SRX15044220 GSM6073759_r1 SRP372752 PRJNA833124 SRS12790463 GSM6073759 GSM6073759 OTHER GENOMIC other About 6 millions of HEK293T cells in 2 ml of culture medium were pelleted by centrifugation at 2000 rpm, resuspended in 0.3 ml of the same medium, gently mixed at 42°C with an equal volume of a 1% agarose L (LKB) in PBS solution, and distributed on a mold containing 100-microliters wells. The mold was placed on ice for 2-5 min, covered with parafilm. The agarose plugs were then placed in Petri dishes with 5 ml of solution containing 0.5 M EDTA (pH 9.5), 1% sodium laurylsarcosine, and 1-2 mg of proteinase K solution per ml for 40-48 hr at 50°C, and stored at 4°C in the same solution. Each DNA-agarose plus usually contained about 15 microgramms of DNA corresponding to about 1 millions of cells. To test the quality of isolated DNA the fractionation in the pulsed-field gels. Portions of the original agarose-DNA plugs (5-50 microliters) containing 1-10 microgramms of DNA were used for electrophoresis without any restriction enzyme digestion. The DNA samples were run in 0.8% agarose gels on an LKB Pulsaphor system using hexagonal electrode and switching times of 25 or 450 sec. For elution of DNA preparations the fractionation in 1% agarose conventional mini-gel was performed. One-half of DNA-agarose plug was washed in 1xTE 3 times (for 15 min each) following by 3 times washing in the same solution containing 17.4 microgramms/ml PMSF in ethanol. After fractionation in the mini-gel, the ethidium-bromide stained DNA band was excised and electoeluted inside the dialysis cellulose membrane bag. After overnight dialysis without stirring against 1 liter of 0.01 x TE at 4°C, the DNA was concentrated with PEG (4°C) and redialyzed. Library preparation: About 1.5 microgramms of isolated DNA, forum DNA, (see above) was ligated with 70 ng of double-stranded oligonucleotide containing EcoRI and PstI sites (25 bp long 5'-phosphorylated 5' pCCCCTGCAGTATAAGGAGAATTCGGG 3' oligonucleotide annealed with 26 bp long 5' biotinylated 5' bio-CCGAATTCTCCTTATACTGCAGGGG 3' oligonucleotide) in 150 microliters of solution containing 0.1 M NaCl, 50 mM Tris HCl (pH 7.4), 8 mM MgCl2, 9 mM 2-mercaptoethanol, 7 microM ATP, 7.5 % PEG, and 40 units of T4 DNA ligase at 20°C for 16 hr. After heating at 65°C for 10 min the DNA preparation was digested with Sau3A enzyme to shorten the forum domain to the termini attached to the ligated oligonicleotide. The selection of such termini was performed in 0.5 ml eppendorf tubes using 300 microliters of suspension containing streptavidin magnespere paramagnetic particles, SA-PMP (Promega) according to the manufacturer's recommendations. After extensive washing with 0.5xSSC removing DNA fragments corresponding to internal parts of forum domains, the forum termini (FT) DNA preparation was eluted from the SA-PMP using digestion with EcoRI enzyme in final volume of 50?mictolitres (double-stranded FT). The FT were then ligated with 100x molar excess of double-stranded Sau3A adaptor (5'-phosphorylated 5' pGATCGTTTGCGGCCGCTTAAGCTTGGG 3' oligonucleotide annealed with 5' CCCAAGCTTAAGCGGCCGCAAAC 3' oligonucleotide). In some experiments (FT) DNA preparation was eluted from the SA-PMP using heating by incubation at 100°C for 3 min in 50 microliters of 0.01xTE (single-stranded FT). Before heating the FT preparation was ligated with100x molar excess of double-stranded Sau3A adaptor in suspension with SA-PMP (see above). Both final DNA samples (double-stranded FT or single-stranded FT) were used for PCR amplifications. 40 cycle PCR amplification in 30 microlitersl of a solution containing 67 mM Tris-HCl (pH 8.4); 6 mM MgCl2; 10 mM 2-mercaptoethanol; 16.6 mM ammonium sulfate; 6.7 microM EDTA; 5 microg/ml BSA; 1 mM dNTPs; 1 microg of primer corresponding to Sau3A adaptor (5' CCCAAGCTTAAGCGGCCGCAAAC 3'); 1 microg of primer corresponding to biotinilated oligonucleotide (5' CCGAATTCTCCTTATACTGCAGGGG 3') and 1 u of Taq polymerase was performed using Eppendorf Mastercycler Personal. Amplification conditions were 90°C for melting, 65°C for annealing and 72°C for extension, for 1 min each. Both final DNA samples (double-stranded FT or single-stranded FT) were used for PCR amplifications. 40 cycle PCR amplification in 30 microlitersl of a solution containing 67 mM Tris-HCl (pH 8.4); 6 mM MgCl2; 10 mM 2-mercaptoethanol; 16.6 mM ammonium sulfate; 6.7 microM EDTA; 5 microg/ml BSA; 1 mM dNTPs; 1 microg of primer corresponding to Sau3A adaptor (5' CCCAAGCTTAAGCGGCCGCAAAC 3'); 1 microg of primer corresponding to biotinilated oligonucleotide (5' CCGAATTCTCCTTATACTGCAGGGG 3') and 1 u of Taq polymerase was performed using Eppendorf Mastercycler Personal. Amplification conditions were 90°C for melting, 65°C for annealing and 72°C for extension, for 1 min each. Deep sequencing of libraries were performed using HiSeq1500 (Illumina) in Paired-End mode using 100-nt long reads. Illumina HiSeq 1500 SRX15044221 GSM6073760_r1 SRP372752 PRJNA833124 SRS12790464 GSM6073760 GSM6073760 OTHER GENOMIC other About 6 millions of HEK293T cells in 2 ml of culture medium were pelleted by centrifugation at 2000 rpm, resuspended in 0.3 ml of the same medium, gently mixed at 42°C with an equal volume of a 1% agarose L (LKB) in PBS solution, and distributed on a mold containing 100-microliters wells. The mold was placed on ice for 2-5 min, covered with parafilm. The agarose plugs were then placed in Petri dishes with 5 ml of solution containing 0.5 M EDTA (pH 9.5), 1% sodium laurylsarcosine, and 1-2 mg of proteinase K solution per ml for 40-48 hr at 50°C, and stored at 4°C in the same solution. Each DNA-agarose plus usually contained about 15 microgramms of DNA corresponding to about 1 millions of cells. To test the quality of isolated DNA the fractionation in the pulsed-field gels. Portions of the original agarose-DNA plugs (5-50 microliters) containing 1-10 microgramms of DNA were used for electrophoresis without any restriction enzyme digestion. The DNA samples were run in 0.8% agarose gels on an LKB Pulsaphor system using hexagonal electrode and switching times of 25 or 450 sec. For elution of DNA preparations the fractionation in 1% agarose conventional mini-gel was performed. One-half of DNA-agarose plug was washed in 1xTE 3 times (for 15 min each) following by 3 times washing in the same solution containing 17.4 microgramms/ml PMSF in ethanol. After fractionation in the mini-gel, the ethidium-bromide stained DNA band was excised and electoeluted inside the dialysis cellulose membrane bag. After overnight dialysis without stirring against 1 liter of 0.01 x TE at 4°C, the DNA was concentrated with PEG (4°C) and redialyzed. Library preparation: About 1.5 microgramms of isolated DNA, forum DNA, (see above) was ligated with 70 ng of double-stranded oligonucleotide containing EcoRI and PstI sites (25 bp long 5'-phosphorylated 5' pCCCCTGCAGTATAAGGAGAATTCGGG 3' oligonucleotide annealed with 26 bp long 5' biotinylated 5' bio-CCGAATTCTCCTTATACTGCAGGGG 3' oligonucleotide) in 150 microliters of solution containing 0.1 M NaCl, 50 mM Tris HCl (pH 7.4), 8 mM MgCl2, 9 mM 2-mercaptoethanol, 7 microM ATP, 7.5 % PEG, and 40 units of T4 DNA ligase at 20°C for 16 hr. After heating at 65°C for 10 min the DNA preparation was digested with Sau3A enzyme to shorten the forum domain to the termini attached to the ligated oligonicleotide. The selection of such termini was performed in 0.5 ml eppendorf tubes using 300 microliters of suspension containing streptavidin magnespere paramagnetic particles, SA-PMP (Promega) according to the manufacturer's recommendations. After extensive washing with 0.5xSSC removing DNA fragments corresponding to internal parts of forum domains, the forum termini (FT) DNA preparation was eluted from the SA-PMP using digestion with EcoRI enzyme in final volume of 50?mictolitres (double-stranded FT). The FT were then ligated with 100x molar excess of double-stranded Sau3A adaptor (5'-phosphorylated 5' pGATCGTTTGCGGCCGCTTAAGCTTGGG 3' oligonucleotide annealed with 5' CCCAAGCTTAAGCGGCCGCAAAC 3' oligonucleotide). In some experiments (FT) DNA preparation was eluted from the SA-PMP using heating by incubation at 100°C for 3 min in 50 microliters of 0.01xTE (single-stranded FT). Before heating the FT preparation was ligated with100x molar excess of double-stranded Sau3A adaptor in suspension with SA-PMP (see above). Both final DNA samples (double-stranded FT or single-stranded FT) were used for PCR amplifications. 40 cycle PCR amplification in 30 microlitersl of a solution containing 67 mM Tris-HCl (pH 8.4); 6 mM MgCl2; 10 mM 2-mercaptoethanol; 16.6 mM ammonium sulfate; 6.7 microM EDTA; 5 microg/ml BSA; 1 mM dNTPs; 1 microg of primer corresponding to Sau3A adaptor (5' CCCAAGCTTAAGCGGCCGCAAAC 3'); 1 microg of primer corresponding to biotinilated oligonucleotide (5' CCGAATTCTCCTTATACTGCAGGGG 3') and 1 u of Taq polymerase was performed using Eppendorf Mastercycler Personal. Amplification conditions were 90°C for melting, 65°C for annealing and 72°C for extension, for 1 min each. Both final DNA samples (double-stranded FT or single-stranded FT) were used for PCR amplifications. 40 cycle PCR amplification in 30 microlitersl of a solution containing 67 mM Tris-HCl (pH 8.4); 6 mM MgCl2; 10 mM 2-mercaptoethanol; 16.6 mM ammonium sulfate; 6.7 microM EDTA; 5 microg/ml BSA; 1 mM dNTPs; 1 microg of primer corresponding to Sau3A adaptor (5' CCCAAGCTTAAGCGGCCGCAAAC 3'); 1 microg of primer corresponding to biotinilated oligonucleotide (5' CCGAATTCTCCTTATACTGCAGGGG 3') and 1 u of Taq polymerase was performed using Eppendorf Mastercycler Personal. Amplification conditions were 90°C for melting, 65°C for annealing and 72°C for extension, for 1 min each. Deep sequencing of libraries were performed using HiSeq1500 (Illumina) in Paired-End mode using 100-nt long reads. Illumina HiSeq 1500