SRX23306398 GSM8024286_r1 SRP484603 PRJNA1066367 SRS20608757 GSM8024286 GSM8024286 ncRNA-Seq TRANSCRIPTOMIC size fractionation Small RNA sequencing was performed on whole guts, ovaries and sorted Red stinger positive cells (ISCs + EBs). For the whole guts, flies were dissected in cold PBS 16 hours after being fed with Pe or 5% sucrose. The crop, the Malpighian tubules and the hindgut were carefully removed. 40 midguts have been dissected per replicate for each condition. Collected tissues were transferred in an Eppendorf tube containing 400 µL of PBS and kept on ice. Once all the tissues were dissected, 10 µL of elastase (Sigma-Aldrich, 10 µg/ µL) was added in each Eppendorf. Samples were kept at 27°C in a heat block for at least 1 hour until the tissues were totally degraded. Tissues were disrupted by pipetting up and down every 5 minutes. Samples were then centrifuged at 300 rcf for 20 minutes at 4°C and the supernatant was removed to obtain cell pellets. The same protocol has been applied for the ovaries. About 10 pairs of ovaries have been dissected per genotype. The Red stinger positive cells (ISCs + EBs) were collected from 250 ~ 500 midguts that were treated with elastase as above. Cells have been sorted using the fluorescence-activated single cell sorting. About 250000 to 750000 cells were collected per replicate. Total RNA was extracted by TRIZOL (Invitrogen) and the genomic DNA was removed by DNase I (Thermo Fisher). Small RNAs were first size-selected from the total RNA by 12% w/v UREA-PAGE using radio-labelled 19mer (5′-CGUACGCGGGUUUAAACGA) and 35mer (5'-CUCAUCUUGGUCGUACGCGGAAUAGUUUAAACUGU) spikes, and oxidised using sodium periodate. The oxidised small RNAs were further size-selected by PAGE. The size-selected oxidised small RNAs were ligated to the 3' adapter 5rApp/NNNNAGATCGGAAGAGCACACGTCT/3ddC, and then to the 5' adapter ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised. The first strand cDNA synthesis was performed using SuperScript II (Thermo Fisher) and the RT primer GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT. The library was amplified using KAPA LongRange DNA polymerase (Sigma) with a universal TruSeq forward primer (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT) and a barcode-containing TruSeq reverse primer (e.g. CAAGCAGAAGACGGCATACGAGATxxxxxxGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT where xxxxxx were the barcode). Illumina HiSeq 2500 SRX23306399 GSM8024287_r1 SRP484603 PRJNA1066367 SRS20608748 GSM8024287 GSM8024287 ncRNA-Seq TRANSCRIPTOMIC size fractionation Small RNA sequencing was performed on whole guts, ovaries and sorted Red stinger positive cells (ISCs + EBs). For the whole guts, flies were dissected in cold PBS 16 hours after being fed with Pe or 5% sucrose. The crop, the Malpighian tubules and the hindgut were carefully removed. 40 midguts have been dissected per replicate for each condition. Collected tissues were transferred in an Eppendorf tube containing 400 µL of PBS and kept on ice. Once all the tissues were dissected, 10 µL of elastase (Sigma-Aldrich, 10 µg/ µL) was added in each Eppendorf. Samples were kept at 27°C in a heat block for at least 1 hour until the tissues were totally degraded. Tissues were disrupted by pipetting up and down every 5 minutes. Samples were then centrifuged at 300 rcf for 20 minutes at 4°C and the supernatant was removed to obtain cell pellets. The same protocol has been applied for the ovaries. About 10 pairs of ovaries have been dissected per genotype. The Red stinger positive cells (ISCs + EBs) were collected from 250 ~ 500 midguts that were treated with elastase as above. Cells have been sorted using the fluorescence-activated single cell sorting. About 250000 to 750000 cells were collected per replicate. Total RNA was extracted by TRIZOL (Invitrogen) and the genomic DNA was removed by DNase I (Thermo Fisher). Small RNAs were first size-selected from the total RNA by 12% w/v UREA-PAGE using radio-labelled 19mer (5′-CGUACGCGGGUUUAAACGA) and 35mer (5'-CUCAUCUUGGUCGUACGCGGAAUAGUUUAAACUGU) spikes, and oxidised using sodium periodate. The oxidised small RNAs were further size-selected by PAGE. The size-selected oxidised small RNAs were ligated to the 3' adapter 5rApp/NNNNAGATCGGAAGAGCACACGTCT/3ddC, and then to the 5' adapter ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised. The first strand cDNA synthesis was performed using SuperScript II (Thermo Fisher) and the RT primer GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT. The library was amplified using KAPA LongRange DNA polymerase (Sigma) with a universal TruSeq forward primer (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT) and a barcode-containing TruSeq reverse primer (e.g. CAAGCAGAAGACGGCATACGAGATxxxxxxGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT where xxxxxx were the barcode). Illumina HiSeq 2500 SRX23306400 GSM8024288_r1 SRP484603 PRJNA1066367 SRS20608752 GSM8024288 GSM8024288 ncRNA-Seq TRANSCRIPTOMIC size fractionation Small RNA sequencing was performed on whole guts, ovaries and sorted Red stinger positive cells (ISCs + EBs). For the whole guts, flies were dissected in cold PBS 16 hours after being fed with Pe or 5% sucrose. The crop, the Malpighian tubules and the hindgut were carefully removed. 40 midguts have been dissected per replicate for each condition. Collected tissues were transferred in an Eppendorf tube containing 400 µL of PBS and kept on ice. Once all the tissues were dissected, 10 µL of elastase (Sigma-Aldrich, 10 µg/ µL) was added in each Eppendorf. Samples were kept at 27°C in a heat block for at least 1 hour until the tissues were totally degraded. Tissues were disrupted by pipetting up and down every 5 minutes. Samples were then centrifuged at 300 rcf for 20 minutes at 4°C and the supernatant was removed to obtain cell pellets. The same protocol has been applied for the ovaries. About 10 pairs of ovaries have been dissected per genotype. The Red stinger positive cells (ISCs + EBs) were collected from 250 ~ 500 midguts that were treated with elastase as above. Cells have been sorted using the fluorescence-activated single cell sorting. About 250000 to 750000 cells were collected per replicate. Total RNA was extracted by TRIZOL (Invitrogen) and the genomic DNA was removed by DNase I (Thermo Fisher). Small RNAs were first size-selected from the total RNA by 12% w/v UREA-PAGE using radio-labelled 19mer (5′-CGUACGCGGGUUUAAACGA) and 35mer (5'-CUCAUCUUGGUCGUACGCGGAAUAGUUUAAACUGU) spikes, and oxidised using sodium periodate. The oxidised small RNAs were further size-selected by PAGE. The size-selected oxidised small RNAs were ligated to the 3' adapter 5rApp/NNNNAGATCGGAAGAGCACACGTCT/3ddC, and then to the 5' adapter ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised. The first strand cDNA synthesis was performed using SuperScript II (Thermo Fisher) and the RT primer GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT. The library was amplified using KAPA LongRange DNA polymerase (Sigma) with a universal TruSeq forward primer (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT) and a barcode-containing TruSeq reverse primer (e.g. CAAGCAGAAGACGGCATACGAGATxxxxxxGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT where xxxxxx were the barcode). Illumina HiSeq 2500 SRX23306401 GSM8024289_r1 SRP484603 PRJNA1066367 SRS20608755 GSM8024289 GSM8024289 ncRNA-Seq TRANSCRIPTOMIC size fractionation Small RNA sequencing was performed on whole guts, ovaries and sorted Red stinger positive cells (ISCs + EBs). For the whole guts, flies were dissected in cold PBS 16 hours after being fed with Pe or 5% sucrose. The crop, the Malpighian tubules and the hindgut were carefully removed. 40 midguts have been dissected per replicate for each condition. Collected tissues were transferred in an Eppendorf tube containing 400 µL of PBS and kept on ice. Once all the tissues were dissected, 10 µL of elastase (Sigma-Aldrich, 10 µg/ µL) was added in each Eppendorf. Samples were kept at 27°C in a heat block for at least 1 hour until the tissues were totally degraded. Tissues were disrupted by pipetting up and down every 5 minutes. Samples were then centrifuged at 300 rcf for 20 minutes at 4°C and the supernatant was removed to obtain cell pellets. The same protocol has been applied for the ovaries. About 10 pairs of ovaries have been dissected per genotype. The Red stinger positive cells (ISCs + EBs) were collected from 250 ~ 500 midguts that were treated with elastase as above. Cells have been sorted using the fluorescence-activated single cell sorting. About 250000 to 750000 cells were collected per replicate. Total RNA was extracted by TRIZOL (Invitrogen) and the genomic DNA was removed by DNase I (Thermo Fisher). Small RNAs were first size-selected from the total RNA by 12% w/v UREA-PAGE using radio-labelled 19mer (5′-CGUACGCGGGUUUAAACGA) and 35mer (5'-CUCAUCUUGGUCGUACGCGGAAUAGUUUAAACUGU) spikes, and oxidised using sodium periodate. The oxidised small RNAs were further size-selected by PAGE. The size-selected oxidised small RNAs were ligated to the 3' adapter 5rApp/NNNNAGATCGGAAGAGCACACGTCT/3ddC, and then to the 5' adapter ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised. The first strand cDNA synthesis was performed using SuperScript II (Thermo Fisher) and the RT primer GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT. The library was amplified using KAPA LongRange DNA polymerase (Sigma) with a universal TruSeq forward primer (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT) and a barcode-containing TruSeq reverse primer (e.g. CAAGCAGAAGACGGCATACGAGATxxxxxxGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT where xxxxxx were the barcode). Illumina HiSeq 2500 SRX23306402 GSM8024290_r1 SRP484603 PRJNA1066367 SRS20608751 GSM8024290 GSM8024290 ncRNA-Seq TRANSCRIPTOMIC size fractionation Small RNA sequencing was performed on whole guts, ovaries and sorted Red stinger positive cells (ISCs + EBs). For the whole guts, flies were dissected in cold PBS 16 hours after being fed with Pe or 5% sucrose. The crop, the Malpighian tubules and the hindgut were carefully removed. 40 midguts have been dissected per replicate for each condition. Collected tissues were transferred in an Eppendorf tube containing 400 µL of PBS and kept on ice. Once all the tissues were dissected, 10 µL of elastase (Sigma-Aldrich, 10 µg/ µL) was added in each Eppendorf. Samples were kept at 27°C in a heat block for at least 1 hour until the tissues were totally degraded. Tissues were disrupted by pipetting up and down every 5 minutes. Samples were then centrifuged at 300 rcf for 20 minutes at 4°C and the supernatant was removed to obtain cell pellets. The same protocol has been applied for the ovaries. About 10 pairs of ovaries have been dissected per genotype. The Red stinger positive cells (ISCs + EBs) were collected from 250 ~ 500 midguts that were treated with elastase as above. Cells have been sorted using the fluorescence-activated single cell sorting. About 250000 to 750000 cells were collected per replicate. Total RNA was extracted by TRIZOL (Invitrogen) and the genomic DNA was removed by DNase I (Thermo Fisher). Small RNAs were first size-selected from the total RNA by 12% w/v UREA-PAGE using radio-labelled 19mer (5′-CGUACGCGGGUUUAAACGA) and 35mer (5'-CUCAUCUUGGUCGUACGCGGAAUAGUUUAAACUGU) spikes, and oxidised using sodium periodate. The oxidised small RNAs were further size-selected by PAGE. The size-selected oxidised small RNAs were ligated to the 3' adapter 5rApp/NNNNAGATCGGAAGAGCACACGTCT/3ddC, and then to the 5' adapter ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised. The first strand cDNA synthesis was performed using SuperScript II (Thermo Fisher) and the RT primer GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT. The library was amplified using KAPA LongRange DNA polymerase (Sigma) with a universal TruSeq forward primer (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT) and a barcode-containing TruSeq reverse primer (e.g. CAAGCAGAAGACGGCATACGAGATxxxxxxGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT where xxxxxx were the barcode). Illumina HiSeq 2500 SRX23306403 GSM8024291_r1 SRP484603 PRJNA1066367 SRS20608750 GSM8024291 GSM8024291 ncRNA-Seq TRANSCRIPTOMIC size fractionation Small RNA sequencing was performed on whole guts, ovaries and sorted Red stinger positive cells (ISCs + EBs). For the whole guts, flies were dissected in cold PBS 16 hours after being fed with Pe or 5% sucrose. The crop, the Malpighian tubules and the hindgut were carefully removed. 40 midguts have been dissected per replicate for each condition. Collected tissues were transferred in an Eppendorf tube containing 400 µL of PBS and kept on ice. Once all the tissues were dissected, 10 µL of elastase (Sigma-Aldrich, 10 µg/ µL) was added in each Eppendorf. Samples were kept at 27°C in a heat block for at least 1 hour until the tissues were totally degraded. Tissues were disrupted by pipetting up and down every 5 minutes. Samples were then centrifuged at 300 rcf for 20 minutes at 4°C and the supernatant was removed to obtain cell pellets. The same protocol has been applied for the ovaries. About 10 pairs of ovaries have been dissected per genotype. The Red stinger positive cells (ISCs + EBs) were collected from 250 ~ 500 midguts that were treated with elastase as above. Cells have been sorted using the fluorescence-activated single cell sorting. About 250000 to 750000 cells were collected per replicate. Total RNA was extracted by TRIZOL (Invitrogen) and the genomic DNA was removed by DNase I (Thermo Fisher). Small RNAs were first size-selected from the total RNA by 12% w/v UREA-PAGE using radio-labelled 19mer (5′-CGUACGCGGGUUUAAACGA) and 35mer (5'-CUCAUCUUGGUCGUACGCGGAAUAGUUUAAACUGU) spikes, and oxidised using sodium periodate. The oxidised small RNAs were further size-selected by PAGE. The size-selected oxidised small RNAs were ligated to the 3' adapter 5rApp/NNNNAGATCGGAAGAGCACACGTCT/3ddC, and then to the 5' adapter ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised. The first strand cDNA synthesis was performed using SuperScript II (Thermo Fisher) and the RT primer GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT. The library was amplified using KAPA LongRange DNA polymerase (Sigma) with a universal TruSeq forward primer (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT) and a barcode-containing TruSeq reverse primer (e.g. CAAGCAGAAGACGGCATACGAGATxxxxxxGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT where xxxxxx were the barcode). Illumina HiSeq 2500 SRX23306404 GSM8024292_r1 SRP484603 PRJNA1066367 SRS20608756 GSM8024292 GSM8024292 ncRNA-Seq TRANSCRIPTOMIC size fractionation Small RNA sequencing was performed on whole guts, ovaries and sorted Red stinger positive cells (ISCs + EBs). For the whole guts, flies were dissected in cold PBS 16 hours after being fed with Pe or 5% sucrose. The crop, the Malpighian tubules and the hindgut were carefully removed. 40 midguts have been dissected per replicate for each condition. Collected tissues were transferred in an Eppendorf tube containing 400 µL of PBS and kept on ice. Once all the tissues were dissected, 10 µL of elastase (Sigma-Aldrich, 10 µg/ µL) was added in each Eppendorf. Samples were kept at 27°C in a heat block for at least 1 hour until the tissues were totally degraded. Tissues were disrupted by pipetting up and down every 5 minutes. Samples were then centrifuged at 300 rcf for 20 minutes at 4°C and the supernatant was removed to obtain cell pellets. The same protocol has been applied for the ovaries. About 10 pairs of ovaries have been dissected per genotype. The Red stinger positive cells (ISCs + EBs) were collected from 250 ~ 500 midguts that were treated with elastase as above. Cells have been sorted using the fluorescence-activated single cell sorting. About 250000 to 750000 cells were collected per replicate. Total RNA was extracted by TRIZOL (Invitrogen) and the genomic DNA was removed by DNase I (Thermo Fisher). Small RNAs were first size-selected from the total RNA by 12% w/v UREA-PAGE using radio-labelled 19mer (5′-CGUACGCGGGUUUAAACGA) and 35mer (5'-CUCAUCUUGGUCGUACGCGGAAUAGUUUAAACUGU) spikes, and oxidised using sodium periodate. The oxidised small RNAs were further size-selected by PAGE. The size-selected oxidised small RNAs were ligated to the 3' adapter 5rApp/NNNNAGATCGGAAGAGCACACGTCT/3ddC, and then to the 5' adapter ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised. The first strand cDNA synthesis was performed using SuperScript II (Thermo Fisher) and the RT primer GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT. The library was amplified using KAPA LongRange DNA polymerase (Sigma) with a universal TruSeq forward primer (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT) and a barcode-containing TruSeq reverse primer (e.g. CAAGCAGAAGACGGCATACGAGATxxxxxxGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT where xxxxxx were the barcode). Illumina HiSeq 2500 SRX23306405 GSM8024293_r1 SRP484603 PRJNA1066367 SRS20608753 GSM8024293 GSM8024293 ncRNA-Seq TRANSCRIPTOMIC size fractionation Small RNA sequencing was performed on whole guts, ovaries and sorted Red stinger positive cells (ISCs + EBs). For the whole guts, flies were dissected in cold PBS 16 hours after being fed with Pe or 5% sucrose. The crop, the Malpighian tubules and the hindgut were carefully removed. 40 midguts have been dissected per replicate for each condition. Collected tissues were transferred in an Eppendorf tube containing 400 µL of PBS and kept on ice. Once all the tissues were dissected, 10 µL of elastase (Sigma-Aldrich, 10 µg/ µL) was added in each Eppendorf. Samples were kept at 27°C in a heat block for at least 1 hour until the tissues were totally degraded. Tissues were disrupted by pipetting up and down every 5 minutes. Samples were then centrifuged at 300 rcf for 20 minutes at 4°C and the supernatant was removed to obtain cell pellets. The same protocol has been applied for the ovaries. About 10 pairs of ovaries have been dissected per genotype. The Red stinger positive cells (ISCs + EBs) were collected from 250 ~ 500 midguts that were treated with elastase as above. Cells have been sorted using the fluorescence-activated single cell sorting. About 250000 to 750000 cells were collected per replicate. Total RNA was extracted by TRIZOL (Invitrogen) and the genomic DNA was removed by DNase I (Thermo Fisher). Small RNAs were first size-selected from the total RNA by 12% w/v UREA-PAGE using radio-labelled 19mer (5′-CGUACGCGGGUUUAAACGA) and 35mer (5'-CUCAUCUUGGUCGUACGCGGAAUAGUUUAAACUGU) spikes, and oxidised using sodium periodate. The oxidised small RNAs were further size-selected by PAGE. The size-selected oxidised small RNAs were ligated to the 3' adapter 5rApp/NNNNAGATCGGAAGAGCACACGTCT/3ddC, and then to the 5' adapter ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised. The first strand cDNA synthesis was performed using SuperScript II (Thermo Fisher) and the RT primer GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT. The library was amplified using KAPA LongRange DNA polymerase (Sigma) with a universal TruSeq forward primer (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT) and a barcode-containing TruSeq reverse primer (e.g. CAAGCAGAAGACGGCATACGAGATxxxxxxGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT where xxxxxx were the barcode). Illumina HiSeq 2500 SRX23306406 GSM8024294_r1 SRP484603 PRJNA1066367 SRS20608754 GSM8024294 GSM8024294 ncRNA-Seq TRANSCRIPTOMIC size fractionation Small RNA sequencing was performed on whole guts, ovaries and sorted Red stinger positive cells (ISCs + EBs). For the whole guts, flies were dissected in cold PBS 16 hours after being fed with Pe or 5% sucrose. The crop, the Malpighian tubules and the hindgut were carefully removed. 40 midguts have been dissected per replicate for each condition. Collected tissues were transferred in an Eppendorf tube containing 400 µL of PBS and kept on ice. Once all the tissues were dissected, 10 µL of elastase (Sigma-Aldrich, 10 µg/ µL) was added in each Eppendorf. Samples were kept at 27°C in a heat block for at least 1 hour until the tissues were totally degraded. Tissues were disrupted by pipetting up and down every 5 minutes. Samples were then centrifuged at 300 rcf for 20 minutes at 4°C and the supernatant was removed to obtain cell pellets. The same protocol has been applied for the ovaries. About 10 pairs of ovaries have been dissected per genotype. The Red stinger positive cells (ISCs + EBs) were collected from 250 ~ 500 midguts that were treated with elastase as above. Cells have been sorted using the fluorescence-activated single cell sorting. About 250000 to 750000 cells were collected per replicate. Total RNA was extracted by TRIZOL (Invitrogen) and the genomic DNA was removed by DNase I (Thermo Fisher). Small RNAs were first size-selected from the total RNA by 12% w/v UREA-PAGE using radio-labelled 19mer (5′-CGUACGCGGGUUUAAACGA) and 35mer (5'-CUCAUCUUGGUCGUACGCGGAAUAGUUUAAACUGU) spikes, and oxidised using sodium periodate. The oxidised small RNAs were further size-selected by PAGE. The size-selected oxidised small RNAs were ligated to the 3' adapter 5rApp/NNNNAGATCGGAAGAGCACACGTCT/3ddC, and then to the 5' adapter ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised. The first strand cDNA synthesis was performed using SuperScript II (Thermo Fisher) and the RT primer GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT. The library was amplified using KAPA LongRange DNA polymerase (Sigma) with a universal TruSeq forward primer (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT) and a barcode-containing TruSeq reverse primer (e.g. CAAGCAGAAGACGGCATACGAGATxxxxxxGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT where xxxxxx were the barcode). Illumina HiSeq 2500 SRX23306407 GSM8024295_r1 SRP484603 PRJNA1066367 SRS20608761 GSM8024295 GSM8024295 ncRNA-Seq TRANSCRIPTOMIC size fractionation Small RNA sequencing was performed on whole guts, ovaries and sorted Red stinger positive cells (ISCs + EBs). For the whole guts, flies were dissected in cold PBS 16 hours after being fed with Pe or 5% sucrose. The crop, the Malpighian tubules and the hindgut were carefully removed. 40 midguts have been dissected per replicate for each condition. Collected tissues were transferred in an Eppendorf tube containing 400 µL of PBS and kept on ice. Once all the tissues were dissected, 10 µL of elastase (Sigma-Aldrich, 10 µg/ µL) was added in each Eppendorf. Samples were kept at 27°C in a heat block for at least 1 hour until the tissues were totally degraded. Tissues were disrupted by pipetting up and down every 5 minutes. Samples were then centrifuged at 300 rcf for 20 minutes at 4°C and the supernatant was removed to obtain cell pellets. The same protocol has been applied for the ovaries. About 10 pairs of ovaries have been dissected per genotype. The Red stinger positive cells (ISCs + EBs) were collected from 250 ~ 500 midguts that were treated with elastase as above. Cells have been sorted using the fluorescence-activated single cell sorting. About 250000 to 750000 cells were collected per replicate. Total RNA was extracted by TRIZOL (Invitrogen) and the genomic DNA was removed by DNase I (Thermo Fisher). Small RNAs were first size-selected from the total RNA by 12% w/v UREA-PAGE using radio-labelled 19mer (5′-CGUACGCGGGUUUAAACGA) and 35mer (5'-CUCAUCUUGGUCGUACGCGGAAUAGUUUAAACUGU) spikes, and oxidised using sodium periodate. The oxidised small RNAs were further size-selected by PAGE. The size-selected oxidised small RNAs were ligated to the 3' adapter 5rApp/NNNNAGATCGGAAGAGCACACGTCT/3ddC, and then to the 5' adapter ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised. The first strand cDNA synthesis was performed using SuperScript II (Thermo Fisher) and the RT primer GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT. The library was amplified using KAPA LongRange DNA polymerase (Sigma) with a universal TruSeq forward primer (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT) and a barcode-containing TruSeq reverse primer (e.g. CAAGCAGAAGACGGCATACGAGATxxxxxxGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT where xxxxxx were the barcode). Illumina HiSeq 2500 SRX23306408 GSM8024296_r1 SRP484603 PRJNA1066367 SRS20608764 GSM8024296 GSM8024296 ncRNA-Seq TRANSCRIPTOMIC size fractionation Small RNA sequencing was performed on whole guts, ovaries and sorted Red stinger positive cells (ISCs + EBs). For the whole guts, flies were dissected in cold PBS 16 hours after being fed with Pe or 5% sucrose. The crop, the Malpighian tubules and the hindgut were carefully removed. 40 midguts have been dissected per replicate for each condition. Collected tissues were transferred in an Eppendorf tube containing 400 µL of PBS and kept on ice. Once all the tissues were dissected, 10 µL of elastase (Sigma-Aldrich, 10 µg/ µL) was added in each Eppendorf. Samples were kept at 27°C in a heat block for at least 1 hour until the tissues were totally degraded. Tissues were disrupted by pipetting up and down every 5 minutes. Samples were then centrifuged at 300 rcf for 20 minutes at 4°C and the supernatant was removed to obtain cell pellets. The same protocol has been applied for the ovaries. About 10 pairs of ovaries have been dissected per genotype. The Red stinger positive cells (ISCs + EBs) were collected from 250 ~ 500 midguts that were treated with elastase as above. Cells have been sorted using the fluorescence-activated single cell sorting. About 250000 to 750000 cells were collected per replicate. Total RNA was extracted by TRIZOL (Invitrogen) and the genomic DNA was removed by DNase I (Thermo Fisher). Small RNAs were first size-selected from the total RNA by 12% w/v UREA-PAGE using radio-labelled 19mer (5′-CGUACGCGGGUUUAAACGA) and 35mer (5'-CUCAUCUUGGUCGUACGCGGAAUAGUUUAAACUGU) spikes, and oxidised using sodium periodate. The oxidised small RNAs were further size-selected by PAGE. The size-selected oxidised small RNAs were ligated to the 3' adapter 5rApp/NNNNAGATCGGAAGAGCACACGTCT/3ddC, and then to the 5' adapter ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised. The first strand cDNA synthesis was performed using SuperScript II (Thermo Fisher) and the RT primer GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT. The library was amplified using KAPA LongRange DNA polymerase (Sigma) with a universal TruSeq forward primer (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT) and a barcode-containing TruSeq reverse primer (e.g. CAAGCAGAAGACGGCATACGAGATxxxxxxGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT where xxxxxx were the barcode). Illumina HiSeq 2500 SRX23306409 GSM8024297_r1 SRP484603 PRJNA1066367 SRS20608758 GSM8024297 GSM8024297 ncRNA-Seq TRANSCRIPTOMIC size fractionation Small RNA sequencing was performed on whole guts, ovaries and sorted Red stinger positive cells (ISCs + EBs). For the whole guts, flies were dissected in cold PBS 16 hours after being fed with Pe or 5% sucrose. The crop, the Malpighian tubules and the hindgut were carefully removed. 40 midguts have been dissected per replicate for each condition. Collected tissues were transferred in an Eppendorf tube containing 400 µL of PBS and kept on ice. Once all the tissues were dissected, 10 µL of elastase (Sigma-Aldrich, 10 µg/ µL) was added in each Eppendorf. Samples were kept at 27°C in a heat block for at least 1 hour until the tissues were totally degraded. Tissues were disrupted by pipetting up and down every 5 minutes. Samples were then centrifuged at 300 rcf for 20 minutes at 4°C and the supernatant was removed to obtain cell pellets. The same protocol has been applied for the ovaries. About 10 pairs of ovaries have been dissected per genotype. The Red stinger positive cells (ISCs + EBs) were collected from 250 ~ 500 midguts that were treated with elastase as above. Cells have been sorted using the fluorescence-activated single cell sorting. About 250000 to 750000 cells were collected per replicate. Total RNA was extracted by TRIZOL (Invitrogen) and the genomic DNA was removed by DNase I (Thermo Fisher). Small RNAs were first size-selected from the total RNA by 12% w/v UREA-PAGE using radio-labelled 19mer (5′-CGUACGCGGGUUUAAACGA) and 35mer (5'-CUCAUCUUGGUCGUACGCGGAAUAGUUUAAACUGU) spikes, and oxidised using sodium periodate. The oxidised small RNAs were further size-selected by PAGE. The size-selected oxidised small RNAs were ligated to the 3' adapter 5rApp/NNNNAGATCGGAAGAGCACACGTCT/3ddC, and then to the 5' adapter ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised. The first strand cDNA synthesis was performed using SuperScript II (Thermo Fisher) and the RT primer GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT. The library was amplified using KAPA LongRange DNA polymerase (Sigma) with a universal TruSeq forward primer (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT) and a barcode-containing TruSeq reverse primer (e.g. CAAGCAGAAGACGGCATACGAGATxxxxxxGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT where xxxxxx were the barcode). Illumina HiSeq 2500 SRX23306410 GSM8024298_r1 SRP484603 PRJNA1066367 SRS20608766 GSM8024298 GSM8024298 ncRNA-Seq TRANSCRIPTOMIC size fractionation Small RNA sequencing was performed on whole guts, ovaries and sorted Red stinger positive cells (ISCs + EBs). For the whole guts, flies were dissected in cold PBS 16 hours after being fed with Pe or 5% sucrose. The crop, the Malpighian tubules and the hindgut were carefully removed. 40 midguts have been dissected per replicate for each condition. Collected tissues were transferred in an Eppendorf tube containing 400 µL of PBS and kept on ice. Once all the tissues were dissected, 10 µL of elastase (Sigma-Aldrich, 10 µg/ µL) was added in each Eppendorf. Samples were kept at 27°C in a heat block for at least 1 hour until the tissues were totally degraded. Tissues were disrupted by pipetting up and down every 5 minutes. Samples were then centrifuged at 300 rcf for 20 minutes at 4°C and the supernatant was removed to obtain cell pellets. The same protocol has been applied for the ovaries. About 10 pairs of ovaries have been dissected per genotype. The Red stinger positive cells (ISCs + EBs) were collected from 250 ~ 500 midguts that were treated with elastase as above. Cells have been sorted using the fluorescence-activated single cell sorting. About 250000 to 750000 cells were collected per replicate. Total RNA was extracted by TRIZOL (Invitrogen) and the genomic DNA was removed by DNase I (Thermo Fisher). Small RNAs were first size-selected from the total RNA by 12% w/v UREA-PAGE using radio-labelled 19mer (5′-CGUACGCGGGUUUAAACGA) and 35mer (5'-CUCAUCUUGGUCGUACGCGGAAUAGUUUAAACUGU) spikes, and oxidised using sodium periodate. The oxidised small RNAs were further size-selected by PAGE. The size-selected oxidised small RNAs were ligated to the 3' adapter 5rApp/NNNNAGATCGGAAGAGCACACGTCT/3ddC, and then to the 5' adapter ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised. The first strand cDNA synthesis was performed using SuperScript II (Thermo Fisher) and the RT primer GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT. The library was amplified using KAPA LongRange DNA polymerase (Sigma) with a universal TruSeq forward primer (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT) and a barcode-containing TruSeq reverse primer (e.g. CAAGCAGAAGACGGCATACGAGATxxxxxxGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT where xxxxxx were the barcode). Illumina HiSeq 2500 SRX23306411 GSM8024299_r1 SRP484603 PRJNA1066367 SRS20608759 GSM8024299 GSM8024299 ncRNA-Seq TRANSCRIPTOMIC size fractionation Small RNA sequencing was performed on whole guts, ovaries and sorted Red stinger positive cells (ISCs + EBs). For the whole guts, flies were dissected in cold PBS 16 hours after being fed with Pe or 5% sucrose. The crop, the Malpighian tubules and the hindgut were carefully removed. 40 midguts have been dissected per replicate for each condition. Collected tissues were transferred in an Eppendorf tube containing 400 µL of PBS and kept on ice. Once all the tissues were dissected, 10 µL of elastase (Sigma-Aldrich, 10 µg/ µL) was added in each Eppendorf. Samples were kept at 27°C in a heat block for at least 1 hour until the tissues were totally degraded. Tissues were disrupted by pipetting up and down every 5 minutes. Samples were then centrifuged at 300 rcf for 20 minutes at 4°C and the supernatant was removed to obtain cell pellets. The same protocol has been applied for the ovaries. About 10 pairs of ovaries have been dissected per genotype. The Red stinger positive cells (ISCs + EBs) were collected from 250 ~ 500 midguts that were treated with elastase as above. Cells have been sorted using the fluorescence-activated single cell sorting. About 250000 to 750000 cells were collected per replicate. Total RNA was extracted by TRIZOL (Invitrogen) and the genomic DNA was removed by DNase I (Thermo Fisher). Small RNAs were first size-selected from the total RNA by 12% w/v UREA-PAGE using radio-labelled 19mer (5′-CGUACGCGGGUUUAAACGA) and 35mer (5'-CUCAUCUUGGUCGUACGCGGAAUAGUUUAAACUGU) spikes, and oxidised using sodium periodate. The oxidised small RNAs were further size-selected by PAGE. The size-selected oxidised small RNAs were ligated to the 3' adapter 5rApp/NNNNAGATCGGAAGAGCACACGTCT/3ddC, and then to the 5' adapter ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised. The first strand cDNA synthesis was performed using SuperScript II (Thermo Fisher) and the RT primer GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT. The library was amplified using KAPA LongRange DNA polymerase (Sigma) with a universal TruSeq forward primer (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT) and a barcode-containing TruSeq reverse primer (e.g. CAAGCAGAAGACGGCATACGAGATxxxxxxGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT where xxxxxx were the barcode). Illumina HiSeq 2500 SRX23306412 GSM8024300_r1 SRP484603 PRJNA1066367 SRS20608767 GSM8024300 GSM8024300 ncRNA-Seq TRANSCRIPTOMIC size fractionation Small RNA sequencing was performed on whole guts, ovaries and sorted Red stinger positive cells (ISCs + EBs). For the whole guts, flies were dissected in cold PBS 16 hours after being fed with Pe or 5% sucrose. The crop, the Malpighian tubules and the hindgut were carefully removed. 40 midguts have been dissected per replicate for each condition. Collected tissues were transferred in an Eppendorf tube containing 400 µL of PBS and kept on ice. Once all the tissues were dissected, 10 µL of elastase (Sigma-Aldrich, 10 µg/ µL) was added in each Eppendorf. Samples were kept at 27°C in a heat block for at least 1 hour until the tissues were totally degraded. Tissues were disrupted by pipetting up and down every 5 minutes. Samples were then centrifuged at 300 rcf for 20 minutes at 4°C and the supernatant was removed to obtain cell pellets. The same protocol has been applied for the ovaries. About 10 pairs of ovaries have been dissected per genotype. The Red stinger positive cells (ISCs + EBs) were collected from 250 ~ 500 midguts that were treated with elastase as above. Cells have been sorted using the fluorescence-activated single cell sorting. About 250000 to 750000 cells were collected per replicate. Total RNA was extracted by TRIZOL (Invitrogen) and the genomic DNA was removed by DNase I (Thermo Fisher). Small RNAs were first size-selected from the total RNA by 12% w/v UREA-PAGE using radio-labelled 19mer (5′-CGUACGCGGGUUUAAACGA) and 35mer (5'-CUCAUCUUGGUCGUACGCGGAAUAGUUUAAACUGU) spikes, and oxidised using sodium periodate. The oxidised small RNAs were further size-selected by PAGE. The size-selected oxidised small RNAs were ligated to the 3' adapter 5rApp/NNNNAGATCGGAAGAGCACACGTCT/3ddC, and then to the 5' adapter ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised. The first strand cDNA synthesis was performed using SuperScript II (Thermo Fisher) and the RT primer GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT. The library was amplified using KAPA LongRange DNA polymerase (Sigma) with a universal TruSeq forward primer (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT) and a barcode-containing TruSeq reverse primer (e.g. CAAGCAGAAGACGGCATACGAGATxxxxxxGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT where xxxxxx were the barcode). Illumina HiSeq 2500 SRX23306413 GSM8024301_r1 SRP484603 PRJNA1066367 SRS20608763 GSM8024301 GSM8024301 ncRNA-Seq TRANSCRIPTOMIC size fractionation Small RNA sequencing was performed on whole guts, ovaries and sorted Red stinger positive cells (ISCs + EBs). For the whole guts, flies were dissected in cold PBS 16 hours after being fed with Pe or 5% sucrose. The crop, the Malpighian tubules and the hindgut were carefully removed. 40 midguts have been dissected per replicate for each condition. Collected tissues were transferred in an Eppendorf tube containing 400 µL of PBS and kept on ice. Once all the tissues were dissected, 10 µL of elastase (Sigma-Aldrich, 10 µg/ µL) was added in each Eppendorf. Samples were kept at 27°C in a heat block for at least 1 hour until the tissues were totally degraded. Tissues were disrupted by pipetting up and down every 5 minutes. Samples were then centrifuged at 300 rcf for 20 minutes at 4°C and the supernatant was removed to obtain cell pellets. The same protocol has been applied for the ovaries. About 10 pairs of ovaries have been dissected per genotype. The Red stinger positive cells (ISCs + EBs) were collected from 250 ~ 500 midguts that were treated with elastase as above. Cells have been sorted using the fluorescence-activated single cell sorting. About 250000 to 750000 cells were collected per replicate. Total RNA was extracted by TRIZOL (Invitrogen) and the genomic DNA was removed by DNase I (Thermo Fisher). Small RNAs were first size-selected from the total RNA by 12% w/v UREA-PAGE using radio-labelled 19mer (5′-CGUACGCGGGUUUAAACGA) and 35mer (5'-CUCAUCUUGGUCGUACGCGGAAUAGUUUAAACUGU) spikes, and oxidised using sodium periodate. The oxidised small RNAs were further size-selected by PAGE. The size-selected oxidised small RNAs were ligated to the 3' adapter 5rApp/NNNNAGATCGGAAGAGCACACGTCT/3ddC, and then to the 5' adapter ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised. The first strand cDNA synthesis was performed using SuperScript II (Thermo Fisher) and the RT primer GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT. The library was amplified using KAPA LongRange DNA polymerase (Sigma) with a universal TruSeq forward primer (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT) and a barcode-containing TruSeq reverse primer (e.g. CAAGCAGAAGACGGCATACGAGATxxxxxxGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT where xxxxxx were the barcode). Illumina HiSeq 2500 SRX23306414 GSM8024302_r1 SRP484603 PRJNA1066367 SRS20608765 GSM8024302 GSM8024302 ncRNA-Seq TRANSCRIPTOMIC size fractionation Small RNA sequencing was performed on whole guts, ovaries and sorted Red stinger positive cells (ISCs + EBs). For the whole guts, flies were dissected in cold PBS 16 hours after being fed with Pe or 5% sucrose. The crop, the Malpighian tubules and the hindgut were carefully removed. 40 midguts have been dissected per replicate for each condition. Collected tissues were transferred in an Eppendorf tube containing 400 µL of PBS and kept on ice. Once all the tissues were dissected, 10 µL of elastase (Sigma-Aldrich, 10 µg/ µL) was added in each Eppendorf. Samples were kept at 27°C in a heat block for at least 1 hour until the tissues were totally degraded. Tissues were disrupted by pipetting up and down every 5 minutes. Samples were then centrifuged at 300 rcf for 20 minutes at 4°C and the supernatant was removed to obtain cell pellets. The same protocol has been applied for the ovaries. About 10 pairs of ovaries have been dissected per genotype. The Red stinger positive cells (ISCs + EBs) were collected from 250 ~ 500 midguts that were treated with elastase as above. Cells have been sorted using the fluorescence-activated single cell sorting. About 250000 to 750000 cells were collected per replicate. Total RNA was extracted by TRIZOL (Invitrogen) and the genomic DNA was removed by DNase I (Thermo Fisher). Small RNAs were first size-selected from the total RNA by 12% w/v UREA-PAGE using radio-labelled 19mer (5′-CGUACGCGGGUUUAAACGA) and 35mer (5'-CUCAUCUUGGUCGUACGCGGAAUAGUUUAAACUGU) spikes, and oxidised using sodium periodate. The oxidised small RNAs were further size-selected by PAGE. The size-selected oxidised small RNAs were ligated to the 3' adapter 5rApp/NNNNAGATCGGAAGAGCACACGTCT/3ddC, and then to the 5' adapter ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised. The first strand cDNA synthesis was performed using SuperScript II (Thermo Fisher) and the RT primer GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT. The library was amplified using KAPA LongRange DNA polymerase (Sigma) with a universal TruSeq forward primer (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT) and a barcode-containing TruSeq reverse primer (e.g. CAAGCAGAAGACGGCATACGAGATxxxxxxGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT where xxxxxx were the barcode). Illumina HiSeq 2500 SRX23306415 GSM8024311_r1 SRP484603 PRJNA1066367 SRS20608762 GSM8024311 GSM8024311 ncRNA-Seq TRANSCRIPTOMIC size fractionation Small RNA sequencing was performed on whole guts, ovaries and sorted Red stinger positive cells (ISCs + EBs). For the whole guts, flies were dissected in cold PBS 16 hours after being fed with Pe or 5% sucrose. The crop, the Malpighian tubules and the hindgut were carefully removed. 40 midguts have been dissected per replicate for each condition. Collected tissues were transferred in an Eppendorf tube containing 400 µL of PBS and kept on ice. Once all the tissues were dissected, 10 µL of elastase (Sigma-Aldrich, 10 µg/ µL) was added in each Eppendorf. Samples were kept at 27°C in a heat block for at least 1 hour until the tissues were totally degraded. Tissues were disrupted by pipetting up and down every 5 minutes. Samples were then centrifuged at 300 rcf for 20 minutes at 4°C and the supernatant was removed to obtain cell pellets. The same protocol has been applied for the ovaries. About 10 pairs of ovaries have been dissected per genotype. The Red stinger positive cells (ISCs + EBs) were collected from 250 ~ 500 midguts that were treated with elastase as above. Cells have been sorted using the fluorescence-activated single cell sorting. About 250000 to 750000 cells were collected per replicate. Total RNA was extracted by TRIZOL (Invitrogen) and the genomic DNA was removed by DNase I (Thermo Fisher). Small RNAs were first size-selected from the total RNA by 12% w/v UREA-PAGE using radio-labelled 19mer (5′-CGUACGCGGGUUUAAACGA) and 35mer (5'-CUCAUCUUGGUCGUACGCGGAAUAGUUUAAACUGU) spikes, and oxidised using sodium periodate. The oxidised small RNAs were further size-selected by PAGE. The size-selected oxidised small RNAs were ligated to the 3' adapter 5rApp/NNNNAGATCGGAAGAGCACACGTCT/3ddC, and then to the 5' adapter ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised. The first strand cDNA synthesis was performed using SuperScript II (Thermo Fisher) and the RT primer GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT. The library was amplified using KAPA LongRange DNA polymerase (Sigma) with a universal TruSeq forward primer (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT) and a barcode-containing TruSeq reverse primer (e.g. CAAGCAGAAGACGGCATACGAGATxxxxxxGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT where xxxxxx were the barcode). Illumina HiSeq 2500 SRX23306416 GSM8024303_r1 SRP484603 PRJNA1066367 SRS20608768 GSM8024303 GSM8024303 ncRNA-Seq TRANSCRIPTOMIC size fractionation Small RNA sequencing was performed on whole guts, ovaries and sorted Red stinger positive cells (ISCs + EBs). For the whole guts, flies were dissected in cold PBS 16 hours after being fed with Pe or 5% sucrose. The crop, the Malpighian tubules and the hindgut were carefully removed. 40 midguts have been dissected per replicate for each condition. Collected tissues were transferred in an Eppendorf tube containing 400 µL of PBS and kept on ice. Once all the tissues were dissected, 10 µL of elastase (Sigma-Aldrich, 10 µg/ µL) was added in each Eppendorf. Samples were kept at 27°C in a heat block for at least 1 hour until the tissues were totally degraded. Tissues were disrupted by pipetting up and down every 5 minutes. Samples were then centrifuged at 300 rcf for 20 minutes at 4°C and the supernatant was removed to obtain cell pellets. The same protocol has been applied for the ovaries. About 10 pairs of ovaries have been dissected per genotype. The Red stinger positive cells (ISCs + EBs) were collected from 250 ~ 500 midguts that were treated with elastase as above. Cells have been sorted using the fluorescence-activated single cell sorting. About 250000 to 750000 cells were collected per replicate. Total RNA was extracted by TRIZOL (Invitrogen) and the genomic DNA was removed by DNase I (Thermo Fisher). Small RNAs were first size-selected from the total RNA by 12% w/v UREA-PAGE using radio-labelled 19mer (5′-CGUACGCGGGUUUAAACGA) and 35mer (5'-CUCAUCUUGGUCGUACGCGGAAUAGUUUAAACUGU) spikes, and oxidised using sodium periodate. The oxidised small RNAs were further size-selected by PAGE. The size-selected oxidised small RNAs were ligated to the 3' adapter 5rApp/NNNNAGATCGGAAGAGCACACGTCT/3ddC, and then to the 5' adapter ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised. The first strand cDNA synthesis was performed using SuperScript II (Thermo Fisher) and the RT primer GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT. The library was amplified using KAPA LongRange DNA polymerase (Sigma) with a universal TruSeq forward primer (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT) and a barcode-containing TruSeq reverse primer (e.g. CAAGCAGAAGACGGCATACGAGATxxxxxxGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT where xxxxxx were the barcode). Illumina HiSeq 2500 SRX23306417 GSM8024304_r1 SRP484603 PRJNA1066367 SRS20608771 GSM8024304 GSM8024304 ncRNA-Seq TRANSCRIPTOMIC size fractionation Small RNA sequencing was performed on whole guts, ovaries and sorted Red stinger positive cells (ISCs + EBs). For the whole guts, flies were dissected in cold PBS 16 hours after being fed with Pe or 5% sucrose. The crop, the Malpighian tubules and the hindgut were carefully removed. 40 midguts have been dissected per replicate for each condition. Collected tissues were transferred in an Eppendorf tube containing 400 µL of PBS and kept on ice. Once all the tissues were dissected, 10 µL of elastase (Sigma-Aldrich, 10 µg/ µL) was added in each Eppendorf. Samples were kept at 27°C in a heat block for at least 1 hour until the tissues were totally degraded. Tissues were disrupted by pipetting up and down every 5 minutes. Samples were then centrifuged at 300 rcf for 20 minutes at 4°C and the supernatant was removed to obtain cell pellets. The same protocol has been applied for the ovaries. About 10 pairs of ovaries have been dissected per genotype. The Red stinger positive cells (ISCs + EBs) were collected from 250 ~ 500 midguts that were treated with elastase as above. Cells have been sorted using the fluorescence-activated single cell sorting. About 250000 to 750000 cells were collected per replicate. Total RNA was extracted by TRIZOL (Invitrogen) and the genomic DNA was removed by DNase I (Thermo Fisher). Small RNAs were first size-selected from the total RNA by 12% w/v UREA-PAGE using radio-labelled 19mer (5′-CGUACGCGGGUUUAAACGA) and 35mer (5'-CUCAUCUUGGUCGUACGCGGAAUAGUUUAAACUGU) spikes, and oxidised using sodium periodate. The oxidised small RNAs were further size-selected by PAGE. The size-selected oxidised small RNAs were ligated to the 3' adapter 5rApp/NNNNAGATCGGAAGAGCACACGTCT/3ddC, and then to the 5' adapter ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised. The first strand cDNA synthesis was performed using SuperScript II (Thermo Fisher) and the RT primer GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT. The library was amplified using KAPA LongRange DNA polymerase (Sigma) with a universal TruSeq forward primer (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT) and a barcode-containing TruSeq reverse primer (e.g. CAAGCAGAAGACGGCATACGAGATxxxxxxGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT where xxxxxx were the barcode). Illumina HiSeq 2500 SRX23306418 GSM8024305_r1 SRP484603 PRJNA1066367 SRS20608772 GSM8024305 GSM8024305 ncRNA-Seq TRANSCRIPTOMIC size fractionation Small RNA sequencing was performed on whole guts, ovaries and sorted Red stinger positive cells (ISCs + EBs). For the whole guts, flies were dissected in cold PBS 16 hours after being fed with Pe or 5% sucrose. The crop, the Malpighian tubules and the hindgut were carefully removed. 40 midguts have been dissected per replicate for each condition. Collected tissues were transferred in an Eppendorf tube containing 400 µL of PBS and kept on ice. Once all the tissues were dissected, 10 µL of elastase (Sigma-Aldrich, 10 µg/ µL) was added in each Eppendorf. Samples were kept at 27°C in a heat block for at least 1 hour until the tissues were totally degraded. Tissues were disrupted by pipetting up and down every 5 minutes. Samples were then centrifuged at 300 rcf for 20 minutes at 4°C and the supernatant was removed to obtain cell pellets. The same protocol has been applied for the ovaries. About 10 pairs of ovaries have been dissected per genotype. The Red stinger positive cells (ISCs + EBs) were collected from 250 ~ 500 midguts that were treated with elastase as above. Cells have been sorted using the fluorescence-activated single cell sorting. About 250000 to 750000 cells were collected per replicate. Total RNA was extracted by TRIZOL (Invitrogen) and the genomic DNA was removed by DNase I (Thermo Fisher). Small RNAs were first size-selected from the total RNA by 12% w/v UREA-PAGE using radio-labelled 19mer (5′-CGUACGCGGGUUUAAACGA) and 35mer (5'-CUCAUCUUGGUCGUACGCGGAAUAGUUUAAACUGU) spikes, and oxidised using sodium periodate. The oxidised small RNAs were further size-selected by PAGE. The size-selected oxidised small RNAs were ligated to the 3' adapter 5rApp/NNNNAGATCGGAAGAGCACACGTCT/3ddC, and then to the 5' adapter ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised. The first strand cDNA synthesis was performed using SuperScript II (Thermo Fisher) and the RT primer GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT. The library was amplified using KAPA LongRange DNA polymerase (Sigma) with a universal TruSeq forward primer (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT) and a barcode-containing TruSeq reverse primer (e.g. CAAGCAGAAGACGGCATACGAGATxxxxxxGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT where xxxxxx were the barcode). Illumina HiSeq 2500 SRX23306419 GSM8024306_r1 SRP484603 PRJNA1066367 SRS20608773 GSM8024306 GSM8024306 ncRNA-Seq TRANSCRIPTOMIC size fractionation Small RNA sequencing was performed on whole guts, ovaries and sorted Red stinger positive cells (ISCs + EBs). For the whole guts, flies were dissected in cold PBS 16 hours after being fed with Pe or 5% sucrose. The crop, the Malpighian tubules and the hindgut were carefully removed. 40 midguts have been dissected per replicate for each condition. Collected tissues were transferred in an Eppendorf tube containing 400 µL of PBS and kept on ice. Once all the tissues were dissected, 10 µL of elastase (Sigma-Aldrich, 10 µg/ µL) was added in each Eppendorf. Samples were kept at 27°C in a heat block for at least 1 hour until the tissues were totally degraded. Tissues were disrupted by pipetting up and down every 5 minutes. Samples were then centrifuged at 300 rcf for 20 minutes at 4°C and the supernatant was removed to obtain cell pellets. The same protocol has been applied for the ovaries. About 10 pairs of ovaries have been dissected per genotype. The Red stinger positive cells (ISCs + EBs) were collected from 250 ~ 500 midguts that were treated with elastase as above. Cells have been sorted using the fluorescence-activated single cell sorting. About 250000 to 750000 cells were collected per replicate. Total RNA was extracted by TRIZOL (Invitrogen) and the genomic DNA was removed by DNase I (Thermo Fisher). Small RNAs were first size-selected from the total RNA by 12% w/v UREA-PAGE using radio-labelled 19mer (5′-CGUACGCGGGUUUAAACGA) and 35mer (5'-CUCAUCUUGGUCGUACGCGGAAUAGUUUAAACUGU) spikes, and oxidised using sodium periodate. The oxidised small RNAs were further size-selected by PAGE. The size-selected oxidised small RNAs were ligated to the 3' adapter 5rApp/NNNNAGATCGGAAGAGCACACGTCT/3ddC, and then to the 5' adapter ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised. The first strand cDNA synthesis was performed using SuperScript II (Thermo Fisher) and the RT primer GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT. The library was amplified using KAPA LongRange DNA polymerase (Sigma) with a universal TruSeq forward primer (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT) and a barcode-containing TruSeq reverse primer (e.g. CAAGCAGAAGACGGCATACGAGATxxxxxxGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT where xxxxxx were the barcode). Illumina HiSeq 2500 SRX23306420 GSM8024307_r1 SRP484603 PRJNA1066367 SRS20608774 GSM8024307 GSM8024307 ncRNA-Seq TRANSCRIPTOMIC size fractionation Small RNA sequencing was performed on whole guts, ovaries and sorted Red stinger positive cells (ISCs + EBs). For the whole guts, flies were dissected in cold PBS 16 hours after being fed with Pe or 5% sucrose. The crop, the Malpighian tubules and the hindgut were carefully removed. 40 midguts have been dissected per replicate for each condition. Collected tissues were transferred in an Eppendorf tube containing 400 µL of PBS and kept on ice. Once all the tissues were dissected, 10 µL of elastase (Sigma-Aldrich, 10 µg/ µL) was added in each Eppendorf. Samples were kept at 27°C in a heat block for at least 1 hour until the tissues were totally degraded. Tissues were disrupted by pipetting up and down every 5 minutes. Samples were then centrifuged at 300 rcf for 20 minutes at 4°C and the supernatant was removed to obtain cell pellets. The same protocol has been applied for the ovaries. About 10 pairs of ovaries have been dissected per genotype. The Red stinger positive cells (ISCs + EBs) were collected from 250 ~ 500 midguts that were treated with elastase as above. Cells have been sorted using the fluorescence-activated single cell sorting. About 250000 to 750000 cells were collected per replicate. Total RNA was extracted by TRIZOL (Invitrogen) and the genomic DNA was removed by DNase I (Thermo Fisher). Small RNAs were first size-selected from the total RNA by 12% w/v UREA-PAGE using radio-labelled 19mer (5′-CGUACGCGGGUUUAAACGA) and 35mer (5'-CUCAUCUUGGUCGUACGCGGAAUAGUUUAAACUGU) spikes, and oxidised using sodium periodate. The oxidised small RNAs were further size-selected by PAGE. The size-selected oxidised small RNAs were ligated to the 3' adapter 5rApp/NNNNAGATCGGAAGAGCACACGTCT/3ddC, and then to the 5' adapter ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised. The first strand cDNA synthesis was performed using SuperScript II (Thermo Fisher) and the RT primer GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT. The library was amplified using KAPA LongRange DNA polymerase (Sigma) with a universal TruSeq forward primer (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT) and a barcode-containing TruSeq reverse primer (e.g. CAAGCAGAAGACGGCATACGAGATxxxxxxGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT where xxxxxx were the barcode). Illumina HiSeq 2500 SRX23306421 GSM8024308_r1 SRP484603 PRJNA1066367 SRS20608770 GSM8024308 GSM8024308 ncRNA-Seq TRANSCRIPTOMIC size fractionation Small RNA sequencing was performed on whole guts, ovaries and sorted Red stinger positive cells (ISCs + EBs). For the whole guts, flies were dissected in cold PBS 16 hours after being fed with Pe or 5% sucrose. The crop, the Malpighian tubules and the hindgut were carefully removed. 40 midguts have been dissected per replicate for each condition. Collected tissues were transferred in an Eppendorf tube containing 400 µL of PBS and kept on ice. Once all the tissues were dissected, 10 µL of elastase (Sigma-Aldrich, 10 µg/ µL) was added in each Eppendorf. Samples were kept at 27°C in a heat block for at least 1 hour until the tissues were totally degraded. Tissues were disrupted by pipetting up and down every 5 minutes. Samples were then centrifuged at 300 rcf for 20 minutes at 4°C and the supernatant was removed to obtain cell pellets. The same protocol has been applied for the ovaries. About 10 pairs of ovaries have been dissected per genotype. The Red stinger positive cells (ISCs + EBs) were collected from 250 ~ 500 midguts that were treated with elastase as above. Cells have been sorted using the fluorescence-activated single cell sorting. About 250000 to 750000 cells were collected per replicate. Total RNA was extracted by TRIZOL (Invitrogen) and the genomic DNA was removed by DNase I (Thermo Fisher). Small RNAs were first size-selected from the total RNA by 12% w/v UREA-PAGE using radio-labelled 19mer (5′-CGUACGCGGGUUUAAACGA) and 35mer (5'-CUCAUCUUGGUCGUACGCGGAAUAGUUUAAACUGU) spikes, and oxidised using sodium periodate. The oxidised small RNAs were further size-selected by PAGE. The size-selected oxidised small RNAs were ligated to the 3' adapter 5rApp/NNNNAGATCGGAAGAGCACACGTCT/3ddC, and then to the 5' adapter ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised. The first strand cDNA synthesis was performed using SuperScript II (Thermo Fisher) and the RT primer GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT. The library was amplified using KAPA LongRange DNA polymerase (Sigma) with a universal TruSeq forward primer (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT) and a barcode-containing TruSeq reverse primer (e.g. CAAGCAGAAGACGGCATACGAGATxxxxxxGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT where xxxxxx were the barcode). Illumina HiSeq 2500 SRX23306422 GSM8024309_r1 SRP484603 PRJNA1066367 SRS20608769 GSM8024309 GSM8024309 ncRNA-Seq TRANSCRIPTOMIC size fractionation Small RNA sequencing was performed on whole guts, ovaries and sorted Red stinger positive cells (ISCs + EBs). For the whole guts, flies were dissected in cold PBS 16 hours after being fed with Pe or 5% sucrose. The crop, the Malpighian tubules and the hindgut were carefully removed. 40 midguts have been dissected per replicate for each condition. Collected tissues were transferred in an Eppendorf tube containing 400 µL of PBS and kept on ice. Once all the tissues were dissected, 10 µL of elastase (Sigma-Aldrich, 10 µg/ µL) was added in each Eppendorf. Samples were kept at 27°C in a heat block for at least 1 hour until the tissues were totally degraded. Tissues were disrupted by pipetting up and down every 5 minutes. Samples were then centrifuged at 300 rcf for 20 minutes at 4°C and the supernatant was removed to obtain cell pellets. The same protocol has been applied for the ovaries. About 10 pairs of ovaries have been dissected per genotype. The Red stinger positive cells (ISCs + EBs) were collected from 250 ~ 500 midguts that were treated with elastase as above. Cells have been sorted using the fluorescence-activated single cell sorting. About 250000 to 750000 cells were collected per replicate. Total RNA was extracted by TRIZOL (Invitrogen) and the genomic DNA was removed by DNase I (Thermo Fisher). Small RNAs were first size-selected from the total RNA by 12% w/v UREA-PAGE using radio-labelled 19mer (5′-CGUACGCGGGUUUAAACGA) and 35mer (5'-CUCAUCUUGGUCGUACGCGGAAUAGUUUAAACUGU) spikes, and oxidised using sodium periodate. The oxidised small RNAs were further size-selected by PAGE. The size-selected oxidised small RNAs were ligated to the 3' adapter 5rApp/NNNNAGATCGGAAGAGCACACGTCT/3ddC, and then to the 5' adapter ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised. The first strand cDNA synthesis was performed using SuperScript II (Thermo Fisher) and the RT primer GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT. The library was amplified using KAPA LongRange DNA polymerase (Sigma) with a universal TruSeq forward primer (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT) and a barcode-containing TruSeq reverse primer (e.g. CAAGCAGAAGACGGCATACGAGATxxxxxxGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT where xxxxxx were the barcode). Illumina HiSeq 2500 SRX23306423 GSM8024310_r1 SRP484603 PRJNA1066367 SRS20608760 GSM8024310 GSM8024310 ncRNA-Seq TRANSCRIPTOMIC size fractionation Small RNA sequencing was performed on whole guts, ovaries and sorted Red stinger positive cells (ISCs + EBs). For the whole guts, flies were dissected in cold PBS 16 hours after being fed with Pe or 5% sucrose. The crop, the Malpighian tubules and the hindgut were carefully removed. 40 midguts have been dissected per replicate for each condition. Collected tissues were transferred in an Eppendorf tube containing 400 µL of PBS and kept on ice. Once all the tissues were dissected, 10 µL of elastase (Sigma-Aldrich, 10 µg/ µL) was added in each Eppendorf. Samples were kept at 27°C in a heat block for at least 1 hour until the tissues were totally degraded. Tissues were disrupted by pipetting up and down every 5 minutes. Samples were then centrifuged at 300 rcf for 20 minutes at 4°C and the supernatant was removed to obtain cell pellets. The same protocol has been applied for the ovaries. About 10 pairs of ovaries have been dissected per genotype. The Red stinger positive cells (ISCs + EBs) were collected from 250 ~ 500 midguts that were treated with elastase as above. Cells have been sorted using the fluorescence-activated single cell sorting. About 250000 to 750000 cells were collected per replicate. Total RNA was extracted by TRIZOL (Invitrogen) and the genomic DNA was removed by DNase I (Thermo Fisher). Small RNAs were first size-selected from the total RNA by 12% w/v UREA-PAGE using radio-labelled 19mer (5′-CGUACGCGGGUUUAAACGA) and 35mer (5'-CUCAUCUUGGUCGUACGCGGAAUAGUUUAAACUGU) spikes, and oxidised using sodium periodate. The oxidised small RNAs were further size-selected by PAGE. The size-selected oxidised small RNAs were ligated to the 3' adapter 5rApp/NNNNAGATCGGAAGAGCACACGTCT/3ddC, and then to the 5' adapter ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised. The first strand cDNA synthesis was performed using SuperScript II (Thermo Fisher) and the RT primer GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT. The library was amplified using KAPA LongRange DNA polymerase (Sigma) with a universal TruSeq forward primer (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT) and a barcode-containing TruSeq reverse primer (e.g. CAAGCAGAAGACGGCATACGAGATxxxxxxGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT where xxxxxx were the barcode). Illumina HiSeq 2500