3 min, followed by incubation on ice for at least 1 min. The reaction master mix was then added with 20 mM Tris (pH 8.4), 50 mM KCl, 5 mM MgCl2, 10 mM DTT, 40 U RNaseOUT and 200 U SuperScript III. Reverse transcription reaction was performed according to the manufacturer's instruction. Reverse transcription products were separated on a 10% polyacrylamide TBE-urea gel. Corresponding region was excised, which was expected to be approximately 200 nt. The first-strand cDNA products were recovered in DNA gel elution buffer (300 mM NaCl, 1 mM EDTA), then purified and re-suspended in Nuclease-free water as described earlier.  cDNA products were circularized in 20 μl of reaction containing 1×CircLigase buffer, 2.5 mM MnCl2, 1M Betaine and 100 U CircLigase II (Epicentre). Circularization was performed at 60 °C for 1 hr and the reaction was heat inactivated at 80 °C for 10 min.</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>Illumina HiSeq 2500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>305482354</ID>
          <LABEL>GSM5482354</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
    <EXPERIMENT_ATTRIBUTES>
      <EXPERIMENT_ATTRIBUTE>
        <TAG>GEO Accession</TAG>
        <VALUE>GSM5482354</VALUE>
      </EXPERIMENT_ATTRIBUTE>
    </EXPERIMENT_ATTRIBUTES>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM5482355" accession="SRX11588508">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX11588508</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM5482355</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM5482355: eIF3-80S_Starv_rep1; Mus musculus; OTHER</TITLE>
    <STUDY_REF accession="SRP330265" refname="GSE181040">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP330265</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS9622988">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS9622988</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM5482355</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>OTHER</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>other</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <SINGLE/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>For cell lysates, at least four 10 cm dishes of cells were harvested in 400 µl ice-cold polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2). Cells were then disrupted by vortexing six times for 20s using lysing matrix D (Fisher), followed by a 40 s interval each time on ice, then centrifuged at 12,000g, 4 °C for 10 min. Samples were then subjected to sucrose gradient sedimentation. Sucrose solutions were prepared in polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2 and 2% Triton X-100). A 15%-45% (w/v) sucrose density gradients were freshly prepared in SW41 ultracentrifuge tubes (Backman) using a Gradient Master (BioComp Instruments). 500 µl of supernatant from cell lysates prepared as described above was loaded onto sucrose gradients followed by centrifugation for 2.5 hr at 32,000 rpm, 4 °C in a SW41 rotor. Separated samples were fractionated at 1.5 ml min-1 through an automated fractionation system (Isco) that continually monitors OD254 values. Ribosome fractions separated by sucrose gradient sedimentation were pooled and digested with E. coli RNase I (Ambion, 750 U per 100 A260 units) by incubation at 4 °C for 1 hr. SUPERase•In (50 U per 100 U RNase I) was then added into the reaction mixture to stop the digestion. Total RNA was extracted using TRIzol LS reagent. Fragmented RNAs were separated on a 15% polyacrylamide TBE-urea gel (Invitrogen) and visualized using SYBR Gold (Invitrogen). Selected regions of the gel corresponding to 20-70 nt (for 40S-seq and eIF3-seq) or 25-35 nt (for Ribo-seq) were excised. The gel slices were disrupted by using centrifugation through the holes at the bottom of the tube. RNA fragments were dissolved by soaking overnight in 400 µl RNA gel elution buffer (300 mM NaOAc pH 5.5, 1 mM EDTA, 0.1 U/µl SUPERase•In). The gel debris was removed using a Spin-X column (Corning), followed by ethanol precipitation.   Purified RNA fragments were re-suspended in Nuclease-free water, then dephosphorylated for 1 hr at 37 °C in a 15 µl reaction (1× T4 polynucleotide kinase buffer, 10 U SUPERase•In and 20 U T4 polynucleotide kinase). Dephosphorylated RNA fragments were precipitated using ethanol and re-suspended in Nuclease-free water. 0.15 μg linker (rApp/NNNNCTGTAGGCACCATCAAT/3ddC) then was added to the RNA fragments, heated at 70 °C for 90 s and then cooled to room temperature, followed by ligation for 3 hr at at 22 °C in a 20 µl reaction (1× T4 Rnl2 reaction buffer, 10 U SUPERase•In, 15% PEG8000 and 20 U T4 RNA ligase 2 truncated). The reaction was heat inactivated at 80 °C for 10 min and the products were separated on a 10% polyacrylamide TBE-urea gel and selected regions in the gel corresponding to 45-95 nt (for 40S-seq and eIF3-seq) or 60-70 nt (for Ribo-seq) were excised. RNA fragments were dissolved by soaking overnight in 400 μl RNA gel elution buffer. RNA fragments were purified from RNA gel elution buffer as described earlier and re-suspended in Nuclease-free water. For reverse transcription, the following oligos containing barcodes were used:   (Phos)CTANNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)AGCNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)ATTNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)CCGNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  where Phos represents phosphorylation, NNN represents random sequence, SpC18 represents Hexa-ethyleneglycol spacer.  The linker ligated RNA sample was mixed with 0.5 mM dNTP and 2.5 mM synthesized primer and incubated at 75 ° C for 3 min, followed by incubation on ice for at least 1 min. The reaction master mix was then added with 20 mM Tris (pH 8.4), 50 mM KCl, 5 mM MgCl2, 10 mM DTT, 40 U RNaseOUT and 200 U SuperScript III. Reverse transcription reaction was performed according to the manufacturer's instruction. Reverse transcription products were separated on a 10% polyacrylamide TBE-urea gel. Corresponding region was excised, which was expected to be approximately 200 nt. The first-strand cDNA products were recovered in DNA gel elution buffer (300 mM NaCl, 1 mM EDTA), then purified and re-suspended in Nuclease-free water as described earlier.  cDNA products were circularized in 20 μl of reaction containing 1×CircLigase buffer, 2.5 mM MnCl2, 1M Betaine and 100 U CircLigase II (Epicentre). Circularization was performed at 60 °C for 1 hr and the reaction was heat inactivated at 80 °C for 10 min.</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>Illumina HiSeq 2500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>305482355</ID>
          <LABEL>GSM5482355</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
    <EXPERIMENT_ATTRIBUTES>
      <EXPERIMENT_ATTRIBUTE>
        <TAG>GEO Accession</TAG>
        <VALUE>GSM5482355</VALUE>
      </EXPERIMENT_ATTRIBUTE>
    </EXPERIMENT_ATTRIBUTES>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM5482356" accession="SRX11588509">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX11588509</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM5482356</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM5482356: eIF3-80S_Starv_rep2; Mus musculus; OTHER</TITLE>
    <STUDY_REF accession="SRP330265" refname="GSE181040">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP330265</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS9622987">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS9622987</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM5482356</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>OTHER</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>other</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <SINGLE/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>For cell lysates, at least four 10 cm dishes of cells were harvested in 400 µl ice-cold polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2). Cells were then disrupted by vortexing six times for 20s using lysing matrix D (Fisher), followed by a 40 s interval each time on ice, then centrifuged at 12,000g, 4 °C for 10 min. Samples were then subjected to sucrose gradient sedimentation. Sucrose solutions were prepared in polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2 and 2% Triton X-100). A 15%-45% (w/v) sucrose density gradients were freshly prepared in SW41 ultracentrifuge tubes (Backman) using a Gradient Master (BioComp Instruments). 500 µl of supernatant from cell lysates prepared as described above was loaded onto sucrose gradients followed by centrifugation for 2.5 hr at 32,000 rpm, 4 °C in a SW41 rotor. Separated samples were fractionated at 1.5 ml min-1 through an automated fractionation system (Isco) that continually monitors OD254 values. Ribosome fractions separated by sucrose gradient sedimentation were pooled and digested with E. coli RNase I (Ambion, 750 U per 100 A260 units) by incubation at 4 °C for 1 hr. SUPERase•In (50 U per 100 U RNase I) was then added into the reaction mixture to stop the digestion. Total RNA was extracted using TRIzol LS reagent. Fragmented RNAs were separated on a 15% polyacrylamide TBE-urea gel (Invitrogen) and visualized using SYBR Gold (Invitrogen). Selected regions of the gel corresponding to 20-70 nt (for 40S-seq and eIF3-seq) or 25-35 nt (for Ribo-seq) were excised. The gel slices were disrupted by using centrifugation through the holes at the bottom of the tube. RNA fragments were dissolved by soaking overnight in 400 µl RNA gel elution buffer (300 mM NaOAc pH 5.5, 1 mM EDTA, 0.1 U/µl SUPERase•In). The gel debris was removed using a Spin-X column (Corning), followed by ethanol precipitation.   Purified RNA fragments were re-suspended in Nuclease-free water, then dephosphorylated for 1 hr at 37 °C in a 15 µl reaction (1× T4 polynucleotide kinase buffer, 10 U SUPERase•In and 20 U T4 polynucleotide kinase). Dephosphorylated RNA fragments were precipitated using ethanol and re-suspended in Nuclease-free water. 0.15 μg linker (rApp/NNNNCTGTAGGCACCATCAAT/3ddC) then was added to the RNA fragments, heated at 70 °C for 90 s and then cooled to room temperature, followed by ligation for 3 hr at at 22 °C in a 20 µl reaction (1× T4 Rnl2 reaction buffer, 10 U SUPERase•In, 15% PEG8000 and 20 U T4 RNA ligase 2 truncated). The reaction was heat inactivated at 80 °C for 10 min and the products were separated on a 10% polyacrylamide TBE-urea gel and selected regions in the gel corresponding to 45-95 nt (for 40S-seq and eIF3-seq) or 60-70 nt (for Ribo-seq) were excised. RNA fragments were dissolved by soaking overnight in 400 μl RNA gel elution buffer. RNA fragments were purified from RNA gel elution buffer as described earlier and re-suspended in Nuclease-free water. For reverse transcription, the following oligos containing barcodes were used:   (Phos)CTANNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)AGCNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)ATTNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)CCGNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  where Phos represents phosphorylation, NNN represents random sequence, SpC18 represents Hexa-ethyleneglycol spacer.  The linker ligated RNA sample was mixed with 0.5 mM dNTP and 2.5 mM synthesized primer and incubated at 75 ° C for 3 min, followed by incubation on ice for at least 1 min. The reaction master mix was then added with 20 mM Tris (pH 8.4), 50 mM KCl, 5 mM MgCl2, 10 mM DTT, 40 U RNaseOUT and 200 U SuperScript III. Reverse transcription reaction was performed according to the manufacturer's instruction. Reverse transcription products were separated on a 10% polyacrylamide TBE-urea gel. Corresponding region was excised, which was expected to be approximately 200 nt. The first-strand cDNA products were recovered in DNA gel elution buffer (300 mM NaCl, 1 mM EDTA), then purified and re-suspended in Nuclease-free water as described earlier.  cDNA products were circularized in 20 μl of reaction containing 1×CircLigase buffer, 2.5 mM MnCl2, 1M Betaine and 100 U CircLigase II (Epicentre). Circularization was performed at 60 °C for 1 hr and the reaction was heat inactivated at 80 °C for 10 min.</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>Illumina HiSeq 2500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>305482356</ID>
          <LABEL>GSM5482356</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
    <EXPERIMENT_ATTRIBUTES>
      <EXPERIMENT_ATTRIBUTE>
        <TAG>GEO Accession</TAG>
        <VALUE>GSM5482356</VALUE>
      </EXPERIMENT_ATTRIBUTE>
    </EXPERIMENT_ATTRIBUTES>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM5482357" accession="SRX11588510">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX11588510</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM5482357</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM5482357: eIF3-80S_OGT_KO_rep1; Mus musculus; OTHER</TITLE>
    <STUDY_REF accession="SRP330265" refname="GSE181040">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP330265</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS9622989">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS9622989</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM5482357</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>OTHER</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>other</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <SINGLE/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>For cell lysates, at least four 10 cm dishes of cells were harvested in 400 µl ice-cold polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2). Cells were then disrupted by vortexing six times for 20s using lysing matrix D (Fisher), followed by a 40 s interval each time on ice, then centrifuged at 12,000g, 4 °C for 10 min. Samples were then subjected to sucrose gradient sedimentation. Sucrose solutions were prepared in polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2 and 2% Triton X-100). A 15%-45% (w/v) sucrose density gradients were freshly prepared in SW41 ultracentrifuge tubes (Backman) using a Gradient Master (BioComp Instruments). 500 µl of supernatant from cell lysates prepared as described above was loaded onto sucrose gradients followed by centrifugation for 2.5 hr at 32,000 rpm, 4 °C in a SW41 rotor. Separated samples were fractionated at 1.5 ml min-1 through an automated fractionation system (Isco) that continually monitors OD254 values. Ribosome fractions separated by sucrose gradient sedimentation were pooled and digested with E. coli RNase I (Ambion, 750 U per 100 A260 units) by incubation at 4 °C for 1 hr. SUPERase•In (50 U per 100 U RNase I) was then added into the reaction mixture to stop the digestion. Total RNA was extracted using TRIzol LS reagent. Fragmented RNAs were separated on a 15% polyacrylamide TBE-urea gel (Invitrogen) and visualized using SYBR Gold (Invitrogen). Selected regions of the gel corresponding to 20-70 nt (for 40S-seq and eIF3-seq) or 25-35 nt (for Ribo-seq) were excised. The gel slices were disrupted by using centrifugation through the holes at the bottom of the tube. RNA fragments were dissolved by soaking overnight in 400 µl RNA gel elution buffer (300 mM NaOAc pH 5.5, 1 mM EDTA, 0.1 U/µl SUPERase•In). The gel debris was removed using a Spin-X column (Corning), followed by ethanol precipitation.   Purified RNA fragments were re-suspended in Nuclease-free water, then dephosphorylated for 1 hr at 37 °C in a 15 µl reaction (1× T4 polynucleotide kinase buffer, 10 U SUPERase•In and 20 U T4 polynucleotide kinase). Dephosphorylated RNA fragments were precipitated using ethanol and re-suspended in Nuclease-free water. 0.15 μg linker (rApp/NNNNCTGTAGGCACCATCAAT/3ddC) then was added to the RNA fragments, heated at 70 °C for 90 s and then cooled to room temperature, followed by ligation for 3 hr at at 22 °C in a 20 µl reaction (1× T4 Rnl2 reaction buffer, 10 U SUPERase•In, 15% PEG8000 and 20 U T4 RNA ligase 2 truncated). The reaction was heat inactivated at 80 °C for 10 min and the products were separated on a 10% polyacrylamide TBE-urea gel and selected regions in the gel corresponding to 45-95 nt (for 40S-seq and eIF3-seq) or 60-70 nt (for Ribo-seq) were excised. RNA fragments were dissolved by soaking overnight in 400 μl RNA gel elution buffer. RNA fragments were purified from RNA gel elution buffer as described earlier and re-suspended in Nuclease-free water. For reverse transcription, the following oligos containing barcodes were used:   (Phos)CTANNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)AGCNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)ATTNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)CCGNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  where Phos represents phosphorylation, NNN represents random sequence, SpC18 represents Hexa-ethyleneglycol spacer.  The linker ligated RNA sample was mixed with 0.5 mM dNTP and 2.5 mM synthesized primer and incubated at 75 ° C for 3 min, followed by incubation on ice for at least 1 min. The reaction master mix was then added with 20 mM Tris (pH 8.4), 50 mM KCl, 5 mM MgCl2, 10 mM DTT, 40 U RNaseOUT and 200 U SuperScript III. Reverse transcription reaction was performed according to the manufacturer's instruction. Reverse transcription products were separated on a 10% polyacrylamide TBE-urea gel. Corresponding region was excised, which was expected to be approximately 200 nt. The first-strand cDNA products were recovered in DNA gel elution buffer (300 mM NaCl, 1 mM EDTA), then purified and re-suspended in Nuclease-free water as described earlier.  cDNA products were circularized in 20 μl of reaction containing 1×CircLigase buffer, 2.5 mM MnCl2, 1M Betaine and 100 U CircLigase II (Epicentre). Circularization was performed at 60 °C for 1 hr and the reaction was heat inactivated at 80 °C for 10 min.</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>Illumina HiSeq 2500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>305482357</ID>
          <LABEL>GSM5482357</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
    <EXPERIMENT_ATTRIBUTES>
      <EXPERIMENT_ATTRIBUTE>
        <TAG>GEO Accession</TAG>
        <VALUE>GSM5482357</VALUE>
      </EXPERIMENT_ATTRIBUTE>
    </EXPERIMENT_ATTRIBUTES>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM5482358" accession="SRX11588511">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX11588511</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM5482358</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM5482358: eIF3-80S_OGT_KO_Starvation; Mus musculus; OTHER</TITLE>
    <STUDY_REF accession="SRP330265" refname="GSE181040">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP330265</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS9622990">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS9622990</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM5482358</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>OTHER</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>other</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <SINGLE/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>For cell lysates, at least four 10 cm dishes of cells were harvested in 400 µl ice-cold polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2). Cells were then disrupted by vortexing six times for 20s using lysing matrix D (Fisher), followed by a 40 s interval each time on ice, then centrifuged at 12,000g, 4 °C for 10 min. Samples were then subjected to sucrose gradient sedimentation. Sucrose solutions were prepared in polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2 and 2% Triton X-100). A 15%-45% (w/v) sucrose density gradients were freshly prepared in SW41 ultracentrifuge tubes (Backman) using a Gradient Master (BioComp Instruments). 500 µl of supernatant from cell lysates prepared as described above was loaded onto sucrose gradients followed by centrifugation for 2.5 hr at 32,000 rpm, 4 °C in a SW41 rotor. Separated samples were fractionated at 1.5 ml min-1 through an automated fractionation system (Isco) that continually monitors OD254 values. Ribosome fractions separated by sucrose gradient sedimentation were pooled and digested with E. coli RNase I (Ambion, 750 U per 100 A260 units) by incubation at 4 °C for 1 hr. SUPERase•In (50 U per 100 U RNase I) was then added into the reaction mixture to stop the digestion. Total RNA was extracted using TRIzol LS reagent. Fragmented RNAs were separated on a 15% polyacrylamide TBE-urea gel (Invitrogen) and visualized using SYBR Gold (Invitrogen). Selected regions of the gel corresponding to 20-70 nt (for 40S-seq and eIF3-seq) or 25-35 nt (for Ribo-seq) were excised. The gel slices were disrupted by using centrifugation through the holes at the bottom of the tube. RNA fragments were dissolved by soaking overnight in 400 µl RNA gel elution buffer (300 mM NaOAc pH 5.5, 1 mM EDTA, 0.1 U/µl SUPERase•In). The gel debris was removed using a Spin-X column (Corning), followed by ethanol precipitation.   Purified RNA fragments were re-suspended in Nuclease-free water, then dephosphorylated for 1 hr at 37 °C in a 15 µl reaction (1× T4 polynucleotide kinase buffer, 10 U SUPERase•In and 20 U T4 polynucleotide kinase). Dephosphorylated RNA fragments were precipitated using ethanol and re-suspended in Nuclease-free water. 0.15 μg linker (rApp/NNNNCTGTAGGCACCATCAAT/3ddC) then was added to the RNA fragments, heated at 70 °C for 90 s and then cooled to room temperature, followed by ligation for 3 hr at at 22 °C in a 20 µl reaction (1× T4 Rnl2 reaction buffer, 10 U SUPERase•In, 15% PEG8000 and 20 U T4 RNA ligase 2 truncated). The reaction was heat inactivated at 80 °C for 10 min and the products were separated on a 10% polyacrylamide TBE-urea gel and selected regions in the gel corresponding to 45-95 nt (for 40S-seq and eIF3-seq) or 60-70 nt (for Ribo-seq) were excised. RNA fragments were dissolved by soaking overnight in 400 μl RNA gel elution buffer. RNA fragments were purified from RNA gel elution buffer as described earlier and re-suspended in Nuclease-free water. For reverse transcription, the following oligos containing barcodes were used:   (Phos)CTANNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)AGCNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)ATTNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)CCGNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  where Phos represents phosphorylation, NNN represents random sequence, SpC18 represents Hexa-ethyleneglycol spacer.  The linker ligated RNA sample was mixed with 0.5 mM dNTP and 2.5 mM synthesized primer and incubated at 75 ° C for 3 min, followed by incubation on ice for at least 1 min. The reaction master mix was then added with 20 mM Tris (pH 8.4), 50 mM KCl, 5 mM MgCl2, 10 mM DTT, 40 U RNaseOUT and 200 U SuperScript III. Reverse transcription reaction was performed according to the manufacturer's instruction. Reverse transcription products were separated on a 10% polyacrylamide TBE-urea gel. Corresponding region was excised, which was expected to be approximately 200 nt. The first-strand cDNA products were recovered in DNA gel elution buffer (300 mM NaCl, 1 mM EDTA), then purified and re-suspended in Nuclease-free water as described earlier.  cDNA products were circularized in 20 μl of reaction containing 1×CircLigase buffer, 2.5 mM MnCl2, 1M Betaine and 100 U CircLigase II (Epicentre). Circularization was performed at 60 °C for 1 hr and the reaction was heat inactivated at 80 °C for 10 min.</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>Illumina HiSeq 2500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>305482358</ID>
          <LABEL>GSM5482358</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
    <EXPERIMENT_ATTRIBUTES>
      <EXPERIMENT_ATTRIBUTE>
        <TAG>GEO Accession</TAG>
        <VALUE>GSM5482358</VALUE>
      </EXPERIMENT_ATTRIBUTE>
    </EXPERIMENT_ATTRIBUTES>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM5482359" accession="SRX11588512">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX11588512</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM5482359</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM5482359: eIF3-80S_ThiametG; Mus musculus; OTHER</TITLE>
    <STUDY_REF accession="SRP330265" refname="GSE181040">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP330265</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS9622991">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS9622991</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM5482359</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>OTHER</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>other</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <SINGLE/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>For cell lysates, at least four 10 cm dishes of cells were harvested in 400 µl ice-cold polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2). Cells were then disrupted by vortexing six times for 20s using lysing matrix D (Fisher), followed by a 40 s interval each time on ice, then centrifuged at 12,000g, 4 °C for 10 min. Samples were then subjected to sucrose gradient sedimentation. Sucrose solutions were prepared in polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2 and 2% Triton X-100). A 15%-45% (w/v) sucrose density gradients were freshly prepared in SW41 ultracentrifuge tubes (Backman) using a Gradient Master (BioComp Instruments). 500 µl of supernatant from cell lysates prepared as described above was loaded onto sucrose gradients followed by centrifugation for 2.5 hr at 32,000 rpm, 4 °C in a SW41 rotor. Separated samples were fractionated at 1.5 ml min-1 through an automated fractionation system (Isco) that continually monitors OD254 values. Ribosome fractions separated by sucrose gradient sedimentation were pooled and digested with E. coli RNase I (Ambion, 750 U per 100 A260 units) by incubation at 4 °C for 1 hr. SUPERase•In (50 U per 100 U RNase I) was then added into the reaction mixture to stop the digestion. Total RNA was extracted using TRIzol LS reagent. Fragmented RNAs were separated on a 15% polyacrylamide TBE-urea gel (Invitrogen) and visualized using SYBR Gold (Invitrogen). Selected regions of the gel corresponding to 20-70 nt (for 40S-seq and eIF3-seq) or 25-35 nt (for Ribo-seq) were excised. The gel slices were disrupted by using centrifugation through the holes at the bottom of the tube. RNA fragments were dissolved by soaking overnight in 400 µl RNA gel elution buffer (300 mM NaOAc pH 5.5, 1 mM EDTA, 0.1 U/µl SUPERase•In). The gel debris was removed using a Spin-X column (Corning), followed by ethanol precipitation.   Purified RNA fragments were re-suspended in Nuclease-free water, then dephosphorylated for 1 hr at 37 °C in a 15 µl reaction (1× T4 polynucleotide kinase buffer, 10 U SUPERase•In and 20 U T4 polynucleotide kinase). Dephosphorylated RNA fragments were precipitated using ethanol and re-suspended in Nuclease-free water. 0.15 μg linker (rApp/NNNNCTGTAGGCACCATCAAT/3ddC) then was added to the RNA fragments, heated at 70 °C for 90 s and then cooled to room temperature, followed by ligation for 3 hr at at 22 °C in a 20 µl reaction (1× T4 Rnl2 reaction buffer, 10 U SUPERase•In, 15% PEG8000 and 20 U T4 RNA ligase 2 truncated). The reaction was heat inactivated at 80 °C for 10 min and the products were separated on a 10% polyacrylamide TBE-urea gel and selected regions in the gel corresponding to 45-95 nt (for 40S-seq and eIF3-seq) or 60-70 nt (for Ribo-seq) were excised. RNA fragments were dissolved by soaking overnight in 400 μl RNA gel elution buffer. RNA fragments were purified from RNA gel elution buffer as described earlier and re-suspended in Nuclease-free water. For reverse transcription, the following oligos containing barcodes were used:   (Phos)CTANNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)AGCNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)ATTNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)CCGNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  where Phos represents phosphorylation, NNN represents random sequence, SpC18 represents Hexa-ethyleneglycol spacer.  The linker ligated RNA sample was mixed with 0.5 mM dNTP and 2.5 mM synthesized primer and incubated at 75 ° C for 3 min, followed by incubation on ice for at least 1 min. The reaction master mix was then added with 20 mM Tris (pH 8.4), 50 mM KCl, 5 mM MgCl2, 10 mM DTT, 40 U RNaseOUT and 200 U SuperScript III. Reverse transcription reaction was performed according to the manufacturer's instruction. Reverse transcription products were separated on a 10% polyacrylamide TBE-urea gel. Corresponding region was excised, which was expected to be approximately 200 nt. The first-strand cDNA products were recovered in DNA gel elution buffer (300 mM NaCl, 1 mM EDTA), then purified and re-suspended in Nuclease-free water as described earlier.  cDNA products were circularized in 20 μl of reaction containing 1×CircLigase buffer, 2.5 mM MnCl2, 1M Betaine and 100 U CircLigase II (Epicentre). Circularization was performed at 60 °C for 1 hr and the reaction was heat inactivated at 80 °C for 10 min.</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>Illumina HiSeq 2500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>305482359</ID>
          <LABEL>GSM5482359</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
    <EXPERIMENT_ATTRIBUTES>
      <EXPERIMENT_ATTRIBUTE>
        <TAG>GEO Accession</TAG>
        <VALUE>GSM5482359</VALUE>
      </EXPERIMENT_ATTRIBUTE>
    </EXPERIMENT_ATTRIBUTES>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM5482360" accession="SRX11588513">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX11588513</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM5482360</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM5482360: eIF3-80S_ThiametG_Starvation; Mus musculus; OTHER</TITLE>
    <STUDY_REF accession="SRP330265" refname="GSE181040">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP330265</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS9622992">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS9622992</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM5482360</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>OTHER</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>other</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <SINGLE/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>For cell lysates, at least four 10 cm dishes of cells were harvested in 400 µl ice-cold polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2). Cells were then disrupted by vortexing six times for 20s using lysing matrix D (Fisher), followed by a 40 s interval each time on ice, then centrifuged at 12,000g, 4 °C for 10 min. Samples were then subjected to sucrose gradient sedimentation. Sucrose solutions were prepared in polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl2 and 2% Triton X-100). A 15%-45% (w/v) sucrose density gradients were freshly prepared in SW41 ultracentrifuge tubes (Backman) using a Gradient Master (BioComp Instruments). 500 µl of supernatant from cell lysates prepared as described above was loaded onto sucrose gradients followed by centrifugation for 2.5 hr at 32,000 rpm, 4 °C in a SW41 rotor. Separated samples were fractionated at 1.5 ml min-1 through an automated fractionation system (Isco) that continually monitors OD254 values. Ribosome fractions separated by sucrose gradient sedimentation were pooled and digested with E. coli RNase I (Ambion, 750 U per 100 A260 units) by incubation at 4 °C for 1 hr. SUPERase•In (50 U per 100 U RNase I) was then added into the reaction mixture to stop the digestion. Total RNA was extracted using TRIzol LS reagent. Fragmented RNAs were separated on a 15% polyacrylamide TBE-urea gel (Invitrogen) and visualized using SYBR Gold (Invitrogen). Selected regions of the gel corresponding to 20-70 nt (for 40S-seq and eIF3-seq) or 25-35 nt (for Ribo-seq) were excised. The gel slices were disrupted by using centrifugation through the holes at the bottom of the tube. RNA fragments were dissolved by soaking overnight in 400 µl RNA gel elution buffer (300 mM NaOAc pH 5.5, 1 mM EDTA, 0.1 U/µl SUPERase•In). The gel debris was removed using a Spin-X column (Corning), followed by ethanol precipitation.   Purified RNA fragments were re-suspended in Nuclease-free water, then dephosphorylated for 1 hr at 37 °C in a 15 µl reaction (1× T4 polynucleotide kinase buffer, 10 U SUPERase•In and 20 U T4 polynucleotide kinase). Dephosphorylated RNA fragments were precipitated using ethanol and re-suspended in Nuclease-free water. 0.15 μg linker (rApp/NNNNCTGTAGGCACCATCAAT/3ddC) then was added to the RNA fragments, heated at 70 °C for 90 s and then cooled to room temperature, followed by ligation for 3 hr at at 22 °C in a 20 µl reaction (1× T4 Rnl2 reaction buffer, 10 U SUPERase•In, 15% PEG8000 and 20 U T4 RNA ligase 2 truncated). The reaction was heat inactivated at 80 °C for 10 min and the products were separated on a 10% polyacrylamide TBE-urea gel and selected regions in the gel corresponding to 45-95 nt (for 40S-seq and eIF3-seq) or 60-70 nt (for Ribo-seq) were excised. RNA fragments were dissolved by soaking overnight in 400 μl RNA gel elution buffer. RNA fragments were purified from RNA gel elution buffer as described earlier and re-suspended in Nuclease-free water. For reverse transcription, the following oligos containing barcodes were used:   (Phos)CTANNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)AGCNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)ATTNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  (Phos)CCGNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC(SpC18)CACTCA(SpC18)TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG  where Phos represents phosphorylation, NNN represents random sequence, SpC18 represents Hexa-ethyleneglycol spacer.  The linker ligated RNA sample was mixed with 0.5 mM dNTP and 2.5 mM synthesized primer and incubated at 75 ° C for 3 min, followed by incubation on ice for at least 1 min. The reaction master mix was then added with 20 mM Tris (pH 8.4), 50 mM KCl, 5 mM MgCl2, 10 mM DTT, 40 U RNaseOUT and 200 U SuperScript III. Reverse transcription reaction was performed according to the manufacturer's instruction. Reverse transcription products were separated on a 10% polyacrylamide TBE-urea gel. Corresponding region was excised, which was expected to be approximately 200 nt. The first-strand cDNA products were recovered in DNA gel elution buffer (300 mM NaCl, 1 mM EDTA), then purified and re-suspended in Nuclease-free water as described earlier.  cDNA products were circularized in 20 μl of reaction containing 1×CircLigase buffer, 2.5 mM MnCl2, 1M Betaine and 100 U CircLigase II (Epicentre). Circularization was performed at 60 °C for 1 hr and the reaction was heat inactivated at 80 °C for 10 min.</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>Illumina HiSeq 2500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>305482360</ID>
          <LABEL>GSM5482360</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
    <EXPERIMENT_ATTRIBUTES>
      <EXPERIMENT_ATTRIBUTE>
        <TAG>GEO Accession</TAG>
        <VALUE>GSM5482360</VALUE>
      </EXPERIMENT_ATTRIBUTE>
    </EXPERIMENT_ATTRIBUTES>
  </EXPERIMENT>
</EXPERIMENT_SET>
