SRX810469 GSM1566007 SRP051171 SRS791675 GSM1566007 OTHER GENOMIC other Genomic DNA was extracted with a Qiagen DNeasy Blood and Tissue Kit (Qiagen, Venlo, Limburg). To generate 5hmC library, 2µg of genomic DNA was digested with ~0.7 µg of PvuRts1I at room temperature for 2 hours. Next, 30 units of T4 Phage β-glucosyltransferase (New England Biolabs, Ipswich, MA) and 75µM UDP-6N3-Glc were added to the reaction and incubated at 37 oC for 2 hours. DNA ends created by PvuRts1I were ligated with 7µM Adapter P1 (top: ACACTCTTTCCCTACACGACGCTCTTCCGATCTNN and bottom: AGATCGGAAGAG CGTCGTGTAGGGAAAGAGTGT) with T4 DNA ligase (New England Biolabs) at 16 oC overnight. The next day, genomic DNA was sheared to around 200 bp by the Covaris s-series sonicator according to the suggested settings. The sheared genomic DNA was then purified with DNA Clean and Concentrator kit (Zymo, Irvine, CA). The purified DNA was reacted with 1 mM dibenzocyclooctyne-S-S-PEG3-biotin conjugate (Click Chemistry Tools, Scottsdale, AZ) at 37 °C for 2 hours. The DNA was then purified again with DNA Clean and Concentrator kit (Zymo). Subsequently, streptavidin beads (New England Biolabs) were added to the DNA and rotated at room temperature for 2 hours. The DNA captured on the beads was washed twice with 5mM Tris pH=8.0 and 1M NaCl. After that, the DNA was end repaired and dA-tailed with NEBNext® End Repair and NEBNext® dA-Tailing Module (New England Biolabs), respectively. Subsequently, 1µM adapter P2 (top: /5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTC and bottom: GACTGGAGTTCAGACGTGTGCTCTTCCGATCT) was added to perform ligation with NEBNext® Ultra™ Ligation Module (New England Biolabs) at 20 °C for 15 minutes. Lastly, 100mM DTT was added to the reaction to cleave the disulfide bond in order to release the 5hmC library from the streptavidin beads. The 5hmC library was then amplified with NEB universal and index1 primer (New England Biolabs). The library DNA was purified via Ampure Beads (Beckman Coulter, Indianapolis, IN) with the ratio 1:1 and subject to next generation sequencing pipeline.For 5fC library construction, to ensure the complete conversion of 5hmC to 5gmC, 12 µg of E14 genomic DNA were first incubated with 180 units of T4-BGT and 450µM UDP-Glc at 37oC for 3 hours. Then fresh 180 units of T4-BGT and 450µM UDP-Glc were added to the reaction at 37oC for overnight. The next day, additional 180 units of T4-BGT and 450µM UDP-Glc were added to the reaction at 37oC for 3 hours. The genomic DNA was then purified via phenol chloroform extraction. Subsequently, 100mM of NaBH4 was added to the DNA and incubated for 2 hours at room temperature. Genomic DNA was then precipitated by ethanol and ready for library construction. Illumina HiSeq 2500 GEO Sample GSM1566007 http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM1566007 gds 301566007 GEO Accession GSM1566007 SRX810470 GSM1566008 SRP051171 SRS791676 GSM1566008 OTHER GENOMIC other Genomic DNA was extracted with a Qiagen DNeasy Blood and Tissue Kit (Qiagen, Venlo, Limburg). To generate 5hmC library, 2µg of genomic DNA was digested with ~0.7 µg of PvuRts1I at room temperature for 2 hours. Next, 30 units of T4 Phage β-glucosyltransferase (New England Biolabs, Ipswich, MA) and 75µM UDP-6N3-Glc were added to the reaction and incubated at 37 oC for 2 hours. DNA ends created by PvuRts1I were ligated with 7µM Adapter P1 (top: ACACTCTTTCCCTACACGACGCTCTTCCGATCTNN and bottom: AGATCGGAAGAG CGTCGTGTAGGGAAAGAGTGT) with T4 DNA ligase (New England Biolabs) at 16 oC overnight. The next day, genomic DNA was sheared to around 200 bp by the Covaris s-series sonicator according to the suggested settings. The sheared genomic DNA was then purified with DNA Clean and Concentrator kit (Zymo, Irvine, CA). The purified DNA was reacted with 1 mM dibenzocyclooctyne-S-S-PEG3-biotin conjugate (Click Chemistry Tools, Scottsdale, AZ) at 37 °C for 2 hours. The DNA was then purified again with DNA Clean and Concentrator kit (Zymo). Subsequently, streptavidin beads (New England Biolabs) were added to the DNA and rotated at room temperature for 2 hours. The DNA captured on the beads was washed twice with 5mM Tris pH=8.0 and 1M NaCl. After that, the DNA was end repaired and dA-tailed with NEBNext® End Repair and NEBNext® dA-Tailing Module (New England Biolabs), respectively. Subsequently, 1µM adapter P2 (top: /5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTC and bottom: GACTGGAGTTCAGACGTGTGCTCTTCCGATCT) was added to perform ligation with NEBNext® Ultra™ Ligation Module (New England Biolabs) at 20 °C for 15 minutes. Lastly, 100mM DTT was added to the reaction to cleave the disulfide bond in order to release the 5hmC library from the streptavidin beads. The 5hmC library was then amplified with NEB universal and index1 primer (New England Biolabs). The library DNA was purified via Ampure Beads (Beckman Coulter, Indianapolis, IN) with the ratio 1:1 and subject to next generation sequencing pipeline.For 5fC library construction, to ensure the complete conversion of 5hmC to 5gmC, 12 µg of E14 genomic DNA were first incubated with 180 units of T4-BGT and 450µM UDP-Glc at 37oC for 3 hours. Then fresh 180 units of T4-BGT and 450µM UDP-Glc were added to the reaction at 37oC for overnight. The next day, additional 180 units of T4-BGT and 450µM UDP-Glc were added to the reaction at 37oC for 3 hours. The genomic DNA was then purified via phenol chloroform extraction. Subsequently, 100mM of NaBH4 was added to the DNA and incubated for 2 hours at room temperature. Genomic DNA was then precipitated by ethanol and ready for library construction. Illumina HiSeq 2500 GEO Sample GSM1566008 http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM1566008 gds 301566008 GEO Accession GSM1566008 SRX810471 GSM1566009 SRP051171 SRS791677 GSM1566009 OTHER GENOMIC other Genomic DNA was extracted with a Qiagen DNeasy Blood and Tissue Kit (Qiagen, Venlo, Limburg). To generate 5hmC library, 2µg of genomic DNA was digested with ~0.7 µg of PvuRts1I at room temperature for 2 hours. Next, 30 units of T4 Phage β-glucosyltransferase (New England Biolabs, Ipswich, MA) and 75µM UDP-6N3-Glc were added to the reaction and incubated at 37 oC for 2 hours. DNA ends created by PvuRts1I were ligated with 7µM Adapter P1 (top: ACACTCTTTCCCTACACGACGCTCTTCCGATCTNN and bottom: AGATCGGAAGAG CGTCGTGTAGGGAAAGAGTGT) with T4 DNA ligase (New England Biolabs) at 16 oC overnight. The next day, genomic DNA was sheared to around 200 bp by the Covaris s-series sonicator according to the suggested settings. The sheared genomic DNA was then purified with DNA Clean and Concentrator kit (Zymo, Irvine, CA). The purified DNA was reacted with 1 mM dibenzocyclooctyne-S-S-PEG3-biotin conjugate (Click Chemistry Tools, Scottsdale, AZ) at 37 °C for 2 hours. The DNA was then purified again with DNA Clean and Concentrator kit (Zymo). Subsequently, streptavidin beads (New England Biolabs) were added to the DNA and rotated at room temperature for 2 hours. The DNA captured on the beads was washed twice with 5mM Tris pH=8.0 and 1M NaCl. After that, the DNA was end repaired and dA-tailed with NEBNext® End Repair and NEBNext® dA-Tailing Module (New England Biolabs), respectively. Subsequently, 1µM adapter P2 (top: /5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTC and bottom: GACTGGAGTTCAGACGTGTGCTCTTCCGATCT) was added to perform ligation with NEBNext® Ultra™ Ligation Module (New England Biolabs) at 20 °C for 15 minutes. Lastly, 100mM DTT was added to the reaction to cleave the disulfide bond in order to release the 5hmC library from the streptavidin beads. The 5hmC library was then amplified with NEB universal and index1 primer (New England Biolabs). The library DNA was purified via Ampure Beads (Beckman Coulter, Indianapolis, IN) with the ratio 1:1 and subject to next generation sequencing pipeline.For 5fC library construction, to ensure the complete conversion of 5hmC to 5gmC, 12 µg of E14 genomic DNA were first incubated with 180 units of T4-BGT and 450µM UDP-Glc at 37oC for 3 hours. Then fresh 180 units of T4-BGT and 450µM UDP-Glc were added to the reaction at 37oC for overnight. The next day, additional 180 units of T4-BGT and 450µM UDP-Glc were added to the reaction at 37oC for 3 hours. The genomic DNA was then purified via phenol chloroform extraction. Subsequently, 100mM of NaBH4 was added to the DNA and incubated for 2 hours at room temperature. Genomic DNA was then precipitated by ethanol and ready for library construction. Illumina HiSeq 2500 GEO Sample GSM1566009 http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM1566009 gds 301566009 GEO Accession GSM1566009 SRX810472 GSM1566010 SRP051171 SRS791678 GSM1566010 OTHER GENOMIC other Genomic DNA was extracted with a Qiagen DNeasy Blood and Tissue Kit (Qiagen, Venlo, Limburg). To generate 5hmC library, 2µg of genomic DNA was digested with ~0.7 µg of PvuRts1I at room temperature for 2 hours. Next, 30 units of T4 Phage β-glucosyltransferase (New England Biolabs, Ipswich, MA) and 75µM UDP-6N3-Glc were added to the reaction and incubated at 37 oC for 2 hours. DNA ends created by PvuRts1I were ligated with 7µM Adapter P1 (top: ACACTCTTTCCCTACACGACGCTCTTCCGATCTNN and bottom: AGATCGGAAGAG CGTCGTGTAGGGAAAGAGTGT) with T4 DNA ligase (New England Biolabs) at 16 oC overnight. The next day, genomic DNA was sheared to around 200 bp by the Covaris s-series sonicator according to the suggested settings. The sheared genomic DNA was then purified with DNA Clean and Concentrator kit (Zymo, Irvine, CA). The purified DNA was reacted with 1 mM dibenzocyclooctyne-S-S-PEG3-biotin conjugate (Click Chemistry Tools, Scottsdale, AZ) at 37 °C for 2 hours. The DNA was then purified again with DNA Clean and Concentrator kit (Zymo). Subsequently, streptavidin beads (New England Biolabs) were added to the DNA and rotated at room temperature for 2 hours. The DNA captured on the beads was washed twice with 5mM Tris pH=8.0 and 1M NaCl. After that, the DNA was end repaired and dA-tailed with NEBNext® End Repair and NEBNext® dA-Tailing Module (New England Biolabs), respectively. Subsequently, 1µM adapter P2 (top: /5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTC and bottom: GACTGGAGTTCAGACGTGTGCTCTTCCGATCT) was added to perform ligation with NEBNext® Ultra™ Ligation Module (New England Biolabs) at 20 °C for 15 minutes. Lastly, 100mM DTT was added to the reaction to cleave the disulfide bond in order to release the 5hmC library from the streptavidin beads. The 5hmC library was then amplified with NEB universal and index1 primer (New England Biolabs). The library DNA was purified via Ampure Beads (Beckman Coulter, Indianapolis, IN) with the ratio 1:1 and subject to next generation sequencing pipeline.For 5fC library construction, to ensure the complete conversion of 5hmC to 5gmC, 12 µg of E14 genomic DNA were first incubated with 180 units of T4-BGT and 450µM UDP-Glc at 37oC for 3 hours. Then fresh 180 units of T4-BGT and 450µM UDP-Glc were added to the reaction at 37oC for overnight. The next day, additional 180 units of T4-BGT and 450µM UDP-Glc were added to the reaction at 37oC for 3 hours. The genomic DNA was then purified via phenol chloroform extraction. Subsequently, 100mM of NaBH4 was added to the DNA and incubated for 2 hours at room temperature. Genomic DNA was then precipitated by ethanol and ready for library construction. Illumina HiSeq 2500 GEO Sample GSM1566010 http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM1566010 gds 301566010 GEO Accession GSM1566010 SRX810473 GSM1566011 SRP051171 SRS791679 GSM1566011 OTHER GENOMIC other Genomic DNA was extracted with a Qiagen DNeasy Blood and Tissue Kit (Qiagen, Venlo, Limburg). To generate 5hmC library, 2µg of genomic DNA was digested with ~0.7 µg of PvuRts1I at room temperature for 2 hours. Next, 30 units of T4 Phage β-glucosyltransferase (New England Biolabs, Ipswich, MA) and 75µM UDP-6N3-Glc were added to the reaction and incubated at 37 oC for 2 hours. DNA ends created by PvuRts1I were ligated with 7µM Adapter P1 (top: ACACTCTTTCCCTACACGACGCTCTTCCGATCTNN and bottom: AGATCGGAAGAG CGTCGTGTAGGGAAAGAGTGT) with T4 DNA ligase (New England Biolabs) at 16 oC overnight. The next day, genomic DNA was sheared to around 200 bp by the Covaris s-series sonicator according to the suggested settings. The sheared genomic DNA was then purified with DNA Clean and Concentrator kit (Zymo, Irvine, CA). The purified DNA was reacted with 1 mM dibenzocyclooctyne-S-S-PEG3-biotin conjugate (Click Chemistry Tools, Scottsdale, AZ) at 37 °C for 2 hours. The DNA was then purified again with DNA Clean and Concentrator kit (Zymo). Subsequently, streptavidin beads (New England Biolabs) were added to the DNA and rotated at room temperature for 2 hours. The DNA captured on the beads was washed twice with 5mM Tris pH=8.0 and 1M NaCl. After that, the DNA was end repaired and dA-tailed with NEBNext® End Repair and NEBNext® dA-Tailing Module (New England Biolabs), respectively. Subsequently, 1µM adapter P2 (top: /5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTC and bottom: GACTGGAGTTCAGACGTGTGCTCTTCCGATCT) was added to perform ligation with NEBNext® Ultra™ Ligation Module (New England Biolabs) at 20 °C for 15 minutes. Lastly, 100mM DTT was added to the reaction to cleave the disulfide bond in order to release the 5hmC library from the streptavidin beads. The 5hmC library was then amplified with NEB universal and index1 primer (New England Biolabs). The library DNA was purified via Ampure Beads (Beckman Coulter, Indianapolis, IN) with the ratio 1:1 and subject to next generation sequencing pipeline.For 5fC library construction, to ensure the complete conversion of 5hmC to 5gmC, 12 µg of E14 genomic DNA were first incubated with 180 units of T4-BGT and 450µM UDP-Glc at 37oC for 3 hours. Then fresh 180 units of T4-BGT and 450µM UDP-Glc were added to the reaction at 37oC for overnight. The next day, additional 180 units of T4-BGT and 450µM UDP-Glc were added to the reaction at 37oC for 3 hours. The genomic DNA was then purified via phenol chloroform extraction. Subsequently, 100mM of NaBH4 was added to the DNA and incubated for 2 hours at room temperature. Genomic DNA was then precipitated by ethanol and ready for library construction. Illumina HiSeq 2500 GEO Sample GSM1566011 http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM1566011 gds 301566011 GEO Accession GSM1566011 SRX810474 GSM1566012 SRP051171 SRS791680 GSM1566012 OTHER GENOMIC other Genomic DNA was extracted with a Qiagen DNeasy Blood and Tissue Kit (Qiagen, Venlo, Limburg). To generate 5hmC library, 2µg of genomic DNA was digested with ~0.7 µg of PvuRts1I at room temperature for 2 hours. Next, 30 units of T4 Phage β-glucosyltransferase (New England Biolabs, Ipswich, MA) and 75µM UDP-6N3-Glc were added to the reaction and incubated at 37 oC for 2 hours. DNA ends created by PvuRts1I were ligated with 7µM Adapter P1 (top: ACACTCTTTCCCTACACGACGCTCTTCCGATCTNN and bottom: AGATCGGAAGAG CGTCGTGTAGGGAAAGAGTGT) with T4 DNA ligase (New England Biolabs) at 16 oC overnight. The next day, genomic DNA was sheared to around 200 bp by the Covaris s-series sonicator according to the suggested settings. The sheared genomic DNA was then purified with DNA Clean and Concentrator kit (Zymo, Irvine, CA). The purified DNA was reacted with 1 mM dibenzocyclooctyne-S-S-PEG3-biotin conjugate (Click Chemistry Tools, Scottsdale, AZ) at 37 °C for 2 hours. The DNA was then purified again with DNA Clean and Concentrator kit (Zymo). Subsequently, streptavidin beads (New England Biolabs) were added to the DNA and rotated at room temperature for 2 hours. The DNA captured on the beads was washed twice with 5mM Tris pH=8.0 and 1M NaCl. After that, the DNA was end repaired and dA-tailed with NEBNext® End Repair and NEBNext® dA-Tailing Module (New England Biolabs), respectively. Subsequently, 1µM adapter P2 (top: /5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTC and bottom: GACTGGAGTTCAGACGTGTGCTCTTCCGATCT) was added to perform ligation with NEBNext® Ultra™ Ligation Module (New England Biolabs) at 20 °C for 15 minutes. Lastly, 100mM DTT was added to the reaction to cleave the disulfide bond in order to release the 5hmC library from the streptavidin beads. The 5hmC library was then amplified with NEB universal and index1 primer (New England Biolabs). The library DNA was purified via Ampure Beads (Beckman Coulter, Indianapolis, IN) with the ratio 1:1 and subject to next generation sequencing pipeline.For 5fC library construction, to ensure the complete conversion of 5hmC to 5gmC, 12 µg of E14 genomic DNA were first incubated with 180 units of T4-BGT and 450µM UDP-Glc at 37oC for 3 hours. Then fresh 180 units of T4-BGT and 450µM UDP-Glc were added to the reaction at 37oC for overnight. The next day, additional 180 units of T4-BGT and 450µM UDP-Glc were added to the reaction at 37oC for 3 hours. The genomic DNA was then purified via phenol chloroform extraction. Subsequently, 100mM of NaBH4 was added to the DNA and incubated for 2 hours at room temperature. Genomic DNA was then precipitated by ethanol and ready for library construction. Illumina HiSeq 2500 GEO Sample GSM1566012 http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM1566012 gds 301566012 GEO Accession GSM1566012