SRX12098449 Official72_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 197 cycles. SRS10077430 XZ30 Official72_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098450 Official73_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 198 cycles. SRS10077428 XZ31 Official73_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098451 Official74_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 199 cycles. SRS10077429 XZ32 Official74_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098452 Official75_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 200 cycles. SRS10077436 XZ33 Official75_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098453 Official76_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 201 cycles. SRS10077432 XZ34 Official76_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098454 Official77_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 202 cycles. SRS10077431 XZ35 Official77_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098455 Official78_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 203 cycles. SRS10077433 XZ36 Official78_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098456 Official79_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 204 cycles. SRS10077434 XZ37 Official79_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098457 Official80_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 205 cycles. SRS10077435 XZ38 Official80_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098458 Official81_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 206 cycles. SRS10077437 XZ39 Official81_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098459 Inspector9_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 45 cycles. SRS10077438 A108 Inspector9_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098460 Official82_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 207 cycles. SRS10077439 XZ40 Official82_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098461 Official83_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 208 cycles. SRS10077440 XZ41 Official83_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098462 Official84_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 209 cycles. SRS10077442 XZ42 Official84_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098463 Official85_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 210 cycles. SRS10077441 XZ43 Official85_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098464 Official86_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 211 cycles. SRS10077443 XZ44 Official86_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098465 Official1_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 27 cycles. SRS10077445 A01 Official1_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098466 Official2_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 28 cycles. SRS10077444 A02 Official2_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098467 Inspector2_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 37 cycles. SRS10077446 A100 Inspector2_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098468 Official32_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 127 cycles. SRS10077447 A57 Official32_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098469 Inspector70_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 128 cycles. SRS10077448 A58 Inspector70_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098470 Official33_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 129 cycles. SRS10077449 A59 Official33_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098471 Inspector71_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 130 cycles. SRS10077450 A60 Inspector71_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098472 Inspector72_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 131 cycles. SRS10077451 A61 Inspector72_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098473 Inspector73_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 132 cycles. SRS10077452 A62 Inspector73_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098474 Inspector74_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 133 cycles. SRS10077453 A63 Inspector74_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098475 Inspector75_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 134 cycles. SRS10077454 A64 Inspector75_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098476 Inspector76_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 135 cycles. SRS10077455 A65 Inspector76_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098477 Inspector77_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 136 cycles. SRS10077456 A66 Inspector77_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098478 Inspector3_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 38 cycles. SRS10077457 A101 Inspector3_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098479 Official34_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 137 cycles. SRS10077458 A67 Official34_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098480 Inspector78_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 138 cycles. SRS10077459 A68 Inspector78_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098481 Official87_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 212 cycles. SRS10077460 XZ45 Official87_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098482 Official88_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 213 cycles. SRS10077461 XZ46 Official88_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098483 Official2_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 214 cycles. SRS10077462 A02_ITS Official2_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098484 Official3_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 215 cycles. SRS10077463 A03_ITS Official3_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098485 Official4_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 216 cycles. SRS10077464 A04_ITS Official4_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098486 Inspector10_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 46 cycles. SRS10077465 A11 Inspector10_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098487 Official5_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 217 cycles. SRS10077466 A05_ITS Official5_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098488 Official6_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 218 cycles. SRS10077467 A06_ITS Official6_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098489 Official7_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 219 cycles. SRS10077468 A07_ITS Official7_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098490 Official8_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 220 cycles. SRS10077469 A08_ITS Official8_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098491 Official9_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 221 cycles. SRS10077470 A09_ITS Official9_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098492 Inspector1_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 222 cycles. SRS10077472 A10_ITS Inspector1_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098493 Inspector2_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 223 cycles. SRS10077471 A100_ITS Inspector2_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098494 Inspector3_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 224 cycles. SRS10077473 A101_ITS Inspector3_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098495 Official10_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 225 cycles. SRS10077475 A104_ITS Official10_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098496 Inspector6_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 226 cycles. SRS10077474 A105_ITS Inspector6_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098497 Official3_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 29 cycles. SRS10077477 A03 Official3_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098498 Inspector11_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 47 cycles. SRS10077476 A110 Inspector11_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098499 Inspector7_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 227 cycles. SRS10077478 A106_ITS Inspector7_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098500 Inspector9_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 228 cycles. SRS10077479 A108_ITS Inspector9_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098501 Inspector10_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 229 cycles. SRS10077480 A11_ITS Inspector10_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098502 Inspector11_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 230 cycles. SRS10077481 A110_ITS Inspector11_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098503 Inspector12_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 231 cycles. SRS10077482 A111_ITS Inspector12_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098504 Inspector13_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 232 cycles. SRS10077483 A112_ITS Inspector13_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098505 Inspector14_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 233 cycles. SRS10077484 A113_ITS Inspector14_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098506 Inspector15_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 234 cycles. SRS10077485 A114_ITS Inspector15_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098507 Inspector16_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 235 cycles. SRS10077486 A115_ITS Inspector16_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098508 Official11_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 236 cycles. SRS10077487 A116_ITS Official11_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098509 Inspector12_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 48 cycles. SRS10077489 A111 Inspector12_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098510 Inspector18_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 237 cycles. SRS10077488 A118_ITS Inspector18_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098511 Inspector20_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 238 cycles. SRS10077490 A12_ITS Inspector20_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098512 Inspector24_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 239 cycles. SRS10077491 A124_ITS Inspector24_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098513 Official13_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 240 cycles. SRS10077493 A125_ITS Official13_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098514 Inspector25_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 241 cycles. SRS10077492 A126_ITS Inspector25_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098515 Inspector26_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 242 cycles. SRS10077495 A127_ITS Inspector26_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098516 Official15_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 243 cycles. SRS10077494 A129_ITS Official15_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098517 Inspector27_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 244 cycles. SRS10077496 A13_ITS Inspector27_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098518 Inspector28_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 245 cycles. SRS10077498 A130_ITS Inspector28_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098519 Official16_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 246 cycles. SRS10077497 A131_ITS Official16_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098520 Inspector13_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 49 cycles. SRS10077499 A112 Inspector13_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098521 Official20_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 247 cycles. SRS10077500 A136_ITS Official20_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098522 Official22_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 248 cycles. SRS10077501 A138_ITS Official22_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098523 Inspector30_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 249 cycles. SRS10077503 A14_ITS Inspector30_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098524 Inspector31_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 250 cycles. SRS10077502 A140_ITS Inspector31_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098525 Inspector32_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 251 cycles. SRS10077504 A141_ITS Inspector32_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098526 Inspector34_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 252 cycles. SRS10077508 A143_ITS Inspector34_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098527 Inspector35_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 253 cycles. SRS10077505 A144_ITS Inspector35_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098528 Inspector37_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 254 cycles. SRS10077506 A15_ITS Inspector37_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098529 Inspector38_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 255 cycles. SRS10077507 A16_ITS Inspector38_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098530 Inspector39_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 256 cycles. SRS10077509 A17_ITS Inspector39_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098531 Inspector14_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 50 cycles. SRS10077511 A113 Inspector14_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098532 Inspector41_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 257 cycles. SRS10077513 A19_ITS Inspector41_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098533 Inspector42_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 258 cycles. SRS10077510 A20_ITS Inspector42_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098534 Inspector43_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 259 cycles. SRS10077512 A21_ITS Inspector43_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098535 Official24_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 260 cycles. SRS10077514 A23_ITS Official24_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098536 Official25_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 261 cycles. SRS10077515 A24_ITS Official25_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098537 Official26_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 262 cycles. SRS10077516 A25_ITS Official26_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098538 Inspector45_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 263 cycles. SRS10077518 A26_ITS Inspector45_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098539 Official28_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 264 cycles. SRS10077517 A29_ITS Official28_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098540 Inspector48_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 265 cycles. SRS10077519 A32_ITS Inspector48_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098541 Inspector49_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 266 cycles. SRS10077520 A33_ITS Inspector49_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098542 Inspector15_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 51 cycles. SRS10077522 A114 Inspector15_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098543 Inspector51_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 267 cycles. SRS10077521 A35_ITS Inspector51_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098544 Inspector53_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 268 cycles. SRS10077523 A37_ITS Inspector53_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098545 Inspector54_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 269 cycles. SRS10077524 A38_ITS Inspector54_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098546 Official30_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 270 cycles. SRS10077525 A41_ITS Official30_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098547 Inspector57_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 271 cycles. SRS10077527 A42_ITS Inspector57_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098548 Inspector58_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 272 cycles. SRS10077526 A44_ITS Inspector58_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098549 Inspector60_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 273 cycles. SRS10077528 A46_ITS Inspector60_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098550 Inspector61_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 274 cycles. SRS10077529 A47_ITS Inspector61_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098551 Inspector62_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 275 cycles. SRS10077531 A48_ITS Inspector62_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098552 Inspector63_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 276 cycles. SRS10077530 A49_ITS Inspector63_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098553 Inspector16_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 52 cycles. SRS10077532 A115 Inspector16_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098554 Inspector65_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 277 cycles. SRS10077533 A51_ITS Inspector65_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098555 Inspector66_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 278 cycles. SRS10077534 A52_ITS Inspector66_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098556 Inspector67_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 279 cycles. SRS10077535 A53_ITS Inspector67_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098557 Inspector100_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 280 cycles. SRS10077536 A54_ITS Inspector100_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098558 Inspector69_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 281 cycles. SRS10077537 A56_ITS Inspector69_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098559 Official32_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 282 cycles. SRS10077538 A57_ITS Official32_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098560 Official33_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 283 cycles. SRS10077539 A59_ITS Official33_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098561 Inspector71_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 284 cycles. SRS10077541 A60_ITS Inspector71_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098562 Inspector72_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 285 cycles. SRS10077540 A61_ITS Inspector72_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098563 Inspector73_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 286 cycles. SRS10077542 A62_ITS Inspector73_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098564 Official11_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 53 cycles. SRS10077543 A116 Official11_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098565 Inspector74_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 287 cycles. SRS10077545 A63_ITS Inspector74_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098566 Inspector75_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 288 cycles. SRS10077544 A64_ITS Inspector75_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098567 Inspector76_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 289 cycles. SRS10077546 A65_ITS Inspector76_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098568 Inspector77_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 290 cycles. SRS10077547 A66_ITS Inspector77_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098569 Official34_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 291 cycles. SRS10077548 A67_ITS Official34_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098570 Inspector78_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 292 cycles. SRS10077549 A68_ITS Inspector78_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098571 Inspector79_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 293 cycles. SRS10077550 A69_ITS Inspector79_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098572 Inspector80_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 294 cycles. SRS10077551 A70_ITS Inspector80_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098573 Inspector81_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 295 cycles. SRS10077552 A71_ITS Inspector81_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098574 Inspector82_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 296 cycles. SRS10077553 A72_ITS Inspector82_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098575 Inspector17_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 54 cycles. SRS10077554 A117 Inspector17_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098576 Inspector84_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 297 cycles. SRS10077555 A74_ITS Inspector84_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098577 Official35_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 298 cycles. SRS10077557 A75_ITS Official35_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098578 Official36_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 299 cycles. SRS10077558 A76_ITS Official36_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098579 Inspector85_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 300 cycles. SRS10077556 A77_ITS Inspector85_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098580 Inspector86_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 301 cycles. SRS10077559 A78_ITS Inspector86_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098581 Inspector87_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 302 cycles. SRS10077560 A79_ITS Inspector87_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098582 Inspector88_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 303 cycles. SRS10077561 A80_ITS Inspector88_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098583 Inspector89_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 304 cycles. SRS10077562 A81_ITS Inspector89_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098584 Inspector90_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 305 cycles. SRS10077563 A82_ITS Inspector90_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098585 Inspector92_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 306 cycles. SRS10077565 A84_ITS Inspector92_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098586 Inspector18_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 55 cycles. SRS10077564 A118 Inspector18_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098587 Official37_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 307 cycles. SRS10077566 A85_ITS Official37_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098588 Inspector93_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 308 cycles. SRS10077567 A87_ITS Inspector93_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098589 Inspector94_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 309 cycles. SRS10077568 A88_ITS Inspector94_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098590 Official39_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 310 cycles. SRS10077571 A89_ITS Official39_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098591 Inspector101_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 311 cycles. SRS10077570 A93_ITS Inspector101_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098592 Official41_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 312 cycles. SRS10077569 A94_ITS Official41_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098593 Official42_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 313 cycles. SRS10077572 A95_ITS Official42_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098594 Official43_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 314 cycles. SRS10077576 A96_ITS Official43_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098595 Inspector97_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 315 cycles. SRS10077573 A97_ITS Inspector97_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098596 Inspector98_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 316 cycles. SRS10077575 A98_ITS Inspector98_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098597 Inspector19_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 56 cycles. SRS10077574 A119 Inspector19_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098598 Inspector99_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 317 cycles. SRS10077577 A99_ITS Inspector99_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098599 Official45_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 318 cycles. SRS10077578 XZ02_ITS Official45_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098600 Official46_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 319 cycles. SRS10077580 XZ03_ITS Official46_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098601 Official49_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 320 cycles. SRS10077579 XZ06_ITS Official49_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098602 Official51_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 321 cycles. SRS10077581 XZ08_ITS Official51_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098603 Official52_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 322 cycles. SRS10077582 XZ09_ITS Official52_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098604 Official55_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 323 cycles. SRS10077584 XZ12_ITS Official55_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098605 Official56_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 324 cycles. SRS10077583 XZ13_ITS Official56_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098606 Official57_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 325 cycles. SRS10077585 XZ14_ITS Official57_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098607 Official58_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 326 cycles. SRS10077586 XZ15_ITS Official58_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098608 Official4_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 30 cycles. SRS10077588 A04 Official4_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098609 Inspector20_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 57 cycles. SRS10077587 A12 Inspector20_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098610 Official59_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 327 cycles. SRS10077590 XZ16_ITS Official59_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098611 Official60_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 328 cycles. SRS10077589 XZ17_ITS Official60_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098612 Official62_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 329 cycles. SRS10077591 XZ19_ITS Official62_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098613 Official64_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 330 cycles. SRS10077592 XZ22_ITS Official64_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098614 Official65_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 331 cycles. SRS10077593 XZ23_ITS Official65_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098615 Official66_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 332 cycles. SRS10077594 XZ24_ITS Official66_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098616 Official67_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 333 cycles. SRS10077595 XZ25_ITS Official67_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098617 Official68_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 334 cycles. SRS10077596 XZ26_ITS Official68_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098618 Official70_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 335 cycles. SRS10077597 XZ28_ITS Official70_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098619 Official72_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 336 cycles. SRS10077598 XZ30_ITS Official72_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098620 Official12_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 58 cycles. SRS10077599 A120 Official12_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098621 Official73_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 337 cycles. SRS10077602 XZ31_ITS Official73_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098622 Official74_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 338 cycles. SRS10077600 XZ32_ITS Official74_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098623 Official76_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 339 cycles. SRS10077601 XZ34_ITS Official76_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098624 Official77_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 340 cycles. SRS10077603 XZ35_ITS Official77_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098625 Official78_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 341 cycles. SRS10077604 XZ36_ITS Official78_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098626 Official81_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 342 cycles. SRS10077605 XZ39_ITS Official81_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098627 Official82_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 343 cycles. SRS10077607 XZ40_ITS Official82_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098628 Official83_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 344 cycles. SRS10077606 XZ41_ITS Official83_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098629 Official84_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 345 cycles. SRS10077608 XZ42_ITS Official84_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098630 Official86_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 346 cycles. SRS10077609 XZ44_ITS Official86_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098631 Inspector21_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 59 cycles. SRS10077610 A121 Inspector21_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098632 Official87_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 347 cycles. SRS10077612 XZ45_ITS Official87_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098633 Official88_ITS SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 348 cycles. SRS10077611 XZ46_ITS Official88_ITS AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098634 Inspector22_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 60 cycles. SRS10077613 A122 Inspector22_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098635 Inspector23_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 61 cycles. SRS10077614 A123 Inspector23_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098636 Inspector24_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 62 cycles. SRS10077615 A124 Inspector24_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098637 Official13_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 63 cycles. SRS10077617 A125 Official13_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098638 Inspector25_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 64 cycles. SRS10077618 A126 Inspector25_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098639 Inspector26_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 65 cycles. SRS10077616 A127 Inspector26_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098640 Official14_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 66 cycles. SRS10077620 A128 Official14_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098641 Official5_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 31 cycles. SRS10077619 A05 Official5_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098642 Official15_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 67 cycles. SRS10077621 A129 Official15_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098643 Inspector27_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 68 cycles. SRS10077622 A13 Inspector27_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098644 Inspector28_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 69 cycles. SRS10077623 A130 Inspector28_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098645 Official16_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 70 cycles. SRS10077624 A131 Official16_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098646 Official17_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 71 cycles. SRS10077626 A132 Official17_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098647 Official18_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 72 cycles. SRS10077625 A133 Official18_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098648 Official19_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 73 cycles. SRS10077627 A134 Official19_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098649 Inspector29_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 74 cycles. SRS10077628 A135 Inspector29_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098650 Official20_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 75 cycles. SRS10077629 A136 Official20_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098651 Official21_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 76 cycles. SRS10077630 A137 Official21_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098652 Official6_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 32 cycles. SRS10077631 A06 Official6_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098653 Official22_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 77 cycles. SRS10077634 A138 Official22_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098654 Official23_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 78 cycles. SRS10077633 A139 Official23_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098655 Inspector30_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 79 cycles. SRS10077632 A14 Inspector30_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098656 Inspector31_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 80 cycles. SRS10077635 A140 Inspector31_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098657 Inspector32_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 81 cycles. SRS10077636 A141 Inspector32_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098658 Inspector33_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 82 cycles. SRS10077637 A142 Inspector33_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098659 Inspector34_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 83 cycles. SRS10077638 A143 Inspector34_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098660 Inspector35_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 84 cycles. SRS10077639 A144 Inspector35_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098661 Inspector36_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 85 cycles. SRS10077640 A145 Inspector36_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098662 Inspector37_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 86 cycles. SRS10077641 A15 Inspector37_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098663 Official7_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 33 cycles. SRS10077642 A07 Official7_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098664 Inspector38_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 87 cycles. SRS10077644 A16 Inspector38_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098665 Inspector39_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 88 cycles. SRS10077645 A17 Inspector39_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098666 Inspector40_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 89 cycles. SRS10077643 A18 Inspector40_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098667 Inspector41_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 90 cycles. SRS10077646 A19 Inspector41_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098668 Inspector42_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 91 cycles. SRS10077648 A20 Inspector42_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098669 Inspector43_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 92 cycles. SRS10077647 A21 Inspector43_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098670 Inspector44_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 93 cycles. SRS10077649 A22 Inspector44_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098671 Official24_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 94 cycles. SRS10077652 A23 Official24_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098672 Official25_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 95 cycles. SRS10077650 A24 Official25_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098673 Official26_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 96 cycles. SRS10077651 A25 Official26_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098674 Official8_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 34 cycles. SRS10077653 A08 Official8_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098675 Inspector45_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 97 cycles. SRS10077654 A26 Inspector45_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098676 Inspector46_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 98 cycles. SRS10077656 A27 Inspector46_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098677 Official27_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 99 cycles. SRS10077655 A28 Official27_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098678 Official28_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 100 cycles. SRS10077657 A29 Official28_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098679 Official29_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 101 cycles. SRS10077658 A30 Official29_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098680 Inspector47_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 102 cycles. SRS10077659 A31 Inspector47_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098681 Inspector48_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 103 cycles. SRS10077660 A32 Inspector48_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098682 Inspector49_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 104 cycles. SRS10077661 A33 Inspector49_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098683 Inspector50_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 105 cycles. SRS10077663 A34 Inspector50_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098684 Inspector51_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 106 cycles. SRS10077662 A35 Inspector51_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098685 Official9_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 35 cycles. SRS10077664 A09 Official9_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098686 Inspector52_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 107 cycles. SRS10077666 A36 Inspector52_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098687 Inspector53_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 108 cycles. SRS10077667 A37 Inspector53_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098688 Inspector54_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 109 cycles. SRS10077665 A38 Inspector54_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098689 Inspector55_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 110 cycles. SRS10077668 A39 Inspector55_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098690 Inspector56_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 111 cycles. SRS10077669 A40 Inspector56_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098691 Official30_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 112 cycles. SRS10077670 A41 Official30_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098692 Inspector57_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 113 cycles. SRS10077671 A42 Inspector57_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098693 Official31_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 114 cycles. SRS10077674 A43 Official31_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098694 Inspector58_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 115 cycles. SRS10077672 A44 Inspector58_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098695 Inspector59_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 116 cycles. SRS10077673 A45 Inspector59_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098696 Inspector1_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 36 cycles. SRS10077675 A10 Inspector1_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098697 Inspector60_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 117 cycles. SRS10077676 A46 Inspector60_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098698 Inspector61_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 118 cycles. SRS10077678 A47 Inspector61_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098699 Inspector62_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 119 cycles. SRS10077679 A48 Inspector62_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098700 Inspector63_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 120 cycles. SRS10077677 A49 Inspector63_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098701 Inspector64_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 121 cycles. SRS10077680 A50 Inspector64_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098702 Inspector65_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 122 cycles. SRS10077681 A51 Inspector65_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098703 Inspector66_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 123 cycles. SRS10077686 A52 Inspector66_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098704 Inspector67_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 124 cycles. SRS10077682 A53 Inspector67_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098705 Inspector68_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 125 cycles. SRS10077685 A55 Inspector68_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098706 Inspector69_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 126 cycles. SRS10077683 A56 Inspector69_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098707 Inspector79_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 139 cycles. SRS10077684 A69 Inspector79_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098708 Inspector80_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 140 cycles. SRS10077688 A70 Inspector80_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098709 Inspector81_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 141 cycles. SRS10077687 A71 Inspector81_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098710 Inspector82_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 142 cycles. SRS10077691 A72 Inspector82_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098711 Inspector83_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 143 cycles. SRS10077689 A73 Inspector83_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098712 Inspector84_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 144 cycles. SRS10077690 A74 Inspector84_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098713 Official35_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 145 cycles. SRS10077692 A75 Official35_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098714 Official36_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 146 cycles. SRS10077693 A76 Official36_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098715 Inspector4_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 39 cycles. SRS10077694 A102 Inspector4_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098716 Inspector85_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 147 cycles. SRS10077695 A77 Inspector85_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098717 Inspector86_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 148 cycles. SRS10077696 A78 Inspector86_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098718 Inspector87_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 149 cycles. SRS10077697 A79 Inspector87_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098719 Inspector88_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 150 cycles. SRS10077699 A80 Inspector88_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098720 Inspector89_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 151 cycles. SRS10077698 A81 Inspector89_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098721 Inspector90_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 152 cycles. SRS10077701 A82 Inspector90_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098722 Inspector91_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 153 cycles. SRS10077700 A83 Inspector91_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098723 Inspector92_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 154 cycles. SRS10077703 A84 Inspector92_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098724 Official37_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 155 cycles. SRS10077702 A85 Official37_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098725 Official38_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 156 cycles. SRS10077705 A86 Official38_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098726 Inspector5_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 40 cycles. SRS10077704 A103 Inspector5_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098727 Inspector93_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 157 cycles. SRS10077706 A87 Inspector93_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098728 Inspector94_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 158 cycles. SRS10077707 A88 Inspector94_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098729 Official39_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 159 cycles. SRS10077711 A89 Official39_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098730 Inspector95_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 160 cycles. SRS10077708 A90 Inspector95_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098731 Official40_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 161 cycles. SRS10077709 A91 Official40_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098732 Inspector96_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 162 cycles. SRS10077710 A92 Inspector96_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098733 Official41_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 163 cycles. SRS10077712 A94 Official41_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098734 Official42_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 164 cycles. SRS10077714 A95 Official42_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098735 Official43_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 165 cycles. SRS10077713 A96 Official43_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098736 Inspector97_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 166 cycles. SRS10077715 A97 Inspector97_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098737 Official10_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 41 cycles. SRS10077717 A104 Official10_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098738 Inspector98_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 167 cycles. SRS10077716 A98 Inspector98_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098739 Inspector99_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 168 cycles. SRS10077718 A99 Inspector99_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098740 Official44_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 169 cycles. SRS10077719 XZ01 Official44_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098741 Official45_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 170 cycles. SRS10077720 XZ02 Official45_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098742 Official46_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 171 cycles. SRS10077721 XZ03 Official46_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098743 Official47_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 172 cycles. SRS10077722 XZ04 Official47_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098744 Official48_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 173 cycles. SRS10077725 XZ05 Official48_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098745 Official49_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 174 cycles. SRS10077723 XZ06 Official49_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098746 Official50_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 175 cycles. SRS10077724 XZ07 Official50_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098747 Official51_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 176 cycles. SRS10077729 XZ08 Official51_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098748 Inspector6_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 42 cycles. SRS10077727 A105 Inspector6_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098749 Official52_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 177 cycles. SRS10077726 XZ09 Official52_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098750 Official53_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 178 cycles. SRS10077728 XZ10 Official53_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098751 Official54_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 179 cycles. SRS10077730 XZ11 Official54_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098752 Official55_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 180 cycles. SRS10077732 XZ12 Official55_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098753 Official56_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 181 cycles. SRS10077731 XZ13 Official56_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098754 Official57_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 182 cycles. SRS10077733 XZ14 Official57_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098755 Official58_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 183 cycles. SRS10077734 XZ15 Official58_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098756 Official59_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 184 cycles. SRS10077736 XZ16 Official59_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098757 Official60_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 185 cycles. SRS10077735 XZ17 Official60_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098758 Official61_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 186 cycles. SRS10077737 XZ18 Official61_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098759 Inspector7_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 43 cycles. SRS10077738 A106 Inspector7_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098760 Official62_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 187 cycles. SRS10077739 XZ19 Official62_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098761 Official63_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 188 cycles. SRS10077741 XZ21 Official63_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098762 Official64_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 189 cycles. SRS10077740 XZ22 Official64_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098763 Official65_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 190 cycles. SRS10077742 XZ23 Official65_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098764 Official66_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 191 cycles. SRS10077743 XZ24 Official66_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098765 Official67_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 192 cycles. SRS10077744 XZ25 Official67_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098766 Official68_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 193 cycles. SRS10077746 XZ26 Official68_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098767 Official69_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 194 cycles. SRS10077745 XZ27 Official69_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098768 Official70_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 195 cycles. SRS10077748 XZ28 Official70_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098769 Official71_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 196 cycles. SRS10077747 XZ29 Official71_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000 SRX12098770 Inspector8_16S SRP336114 bp0 There are 99 inspectors and 88 officials from China Railway Corporation were enrolled in this study. Differences in composition and function of both gut bacterial and fungal microbiota of the two groups were compared. Using universal primers 341F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') to amplify the bacterial 16S rRNA gene fragments (V3-V4). While primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) was used to amplify the fungal internal transcribed spacer regions 1 (ITS1) by the following PCR conditions: 30 s at 95 C, 30 s at 55 C, and 45 s at 72 C for 44 cycles. SRS10077749 A107 Inspector8_16S AMPLICON METAGENOMIC PCR Illumina NovaSeq 6000