SRX818448 GSM1569222 SRP051374 SRS798502 GSM1569222 miRNA-Seq TRANSCRIPTOMIC size fractionation MCF7 cells were collected with Trizol reagent (Invitrogen) following manufacturer's protocol. Small RNAs of 15-40 bases were gel-purified from 5 ug total RNA Small RNAs of 15-40 bases were gel-purified from 5 ug total RNA with 10% acrylamide gel (American Bioanalytical AB13021). Purified small RNA was subjected to library preparation, similar to Illumina protocol with modification. Briefly, pre-adenylated primer was made following a published protocol (Chen, Y.-R., Zheng, Y., Liu, B., Zhong, S., Giovannoni, J. and Fei, Z. (2012) A cost-effective method for Illumina small RNA-Seq library preparation using T4 RNA ligase 1 adenylated adapters. Plant Methods, 8, 41.) using /5Phos/TGGAATTCTCGGGTGCCAAGG/3ddC/. Small RNA was ligated to the pre-adenylated primer with truncated T4 RNA ligase 2 (NEB M0242S). The 35-55 bases product was purified with 10% acrylamide gel and further went through a 5’ ligation reaction with primer: dGdTdTdCdAdGdAdGdTdTdCdTdAdCdA GUCCGACGAUC (Dharmacon) with T4 RNA ligase 1 (Fermentas EL0021). The 60-80 bases product was purified with 10% acrylamide gel and reverse transcribed with M-MLV reverse transcriptase (Invitrogen 28025-013) using primer: GCCTTGGCACCCGAGAATTCCA. The RT product was PCR amplified for 18 cycles with Phusion DNA polymerase (NEB M0530) using a universal primer: AATGATACGGCGACCACCGAGATCTACACGTT-CAGAGTTCTACAGTCCGA and a specific primer for each sample. 130-150nt small RNA libraries were purified with 8% acrylamide gel. Barcoded small RNA libraries were sequenced on a HiSeq2000 (Illumina). TruSeq Small RNA Library Illumina HiSeq 2000 GEO Sample GSM1569222 http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM1569222 gds 301569222 GEO Accession GSM1569222 SRX818449 GSM1569223 SRP051374 SRS798503 GSM1569223 miRNA-Seq TRANSCRIPTOMIC size fractionation MCF7 cells were collected with Trizol reagent (Invitrogen) following manufacturer's protocol. Small RNAs of 15-40 bases were gel-purified from 5 ug total RNA Small RNAs of 15-40 bases were gel-purified from 5 ug total RNA with 10% acrylamide gel (American Bioanalytical AB13021). Purified small RNA was subjected to library preparation, similar to Illumina protocol with modification. Briefly, pre-adenylated primer was made following a published protocol (Chen, Y.-R., Zheng, Y., Liu, B., Zhong, S., Giovannoni, J. and Fei, Z. (2012) A cost-effective method for Illumina small RNA-Seq library preparation using T4 RNA ligase 1 adenylated adapters. Plant Methods, 8, 41.) using /5Phos/TGGAATTCTCGGGTGCCAAGG/3ddC/. Small RNA was ligated to the pre-adenylated primer with truncated T4 RNA ligase 2 (NEB M0242S). The 35-55 bases product was purified with 10% acrylamide gel and further went through a 5’ ligation reaction with primer: dGdTdTdCdAdGdAdGdTdTdCdTdAdCdA GUCCGACGAUC (Dharmacon) with T4 RNA ligase 1 (Fermentas EL0021). The 60-80 bases product was purified with 10% acrylamide gel and reverse transcribed with M-MLV reverse transcriptase (Invitrogen 28025-013) using primer: GCCTTGGCACCCGAGAATTCCA. The RT product was PCR amplified for 18 cycles with Phusion DNA polymerase (NEB M0530) using a universal primer: AATGATACGGCGACCACCGAGATCTACACGTT-CAGAGTTCTACAGTCCGA and a specific primer for each sample. 130-150nt small RNA libraries were purified with 8% acrylamide gel. Barcoded small RNA libraries were sequenced on a HiSeq2000 (Illumina). TruSeq Small RNA Library Illumina HiSeq 2000 GEO Sample GSM1569223 http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM1569223 gds 301569223 GEO Accession GSM1569223