SRX700994 L. williamsii transcriptome (GS-FLX reads) SRP057967 PRJNA261064 Total RNA was isolated from roots and buttons using the Trizol reagent (Invitrogen) and re-purified with the RNeasy kit (Qiagen) following the manufacturer’s recommendations. RNA purity was checked using the Agilent 2100 Bioanalyzer RNA 6000 Nano Assay chip (Agilent Technologies, Stockport, U.K). cDNA synthesis was performed from 3.5 µg of total RNA using the Message Amp-II kit (Ambion, Foster City, CA) following the manufacturer’s protocol. cDNA derived from button and peyote roots was pooled (using the same amount of each) and sequencing on GS-FLX and GS-Junior platform (one run per equipment). SRS701107 SAMN03068713 EST TRANSCRIPTOMIC PolyA 0 0 Technical Read Adapter 1 1 Application Read Forward 5 454 GS FLX SRX701021 L. williamsii transcriptome (GS-Junior reads) SRP057967 PRJNA261064 otal RNA was isolated from roots and buttons using the Trizol reagent (Invitrogen) and re-purified with the RNeasy kit (Qiagen) following the manufacturer’s recommendations. RNA purity was checked using the Agilent 2100 Bioanalyzer RNA 6000 Nano Assay chip (Agilent Technologies, Stockport, U.K). cDNA synthesis was performed from 3.5 µg of total RNA using the Message Amp-II kit (Ambion, Foster City, CA) following the manufacturer’s protocol. cDNA derived from button and peyote roots was pooled (using the same amount of each) and sequencing on GS-FLX and GS-Junior platform (one run per equipment). SRS701107 SAMN03068713 EST TRANSCRIPTOMIC PolyA 0 0 Technical Read Adapter 1 1 Application Read Forward 5 454 GS Junior SRX701022 L. williamsii transcriptome (IonPGM reads) SRP057967 PRJNA261064 Total RNA was isolated from roots and buttons using the Trizol reagent (Invitrogen) and re-purified with the RNeasy kit (Qiagen) following the manufacturer’s recommendations. RNA purity was checked using the Agilent 2100 Bioanalyzer RNA 6000 Nano Assay chip (Agilent Technologies, Stockport, U.K). cDNA synthesis was performed from 3.5 µg of total RNA using the Message Amp-II kit (Ambion, Foster City, CA) following the manufacturer’s protocol. cDNA samples were prepared with the Ion Xpress™ Template Kit (Life Technologies) according to the Ion Xpress™ Template Kit User Guide and sequenced on a Personal Genome Machine™ (PGM™) sequencer using two 3.18 semiconductor chips. The adapters used were MID01 (TCGATAATCTTCTGCTGTACGGCCAAGGCGT) and MID02 (TGATGATTGCCCTGCTGTACGGCCAAGGCGT) from roots and button, respectively) SRS701107 EST TRANSCRIPTOMIC PolyA 0 0 Technical Read Adapter 1 1 Application Read Forward 5 Ion Torrent PGM