SRX12803064 PCR Blank 3 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748624 NoTemplatePCRSJ3 PCR Blank 3 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803065 Aposymbiotic 1 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748625 ABL1 Aposymbiotic 1 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803066 Aposymbiotic 2 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748626 ABL2 Aposymbiotic 2 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803067 Aposymbiotic 3 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748627 ABL3 Aposymbiotic 3 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803068 Aposymbiotic 4 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748628 ABL4 Aposymbiotic 4 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803069 Aposymbiotic 5 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748629 ABL5 Aposymbiotic 5 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803070 Inocula SS5_R1 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748630 SS5_1 Inocula SS5_R1 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803071 Aposymbiotic 6 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748631 ABLM Aposymbiotic 6 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803072 Inocula SS5_R2 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748634 SS5_2 Inocula SS5_R2 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803073 Inocula SS7_R1 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748632 SS7_1 Inocula SS7_R1 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803074 Inocula SS7_R2 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748633 SS7_2 Inocula SS7_R2 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803075 Inocula B1_R1 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748635 B1_1 Inocula B1_R1 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803076 Inocula B1_R2 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748637 B1_2 Inocula B1_R2 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803077 Inocula SS8_R1 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748636 SS8_1 Inocula SS8_R1 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803078 Inocula SS8_R2 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748638 SS8_2 Inocula SS8_R2 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803079 Inocula SS9_R1 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748639 SS9_1 Inocula SS9_R1 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803080 Inocula SS9_R2 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748640 SS9_2 Inocula SS9_R2 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803081 Inocula WT10_R1 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748641 WT10_1 Inocula WT10_R1 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803082 Inocula WT10_R2 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748642 WT10_2 Inocula WT10_R2 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803083 Inoculated anemone B1_R1 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748643 6AB11 Inoculated anemone B1_R1 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803084 Inoculated anemone B1_R2 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748644 6AB12 Inoculated anemone B1_R2 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803085 Inoculated anemone B1_R3 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748645 6AB13 Inoculated anemone B1_R3 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803086 Inoculated anemone B1_R4 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748646 6AB14 Inoculated anemone B1_R4 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803087 Inocula SS1_R1 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748647 SS1_1 Inocula SS1_R1 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803088 Inoculated anemone SS1_R1 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748648 6AS11 Inoculated anemone SS1_R1 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803089 Inoculated anemone SS1_R2 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748649 6AS12 Inoculated anemone SS1_R2 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803090 Inoculated anemone SS1_R3 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748650 6AS13 Inoculated anemone SS1_R3 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803091 Inoculated anemone SS1_R4 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748651 6AS14 Inoculated anemone SS1_R4 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803092 Inoculated anemone SS3_R1 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748653 6AS31 Inoculated anemone SS3_R1 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803093 Inoculated anemone SS3_R2 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748652 6AS32 Inoculated anemone SS3_R2 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803094 Inoculated anemone SS3_R3 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748654 6AS33 Inoculated anemone SS3_R3 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803095 Inoculated anemone SS3_R4 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748655 6AS34 Inoculated anemone SS3_R4 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803096 Inoculated anemone SS5_R1 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748657 6AS51 Inoculated anemone SS5_R1 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803097 Inoculated anemone SS5_R2 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748656 6AS52 Inoculated anemone SS5_R2 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803098 Inocula SS1_R2 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748658 SS1_2 Inocula SS1_R2 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803099 Inoculated anemone SS5_R3 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748659 6AS53 Inoculated anemone SS5_R3 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803100 Inoculated anemone SS5_R4 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748660 6AS54 Inoculated anemone SS5_R4 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803101 Inoculated anemone SS7_R1 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748661 6AS71 Inoculated anemone SS7_R1 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803102 Inoculated anemone SS7_R2 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748662 6AS72 Inoculated anemone SS7_R2 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803103 Inoculated anemone SS7_R3 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748663 6AS73 Inoculated anemone SS7_R3 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803104 Inoculated anemone SS7_R4 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748664 6AS74 Inoculated anemone SS7_R4 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803105 Inoculated anemone SS8_R1 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748665 6AS81 Inoculated anemone SS8_R1 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803106 Inoculated anemone SS8_R2 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748666 6AS82 Inoculated anemone SS8_R2 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803107 Inoculated anemone SS8_R3 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748667 6AS83 Inoculated anemone SS8_R3 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803108 Inoculated anemone SS8_R4 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748668 6AS84 Inoculated anemone SS8_R4 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803109 Inocula SS3_R1 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748670 SS3_1 Inocula SS3_R1 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803110 Inoculated anemone SS9_R1 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748669 6AS91 Inoculated anemone SS9_R1 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803111 Inoculated anemone SS9_R2 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748671 6AS92 Inoculated anemone SS9_R2 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803112 Inoculated anemone SS9_R3 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748673 6AS93 Inoculated anemone SS9_R3 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803113 Inoculated anemone SS9_R4 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748672 6AS94 Inoculated anemone SS9_R4 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803114 Inoculated anemone WT10_R1 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748674 6AW101 Inoculated anemone WT10_R1 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803115 Inoculated anemone WT10_R2 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748676 6AW102 Inoculated anemone WT10_R2 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803116 Inoculated anemone WT10_R3 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748675 6AW103 Inoculated anemone WT10_R3 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803117 Inoculated anemone WT10_R4 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748677 6AW104 Inoculated anemone WT10_R4 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803118 Extraction Blank 1 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748678 ExtBlank1SJ Extraction Blank 1 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803119 Extraction Blank 2 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748679 ExtBlank2SJ Extraction Blank 2 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803120 Inocula SS3_R2 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748680 SS3_2 Inocula SS3_R2 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803121 Extraction Blank 3 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748681 ExtBlank3SJ Extraction Blank 3 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803122 Extraction Blank 4 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748682 ExtBlank4SJ Extraction Blank 4 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803123 PCR Blank 1 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748683 NoTemplatePCRSJ1 PCR Blank 1 AMPLICON GENOMIC PCR Illumina MiSeq SRX12803124 PCR Blank 2 SRP343513 bp0 DNA was extracted from the entire anemone for the freshly isolated Symbiodiniaceae samples, and from a 1 ml aliquot of pure culture for the Symbiodiniaceae culture samples. DNA was also extracted from entire single aposymbiotic anemones. The extraction was conducted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. Tissue-free extractions were also conducted as contamination controls. Symbiodiniaceae ITS2 primers Sym_Var_5.8S2 [5 GTGACCTATGAACTCAGGAGTCGAATTGCAGAACTCCGT GAACC 3] (Hume et al., 2015); Sym_Var_Rev [3 CTGAGACTTGCACATCGCAGCCGGGT TCWCTTGTYTGACTTCATGC 5] (Hume et al., 2013) with Illumina adapters (underlined- specific for the Walter and Eliza Hall Institute (WEHI)) were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes. Illumina MiSeq v3 sequencing was conducted at the Walter and Eliza Hall Institute and raw sequences were submitted to SymPortal (Hume et al., 2019) for Symbiodiniaceae community analysis. SRS10748684 NoTemplatePCRSJ2 PCR Blank 2 AMPLICON GENOMIC PCR Illumina MiSeq