SRX18306018 GSM6739111_r1 SRP408588 PRJNA903134 SRS15796696 GSM6739111 GSM6739111 OTHER GENOMIC other At screen end point cells were harvested and gDNA was extracted with QIAamp DNA Blood Maxi Kit (Qiagen #51194). Genome weight was estimated based on measured ploidy of cells. The sequencing library was prepared using NEBnext® Ultra II Q5 Master Mix (NEB #M0544) and custom primers (forward i5: 5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT[N]cccttggagaaccaccttgTTG-3' with N=(0-8) nt stagger and reverse primer for multiplexing: 5'-CAAGCAGAAGACGGCATACGAGAT[8N]GTGACTGGAGTTCAGACGTG-3') to have a balanced read sample. A barcode in the reverse primer was used for identification of the sequencing libraries. Libraries were gel purified and cleaned up. Libraries were balanced and quality was assessed with Bioanalyzer High Sensitivity DNA Kit, Agilent #5067-4626). R1 was used for sgRNA identification, R2 was used to read out barcode associated with each single sgRNA in the pool Illumina HiSeq 4000 SRX18306019 GSM6739112_r1 SRP408588 PRJNA903134 SRS15796698 GSM6739112 GSM6739112 OTHER GENOMIC other At screen end point cells were harvested and gDNA was extracted with QIAamp DNA Blood Maxi Kit (Qiagen #51194). Genome weight was estimated based on measured ploidy of cells. The sequencing library was prepared using NEBnext® Ultra II Q5 Master Mix (NEB #M0544) and custom primers (forward i5: 5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT[N]cccttggagaaccaccttgTTG-3' with N=(0-8) nt stagger and reverse primer for multiplexing: 5'-CAAGCAGAAGACGGCATACGAGAT[8N]GTGACTGGAGTTCAGACGTG-3') to have a balanced read sample. A barcode in the reverse primer was used for identification of the sequencing libraries. Libraries were gel purified and cleaned up. Libraries were balanced and quality was assessed with Bioanalyzer High Sensitivity DNA Kit, Agilent #5067-4626). R1 was used for sgRNA identification, R2 was used to read out barcode associated with each single sgRNA in the pool NextSeq 550 SRX18306020 GSM6739113_r1 SRP408588 PRJNA903134 SRS15796697 GSM6739113 GSM6739113 OTHER GENOMIC other At screen end point cells were harvested and gDNA was extracted with QIAamp DNA Blood Maxi Kit (Qiagen #51194). Genome weight was estimated based on measured ploidy of cells. The sequencing library was prepared using NEBnext® Ultra II Q5 Master Mix (NEB #M0544) and custom primers (forward i5: 5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT[N]cccttggagaaccaccttgTTG-3' with N=(0-8) nt stagger and reverse primer for multiplexing: 5'-CAAGCAGAAGACGGCATACGAGAT[8N]GTGACTGGAGTTCAGACGTG-3') to have a balanced read sample. A barcode in the reverse primer was used for identification of the sequencing libraries. Libraries were gel purified and cleaned up. Libraries were balanced and quality was assessed with Bioanalyzer High Sensitivity DNA Kit, Agilent #5067-4626). R1 was used for sgRNA identification, R2 was used to read out barcode associated with each single sgRNA in the pool Illumina HiSeq 4000 SRX18306021 GSM6739115_r1 SRP408588 PRJNA903134 SRS15796699 GSM6739115 GSM6739115 OTHER GENOMIC other At screen end point cells were harvested and gDNA was extracted with QIAamp DNA Blood Maxi Kit (Qiagen #51194). Genome weight was estimated based on measured ploidy of cells. The sequencing library was prepared using NEBnext® Ultra II Q5 Master Mix (NEB #M0544) and custom primers (forward i5: 5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT[N]cccttggagaaccaccttgTTG-3' with N=(0-8) nt stagger and reverse primer for multiplexing: 5'-CAAGCAGAAGACGGCATACGAGAT[8N]GTGACTGGAGTTCAGACGTG-3') to have a balanced read sample. A barcode in the reverse primer was used for identification of the sequencing libraries. Libraries were gel purified and cleaned up. Libraries were balanced and quality was assessed with Bioanalyzer High Sensitivity DNA Kit, Agilent #5067-4626). R1 was used for sgRNA identification, R2 was used to read out barcode associated with each single sgRNA in the pool Illumina HiSeq 4000 SRX18306022 GSM6739116_r1 SRP408588 PRJNA903134 SRS15796700 GSM6739116 GSM6739116 OTHER GENOMIC other At screen end point cells were harvested and gDNA was extracted with QIAamp DNA Blood Maxi Kit (Qiagen #51194). Genome weight was estimated based on measured ploidy of cells. The sequencing library was prepared using NEBnext® Ultra II Q5 Master Mix (NEB #M0544) and custom primers (forward i5: 5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT[N]cccttggagaaccaccttgTTG-3' with N=(0-8) nt stagger and reverse primer for multiplexing: 5'-CAAGCAGAAGACGGCATACGAGAT[8N]GTGACTGGAGTTCAGACGTG-3') to have a balanced read sample. A barcode in the reverse primer was used for identification of the sequencing libraries. Libraries were gel purified and cleaned up. Libraries were balanced and quality was assessed with Bioanalyzer High Sensitivity DNA Kit, Agilent #5067-4626). R1 was used for sgRNA identification, R2 was used to read out barcode associated with each single sgRNA in the pool NextSeq 550 SRX18306023 GSM6739114_r1 SRP408588 PRJNA903134 SRS15796701 GSM6739114 GSM6739114 OTHER GENOMIC other At screen end point cells were harvested and gDNA was extracted with QIAamp DNA Blood Maxi Kit (Qiagen #51194). Genome weight was estimated based on measured ploidy of cells. The sequencing library was prepared using NEBnext® Ultra II Q5 Master Mix (NEB #M0544) and custom primers (forward i5: 5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT[N]cccttggagaaccaccttgTTG-3' with N=(0-8) nt stagger and reverse primer for multiplexing: 5'-CAAGCAGAAGACGGCATACGAGAT[8N]GTGACTGGAGTTCAGACGTG-3') to have a balanced read sample. A barcode in the reverse primer was used for identification of the sequencing libraries. Libraries were gel purified and cleaned up. Libraries were balanced and quality was assessed with Bioanalyzer High Sensitivity DNA Kit, Agilent #5067-4626). R1 was used for sgRNA identification, R2 was used to read out barcode associated with each single sgRNA in the pool NextSeq 550 SRX18306024 GSM6739117_r1 SRP408588 PRJNA903134 SRS15796702 GSM6739117 GSM6739117 OTHER GENOMIC other At screen end point cells were harvested and gDNA was extracted with QIAamp DNA Blood Maxi Kit (Qiagen #51194). Genome weight was estimated based on measured ploidy of cells. The sequencing library was prepared using NEBnext® Ultra II Q5 Master Mix (NEB #M0544) and custom primers (forward i5: 5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT[N]cccttggagaaccaccttgTTG-3' with N=(0-8) nt stagger and reverse primer for multiplexing: 5'-CAAGCAGAAGACGGCATACGAGAT[8N]GTGACTGGAGTTCAGACGTG-3') to have a balanced read sample. A barcode in the reverse primer was used for identification of the sequencing libraries. Libraries were gel purified and cleaned up. Libraries were balanced and quality was assessed with Bioanalyzer High Sensitivity DNA Kit, Agilent #5067-4626). R1 was used for sgRNA identification, R2 was used to read out barcode associated with each single sgRNA in the pool Illumina HiSeq 4000 SRX18306025 GSM6739118_r1 SRP408588 PRJNA903134 SRS15796703 GSM6739118 GSM6739118 OTHER GENOMIC other At screen end point cells were harvested and gDNA was extracted with QIAamp DNA Blood Maxi Kit (Qiagen #51194). Genome weight was estimated based on measured ploidy of cells. The sequencing library was prepared using NEBnext® Ultra II Q5 Master Mix (NEB #M0544) and custom primers (forward i5: 5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT[N]cccttggagaaccaccttgTTG-3' with N=(0-8) nt stagger and reverse primer for multiplexing: 5'-CAAGCAGAAGACGGCATACGAGAT[8N]GTGACTGGAGTTCAGACGTG-3') to have a balanced read sample. A barcode in the reverse primer was used for identification of the sequencing libraries. Libraries were gel purified and cleaned up. Libraries were balanced and quality was assessed with Bioanalyzer High Sensitivity DNA Kit, Agilent #5067-4626). R1 was used for sgRNA identification, R2 was used to read out barcode associated with each single sgRNA in the pool NextSeq 550 SRX18306026 GSM6739119_r1 SRP408588 PRJNA903134 SRS15796704 GSM6739119 GSM6739119 OTHER GENOMIC other At screen end point cells were harvested and gDNA was extracted with QIAamp DNA Blood Maxi Kit (Qiagen #51194). Genome weight was estimated based on measured ploidy of cells. The sequencing library was prepared using NEBnext® Ultra II Q5 Master Mix (NEB #M0544) and custom primers (forward i5: 5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT[N]cccttggagaaccaccttgTTG-3' with N=(0-8) nt stagger and reverse primer for multiplexing: 5'-CAAGCAGAAGACGGCATACGAGAT[8N]GTGACTGGAGTTCAGACGTG-3') to have a balanced read sample. A barcode in the reverse primer was used for identification of the sequencing libraries. Libraries were gel purified and cleaned up. Libraries were balanced and quality was assessed with Bioanalyzer High Sensitivity DNA Kit, Agilent #5067-4626). R1 was used for sgRNA identification, R2 was used to read out barcode associated with each single sgRNA in the pool NextSeq 550 SRX18306027 GSM6739120_r1 SRP408588 PRJNA903134 SRS15796705 GSM6739120 GSM6739120 OTHER GENOMIC other At screen end point cells were harvested and gDNA was extracted with QIAamp DNA Blood Maxi Kit (Qiagen #51194). Genome weight was estimated based on measured ploidy of cells. The sequencing library was prepared using NEBnext® Ultra II Q5 Master Mix (NEB #M0544) and custom primers (forward i5: 5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT[N]cccttggagaaccaccttgTTG-3' with N=(0-8) nt stagger and reverse primer for multiplexing: 5'-CAAGCAGAAGACGGCATACGAGAT[8N]GTGACTGGAGTTCAGACGTG-3') to have a balanced read sample. A barcode in the reverse primer was used for identification of the sequencing libraries. Libraries were gel purified and cleaned up. Libraries were balanced and quality was assessed with Bioanalyzer High Sensitivity DNA Kit, Agilent #5067-4626). R1 was used for sgRNA identification, R2 was used to read out barcode associated with each single sgRNA in the pool NextSeq 550