SRX957005 A1_WGS SRP056183 PRJNA278310 Without centrifugation of bile samples, total DNA of 400 μL bile per patient was extracted using Invitrogen Purelink Genomic DNA mini kit (Life Technologies, Carlsbad, CA, USA), following manufacturer’s blood DNA extraction protocol. DNA concentration was quantified by Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA), and quality was examined by agarose gel electrophoresis using E-Gel electrophoresis system (L ife Technologies, Carlsbad, CA, USA). Total DNA of bile samples was sheared into ~350bp fragments by Covaris M220 (Covaris, Woburn, MA, USA) and then multiplexed libraries were prepared using Illumina TruSeq Nano DNA Sample Preparation Kits (Illumina, San Diego, CA, USA) according to manufacturer’s instructions. Illumina HiSeq 2000 platform was used to generated 2x100 bp pair-end sequencing reads. SRS874470 SAMN03417491 A1_WGS_library WGS METAGENOMIC RANDOM 202 0 Application Read Forward 1 1 Application Read Reverse 102 Illumina HiSeq 2000 SRX957011 A1_16S_rDNA SRP056183 Without centrifugation of bile samples, total DNA of 400 μL bile per patient was extracted using Invitrogen Purelink Genomic DNA mini kit (Life Technologies, Carlsbad, CA, USA), following manufacturer’s blood DNA extraction protocol. DNA concentration was quantified by Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA), and quality was examined by agarose gel electrophoresis using E-Gel electrophoresis system (L ife Technologies, Carlsbad, CA, USA). Universal primer pairs 356F (forward, 5’CCTACGGGNGGCWGCAG3’) and reverse 803R (backward, 5’GACTACHVGGGTATCTAATCC3’) targeting V3-V4 region of bacterial 16S ribosome DNA (rDNA) gene were used for amplification. We employed a two-step PCR 16S rDNA gene amplification protocol used by Ottesen et. al. (2014) for amplification and library preparation. In brief, at the first step, target region of 16S rDNA was amplified using 16S primers with overhang adapters attached (forward primer overhang adapter 5’TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG3’ and reverse primer overhang adapter 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG3’). These overhang adapters are compatible with the Illumina Nextera DNA indices. Then, P5/P7 adapters and sample barcodes in Illumina Nextera XT index kit (Illumina, San Diego, CA, USA) were added to the cleaned-up PCR products by the second-round PCR. The final PCR products were cleaned up and sequenced by Illumina MiSeq platform to generate 2x250 bp paired-end reads, which could cover amplified 16S V3-V4 region. SRS874470 SAMN03417491 A1_16S_library AMPLICON METAGENOMIC PCR 502 0 Application Read Forward 1 1 Application Read Reverse 252 Illumina MiSeq SRX957014 A2_WGS SRP056183 Without centrifugation of bile samples, total DNA of 400 μL bile per patient was extracted using Invitrogen Purelink Genomic DNA mini kit (Life Technologies, Carlsbad, CA, USA), following manufacturer’s blood DNA extraction protocol. DNA concentration was quantified by Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA), and quality was examined by agarose gel electrophoresis using E-Gel electrophoresis system (L ife Technologies, Carlsbad, CA, USA). Total DNA of bile samples was sheared into ~350bp fragments by Covaris M220 (Covaris, Woburn, MA, USA) and then multiplexed libraries were prepared using Illumina TruSeq Nano DNA Sample Preparation Kits (Illumina, San Diego, CA, USA) according to manufacturer’s instructions. Illumina HiSeq 2000 platform was used to generated 2x100 bp pair-end sequencing reads. SRS874478 SAMN03417492 A2_WGS_library WGS METAGENOMIC RANDOM 202 0 Application Read Forward 1 1 Application Read Reverse 102 Illumina HiSeq 2000 SRX957016 A2_16S_rDNA SRP056183 Without centrifugation of bile samples, total DNA of 400 μL bile per patient was extracted using Invitrogen Purelink Genomic DNA mini kit (Life Technologies, Carlsbad, CA, USA), following manufacturer’s blood DNA extraction protocol. DNA concentration was quantified by Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA), and quality was examined by agarose gel electrophoresis using E-Gel electrophoresis system (L ife Technologies, Carlsbad, CA, USA). Universal primer pairs 356F (forward, 5’CCTACGGGNGGCWGCAG3’) and reverse 803R (backward, 5’GACTACHVGGGTATCTAATCC3’) targeting V3-V4 region of bacterial 16S ribosome DNA (rDNA) gene were used for amplification. We employed a two-step PCR 16S rDNA gene amplification protocol used by Ottesen et. al. (2014) for amplification and library preparation. In brief, at the first step, target region of 16S rDNA was amplified using 16S primers with overhang adapters attached (forward primer overhang adapter 5’TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG3’ and reverse primer overhang adapter 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG3’). These overhang adapters are compatible with the Illumina Nextera DNA indices. Then, P5/P7 adapters and sample barcodes in Illumina Nextera XT index kit (Illumina, San Diego, CA, USA) were added to the cleaned-up PCR products by the second-round PCR. The final PCR products were cleaned up and sequenced by Illumina MiSeq platform to generate 2x250 bp paired-end reads, which could cover amplified 16S V3-V4 region. SRS874478 SAMN03417492 A2_16S_library AMPLICON METAGENOMIC PCR 502 0 Application Read Forward 1 1 Application Read Reverse 252 Illumina MiSeq SRX957017 A3_WGS SRP056183 Without centrifugation of bile samples, total DNA of 400 μL bile per patient was extracted using Invitrogen Purelink Genomic DNA mini kit (Life Technologies, Carlsbad, CA, USA), following manufacturer’s blood DNA extraction protocol. DNA concentration was quantified by Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA), and quality was examined by agarose gel electrophoresis using E-Gel electrophoresis system (L ife Technologies, Carlsbad, CA, USA). Total DNA of bile samples was sheared into ~350bp fragments by Covaris M220 (Covaris, Woburn, MA, USA) and then multiplexed libraries were prepared using Illumina TruSeq Nano DNA Sample Preparation Kits (Illumina, San Diego, CA, USA) according to manufacturer’s instructions. Illumina HiSeq 2000 platform was used to generated 2x100 bp pair-end sequencing reads. SRS874480 SAMN03417493 A3_WGS_library WGS METAGENOMIC RANDOM 202 0 Application Read Forward 1 1 Application Read Reverse 102 Illumina HiSeq 2000 SRX957018 A4_WGS SRP056183 Without centrifugation of bile samples, total DNA of 400 μL bile per patient was extracted using Invitrogen Purelink Genomic DNA mini kit (Life Technologies, Carlsbad, CA, USA), following manufacturer’s blood DNA extraction protocol. DNA concentration was quantified by Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA), and quality was examined by agarose gel electrophoresis using E-Gel electrophoresis system (L ife Technologies, Carlsbad, CA, USA). Total DNA of bile samples was sheared into ~350bp fragments by Covaris M220 (Covaris, Woburn, MA, USA) and then multiplexed libraries were prepared using Illumina TruSeq Nano DNA Sample Preparation Kits (Illumina, San Diego, CA, USA) according to manufacturer’s instructions. Illumina HiSeq 2000 platform was used to generated 2x100 bp pair-end sequencing reads. SRS874479 SAMN03417494 A4_WGS_library WGS METAGENOMIC RANDOM 202 0 Application Read Forward 1 1 Application Read Reverse 102 Illumina HiSeq 2000 SRX957019 A5_WGS SRP056183 Without centrifugation of bile samples, total DNA of 400 μL bile per patient was extracted using Invitrogen Purelink Genomic DNA mini kit (Life Technologies, Carlsbad, CA, USA), following manufacturer’s blood DNA extraction protocol. DNA concentration was quantified by Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA), and quality was examined by agarose gel electrophoresis using E-Gel electrophoresis system (L ife Technologies, Carlsbad, CA, USA). Total DNA of bile samples was sheared into ~350bp fragments by Covaris M220 (Covaris, Woburn, MA, USA) and then multiplexed libraries were prepared using Illumina TruSeq Nano DNA Sample Preparation Kits (Illumina, San Diego, CA, USA) according to manufacturer’s instructions. Illumina HiSeq 2000 platform was used to generated 2x100 bp pair-end sequencing reads. SRS874481 SAMN03417495 A5_WGS_library WGS METAGENOMIC RANDOM 202 0 Application Read Forward 1 1 Application Read Reverse 102 Illumina HiSeq 2000 SRX957020 B1_WGS SRP056183 Without centrifugation of bile samples, total DNA of 400 μL bile per patient was extracted using Invitrogen Purelink Genomic DNA mini kit (Life Technologies, Carlsbad, CA, USA), following manufacturer’s blood DNA extraction protocol. DNA concentration was quantified by Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA), and quality was examined by agarose gel electrophoresis using E-Gel electrophoresis system (L ife Technologies, Carlsbad, CA, USA). Total DNA of bile samples was sheared into ~350bp fragments by Covaris M220 (Covaris, Woburn, MA, USA) and then multiplexed libraries were prepared using Illumina TruSeq Nano DNA Sample Preparation Kits (Illumina, San Diego, CA, USA) according to manufacturer’s instructions. Illumina HiSeq 2000 platform was used to generated 2x100 bp pair-end sequencing reads. SRS874482 SAMN03417496 B1_WGS_library WGS METAGENOMIC RANDOM 202 0 Application Read Forward 1 1 Application Read Reverse 102 Illumina HiSeq 2000 SRX957021 B2_WGS SRP056183 Without centrifugation of bile samples, total DNA of 400 μL bile per patient was extracted using Invitrogen Purelink Genomic DNA mini kit (Life Technologies, Carlsbad, CA, USA), following manufacturer’s blood DNA extraction protocol. DNA concentration was quantified by Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA), and quality was examined by agarose gel electrophoresis using E-Gel electrophoresis system (L ife Technologies, Carlsbad, CA, USA). Total DNA of bile samples was sheared into ~350bp fragments by Covaris M220 (Covaris, Woburn, MA, USA) and then multiplexed libraries were prepared using Illumina TruSeq Nano DNA Sample Preparation Kits (Illumina, San Diego, CA, USA) according to manufacturer’s instructions. Illumina HiSeq 2000 platform was used to generated 2x100 bp pair-end sequencing reads. SRS874483 SAMN03417497 B2_WGS_library WGS METAGENOMIC RANDOM 202 0 Application Read Forward 1 1 Application Read Reverse 102 Illumina HiSeq 2000 SRX957022 B4_WGS SRP056183 Without centrifugation of bile samples, total DNA of 400 μL bile per patient was extracted using Invitrogen Purelink Genomic DNA mini kit (Life Technologies, Carlsbad, CA, USA), following manufacturer’s blood DNA extraction protocol. DNA concentration was quantified by Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA), and quality was examined by agarose gel electrophoresis using E-Gel electrophoresis system (L ife Technologies, Carlsbad, CA, USA). Total DNA of bile samples was sheared into ~350bp fragments by Covaris M220 (Covaris, Woburn, MA, USA) and then multiplexed libraries were prepared using Illumina TruSeq Nano DNA Sample Preparation Kits (Illumina, San Diego, CA, USA) according to manufacturer’s instructions. Illumina HiSeq 2000 platform was used to generated 2x100 bp pair-end sequencing reads. SRS874484 SAMN03417498 B4_WGS_library WGS METAGENOMIC RANDOM 202 0 Application Read Forward 1 1 Application Read Reverse 102 Illumina HiSeq 2000 SRX957023 B5_WGS SRP056183 Without centrifugation of bile samples, total DNA of 400 μL bile per patient was extracted using Invitrogen Purelink Genomic DNA mini kit (Life Technologies, Carlsbad, CA, USA), following manufacturer’s blood DNA extraction protocol. DNA concentration was quantified by Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA), and quality was examined by agarose gel electrophoresis using E-Gel electrophoresis system (L ife Technologies, Carlsbad, CA, USA). Total DNA of bile samples was sheared into ~350bp fragments by Covaris M220 (Covaris, Woburn, MA, USA) and then multiplexed libraries were prepared using Illumina TruSeq Nano DNA Sample Preparation Kits (Illumina, San Diego, CA, USA) according to manufacturer’s instructions. Illumina HiSeq 2000 platform was used to generated 2x100 bp pair-end sequencing reads. SRS874485 SAMN03417499 B5_WGS_library WGS METAGENOMIC RANDOM 202 0 Application Read Forward 1 1 Application Read Reverse 102 Illumina HiSeq 2000 SRX957024 B6_WGS SRP056183 Without centrifugation of bile samples, total DNA of 400 μL bile per patient was extracted using Invitrogen Purelink Genomic DNA mini kit (Life Technologies, Carlsbad, CA, USA), following manufacturer’s blood DNA extraction protocol. DNA concentration was quantified by Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA), and quality was examined by agarose gel electrophoresis using E-Gel electrophoresis system (L ife Technologies, Carlsbad, CA, USA). Total DNA of bile samples was sheared into ~350bp fragments by Covaris M220 (Covaris, Woburn, MA, USA) and then multiplexed libraries were prepared using Illumina TruSeq Nano DNA Sample Preparation Kits (Illumina, San Diego, CA, USA) according to manufacturer’s instructions. Illumina HiSeq 2000 platform was used to generated 2x100 bp pair-end sequencing reads. SRS874486 SAMN03417500 B6_WGS_library WGS METAGENOMIC RANDOM 202 0 Application Read Forward 1 1 Application Read Reverse 102 Illumina HiSeq 2000 SRX957025 C1_WGS SRP056183 Without centrifugation of bile samples, total DNA of 400 μL bile per patient was extracted using Invitrogen Purelink Genomic DNA mini kit (Life Technologies, Carlsbad, CA, USA), following manufacturer’s blood DNA extraction protocol. DNA concentration was quantified by Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA), and quality was examined by agarose gel electrophoresis using E-Gel electrophoresis system (L ife Technologies, Carlsbad, CA, USA). Total DNA of bile samples was sheared into ~350bp fragments by Covaris M220 (Covaris, Woburn, MA, USA) and then multiplexed libraries were prepared using Illumina TruSeq Nano DNA Sample Preparation Kits (Illumina, San Diego, CA, USA) according to manufacturer’s instructions. Illumina HiSeq 2000 platform was used to generated 2x100 bp pair-end sequencing reads. SRS874487 SAMN03417501 C1_WGS_library WGS METAGENOMIC RANDOM 202 0 Application Read Forward 1 1 Application Read Reverse 102 Illumina HiSeq 2000 SRX957026 C2_WGS SRP056183 Without centrifugation of bile samples, total DNA of 400 μL bile per patient was extracted using Invitrogen Purelink Genomic DNA mini kit (Life Technologies, Carlsbad, CA, USA), following manufacturer’s blood DNA extraction protocol. DNA concentration was quantified by Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA), and quality was examined by agarose gel electrophoresis using E-Gel electrophoresis system (L ife Technologies, Carlsbad, CA, USA). Total DNA of bile samples was sheared into ~350bp fragments by Covaris M220 (Covaris, Woburn, MA, USA) and then multiplexed libraries were prepared using Illumina TruSeq Nano DNA Sample Preparation Kits (Illumina, San Diego, CA, USA) according to manufacturer’s instructions. Illumina HiSeq 2000 platform was used to generated 2x100 bp pair-end sequencing reads. SRS874488 SAMN03417502 C2_WGS_library WGS METAGENOMIC RANDOM 202 0 Application Read Forward 1 1 Application Read Reverse 102 Illumina HiSeq 2000 SRX957027 C3_WGS SRP056183 Without centrifugation of bile samples, total DNA of 400 μL bile per patient was extracted using Invitrogen Purelink Genomic DNA mini kit (Life Technologies, Carlsbad, CA, USA), following manufacturer’s blood DNA extraction protocol. DNA concentration was quantified by Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA), and quality was examined by agarose gel electrophoresis using E-Gel electrophoresis system (L ife Technologies, Carlsbad, CA, USA). Total DNA of bile samples was sheared into ~350bp fragments by Covaris M220 (Covaris, Woburn, MA, USA) and then multiplexed libraries were prepared using Illumina TruSeq Nano DNA Sample Preparation Kits (Illumina, San Diego, CA, USA) according to manufacturer’s instructions. Illumina HiSeq 2000 platform was used to generated 2x100 bp pair-end sequencing reads. SRS874489 SAMN03417503 C3_WGS_library WGS METAGENOMIC RANDOM 202 0 Application Read Forward 1 1 Application Read Reverse 102 Illumina HiSeq 2000 SRX957028 C4_WGS SRP056183 Without centrifugation of bile samples, total DNA of 400 μL bile per patient was extracted using Invitrogen Purelink Genomic DNA mini kit (Life Technologies, Carlsbad, CA, USA), following manufacturer’s blood DNA extraction protocol. DNA concentration was quantified by Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA), and quality was examined by agarose gel electrophoresis using E-Gel electrophoresis system (L ife Technologies, Carlsbad, CA, USA). Total DNA of bile samples was sheared into ~350bp fragments by Covaris M220 (Covaris, Woburn, MA, USA) and then multiplexed libraries were prepared using Illumina TruSeq Nano DNA Sample Preparation Kits (Illumina, San Diego, CA, USA) according to manufacturer’s instructions. Illumina HiSeq 2000 platform was used to generated 2x100 bp pair-end sequencing reads. SRS874490 SAMN03417504 C4_WGS_library WGS METAGENOMIC RANDOM 202 0 Application Read Forward 1 1 Application Read Reverse 102 Illumina HiSeq 2000 SRX957029 C5_WGS SRP056183 Without centrifugation of bile samples, total DNA of 400 μL bile per patient was extracted using Invitrogen Purelink Genomic DNA mini kit (Life Technologies, Carlsbad, CA, USA), following manufacturer’s blood DNA extraction protocol. DNA concentration was quantified by Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA), and quality was examined by agarose gel electrophoresis using E-Gel electrophoresis system (L ife Technologies, Carlsbad, CA, USA). Total DNA of bile samples was sheared into ~350bp fragments by Covaris M220 (Covaris, Woburn, MA, USA) and then multiplexed libraries were prepared using Illumina TruSeq Nano DNA Sample Preparation Kits (Illumina, San Diego, CA, USA) according to manufacturer’s instructions. Illumina HiSeq 2000 platform was used to generated 2x100 bp pair-end sequencing reads. SRS874491 SAMN03417505 C5_WGS_library WGS METAGENOMIC RANDOM 202 0 Application Read Forward 1 1 Application Read Reverse 102 Illumina HiSeq 2000 SRX957030 A3_16S_rDNA SRP056183 Without centrifugation of bile samples, total DNA of 400 μL bile per patient was extracted using Invitrogen Purelink Genomic DNA mini kit (Life Technologies, Carlsbad, CA, USA), following manufacturer’s blood DNA extraction protocol. DNA concentration was quantified by Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA), and quality was examined by agarose gel electrophoresis using E-Gel electrophoresis system (L ife Technologies, Carlsbad, CA, USA). Universal primer pairs 356F (forward, 5’CCTACGGGNGGCWGCAG3’) and reverse 803R (backward, 5’GACTACHVGGGTATCTAATCC3’) targeting V3-V4 region of bacterial 16S ribosome DNA (rDNA) gene were used for amplification. We employed a two-step PCR 16S rDNA gene amplification protocol used by Ottesen et. al. (2014) for amplification and library preparation. In brief, at the first step, target region of 16S rDNA was amplified using 16S primers with overhang adapters attached (forward primer overhang adapter 5’TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG3’ and reverse primer overhang adapter 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG3’). These overhang adapters are compatible with the Illumina Nextera DNA indices. Then, P5/P7 adapters and sample barcodes in Illumina Nextera XT index kit (Illumina, San Diego, CA, USA) were added to the cleaned-up PCR products by the second-round PCR. The final PCR products were cleaned up and sequenced by Illumina MiSeq platform to generate 2x250 bp paired-end reads, which could cover amplified 16S V3-V4 region. SRS874480 SAMN03417493 A3_16S_library AMPLICON METAGENOMIC PCR 502 0 Application Read Forward 1 1 Application Read Reverse 252 Illumina MiSeq SRX957031 A4_16S_rDNA SRP056183 Without centrifugation of bile samples, total DNA of 400 μL bile per patient was extracted using Invitrogen Purelink Genomic DNA mini kit (Life Technologies, Carlsbad, CA, USA), following manufacturer’s blood DNA extraction protocol. DNA concentration was quantified by Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA), and quality was examined by agarose gel electrophoresis using E-Gel electrophoresis system (L ife Technologies, Carlsbad, CA, USA). Universal primer pairs 356F (forward, 5’CCTACGGGNGGCWGCAG3’) and reverse 803R (backward, 5’GACTACHVGGGTATCTAATCC3’) targeting V3-V4 region of bacterial 16S ribosome DNA (rDNA) gene were used for amplification. We employed a two-step PCR 16S rDNA gene amplification protocol used by Ottesen et. al. (2014) for amplification and library preparation. In brief, at the first step, target region of 16S rDNA was amplified using 16S primers with overhang adapters attached (forward primer overhang adapter 5’TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG3’ and reverse primer overhang adapter 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG3’). These overhang adapters are compatible with the Illumina Nextera DNA indices. Then, P5/P7 adapters and sample barcodes in Illumina Nextera XT index kit (Illumina, San Diego, CA, USA) were added to the cleaned-up PCR products by the second-round PCR. The final PCR products were cleaned up and sequenced by Illumina MiSeq platform to generate 2x250 bp paired-end reads, which could cover amplified 16S V3-V4 region. SRS874479 SAMN03417494 A4_16S_library AMPLICON METAGENOMIC PCR 502 0 Application Read Forward 1 1 Application Read Reverse 252 Illumina MiSeq SRX957032 A5_16S_rDNA SRP056183 Without centrifugation of bile samples, total DNA of 400 μL bile per patient was extracted using Invitrogen Purelink Genomic DNA mini kit (Life Technologies, Carlsbad, CA, USA), following manufacturer’s blood DNA extraction protocol. DNA concentration was quantified by Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA), and quality was examined by agarose gel electrophoresis using E-Gel electrophoresis system (L ife Technologies, Carlsbad, CA, USA). Universal primer pairs 356F (forward, 5’CCTACGGGNGGCWGCAG3’) and reverse 803R (backward, 5’GACTACHVGGGTATCTAATCC3’) targeting V3-V4 region of bacterial 16S ribosome DNA (rDNA) gene were used for amplification. We employed a two-step PCR 16S rDNA gene amplification protocol used by Ottesen et. al. (2014) for amplification and library preparation. In brief, at the first step, target region of 16S rDNA was amplified using 16S primers with overhang adapters attached (forward primer overhang adapter 5’TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG3’ and reverse primer overhang adapter 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG3’). These overhang adapters are compatible with the Illumina Nextera DNA indices. Then, P5/P7 adapters and sample barcodes in Illumina Nextera XT index kit (Illumina, San Diego, CA, USA) were added to the cleaned-up PCR products by the second-round PCR. The final PCR products were cleaned up and sequenced by Illumina MiSeq platform to generate 2x250 bp paired-end reads, which could cover amplified 16S V3-V4 region. SRS874481 SAMN03417495 A5_16S_library AMPLICON METAGENOMIC PCR 502 0 Application Read Forward 1 1 Application Read Reverse 252 Illumina MiSeq SRX957033 B1_16S_rDNA SRP056183 Without centrifugation of bile samples, total DNA of 400 μL bile per patient was extracted using Invitrogen Purelink Genomic DNA mini kit (Life Technologies, Carlsbad, CA, USA), following manufacturer’s blood DNA extraction protocol. DNA concentration was quantified by Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA), and quality was examined by agarose gel electrophoresis using E-Gel electrophoresis system (L ife Technologies, Carlsbad, CA, USA). Universal primer pairs 356F (forward, 5’CCTACGGGNGGCWGCAG3’) and reverse 803R (backward, 5’GACTACHVGGGTATCTAATCC3’) targeting V3-V4 region of bacterial 16S ribosome DNA (rDNA) gene were used for amplification. We employed a two-step PCR 16S rDNA gene amplification protocol used by Ottesen et. al. (2014) for amplification and library preparation. In brief, at the first step, target region of 16S rDNA was amplified using 16S primers with overhang adapters attached (forward primer overhang adapter 5’TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG3’ and reverse primer overhang adapter 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG3’). These overhang adapters are compatible with the Illumina Nextera DNA indices. Then, P5/P7 adapters and sample barcodes in Illumina Nextera XT index kit (Illumina, San Diego, CA, USA) were added to the cleaned-up PCR products by the second-round PCR. The final PCR products were cleaned up and sequenced by Illumina MiSeq platform to generate 2x250 bp paired-end reads, which could cover amplified 16S V3-V4 region. SRS874482 SAMN03417496 B1_16S_library AMPLICON METAGENOMIC PCR 502 0 Application Read Forward 1 1 Application Read Reverse 252 Illumina MiSeq SRX957034 B2_16S_rDNA SRP056183 Without centrifugation of bile samples, total DNA of 400 μL bile per patient was extracted using Invitrogen Purelink Genomic DNA mini kit (Life Technologies, Carlsbad, CA, USA), following manufacturer’s blood DNA extraction protocol. DNA concentration was quantified by Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA), and quality was examined by agarose gel electrophoresis using E-Gel electrophoresis system (L ife Technologies, Carlsbad, CA, USA). Universal primer pairs 356F (forward, 5’CCTACGGGNGGCWGCAG3’) and reverse 803R (backward, 5’GACTACHVGGGTATCTAATCC3’) targeting V3-V4 region of bacterial 16S ribosome DNA (rDNA) gene were used for amplification. We employed a two-step PCR 16S rDNA gene amplification protocol used by Ottesen et. al. (2014) for amplification and library preparation. In brief, at the first step, target region of 16S rDNA was amplified using 16S primers with overhang adapters attached (forward primer overhang adapter 5’TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG3’ and reverse primer overhang adapter 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG3’). These overhang adapters are compatible with the Illumina Nextera DNA indices. Then, P5/P7 adapters and sample barcodes in Illumina Nextera XT index kit (Illumina, San Diego, CA, USA) were added to the cleaned-up PCR products by the second-round PCR. The final PCR products were cleaned up and sequenced by Illumina MiSeq platform to generate 2x250 bp paired-end reads, which could cover amplified 16S V3-V4 region. SRS874483 SAMN03417497 B2_16S_library AMPLICON METAGENOMIC PCR 502 0 Application Read Forward 1 1 Application Read Reverse 252 Illumina MiSeq SRX957035 B4_16S_rDNA SRP056183 Without centrifugation of bile samples, total DNA of 400 μL bile per patient was extracted using Invitrogen Purelink Genomic DNA mini kit (Life Technologies, Carlsbad, CA, USA), following manufacturer’s blood DNA extraction protocol. DNA concentration was quantified by Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA), and quality was examined by agarose gel electrophoresis using E-Gel electrophoresis system (L ife Technologies, Carlsbad, CA, USA). Universal primer pairs 356F (forward, 5’CCTACGGGNGGCWGCAG3’) and reverse 803R (backward, 5’GACTACHVGGGTATCTAATCC3’) targeting V3-V4 region of bacterial 16S ribosome DNA (rDNA) gene were used for amplification. We employed a two-step PCR 16S rDNA gene amplification protocol used by Ottesen et. al. (2014) for amplification and library preparation. In brief, at the first step, target region of 16S rDNA was amplified using 16S primers with overhang adapters attached (forward primer overhang adapter 5’TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG3’ and reverse primer overhang adapter 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG3’). These overhang adapters are compatible with the Illumina Nextera DNA indices. Then, P5/P7 adapters and sample barcodes in Illumina Nextera XT index kit (Illumina, San Diego, CA, USA) were added to the cleaned-up PCR products by the second-round PCR. The final PCR products were cleaned up and sequenced by Illumina MiSeq platform to generate 2x250 bp paired-end reads, which could cover amplified 16S V3-V4 region. SRS874484 SAMN03417498 B4_16S_library AMPLICON METAGENOMIC PCR 502 0 Application Read Forward 1 1 Application Read Reverse 252 Illumina MiSeq SRX957036 B5_16S_rDNA SRP056183 Without centrifugation of bile samples, total DNA of 400 μL bile per patient was extracted using Invitrogen Purelink Genomic DNA mini kit (Life Technologies, Carlsbad, CA, USA), following manufacturer’s blood DNA extraction protocol. DNA concentration was quantified by Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA), and quality was examined by agarose gel electrophoresis using E-Gel electrophoresis system (L ife Technologies, Carlsbad, CA, USA). Universal primer pairs 356F (forward, 5’CCTACGGGNGGCWGCAG3’) and reverse 803R (backward, 5’GACTACHVGGGTATCTAATCC3’) targeting V3-V4 region of bacterial 16S ribosome DNA (rDNA) gene were used for amplification. We employed a two-step PCR 16S rDNA gene amplification protocol used by Ottesen et. al. (2014) for amplification and library preparation. In brief, at the first step, target region of 16S rDNA was amplified using 16S primers with overhang adapters attached (forward primer overhang adapter 5’TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG3’ and reverse primer overhang adapter 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG3’). These overhang adapters are compatible with the Illumina Nextera DNA indices. Then, P5/P7 adapters and sample barcodes in Illumina Nextera XT index kit (Illumina, San Diego, CA, USA) were added to the cleaned-up PCR products by the second-round PCR. The final PCR products were cleaned up and sequenced by Illumina MiSeq platform to generate 2x250 bp paired-end reads, which could cover amplified 16S V3-V4 region. SRS874485 SAMN03417499 B5_16S_library AMPLICON METAGENOMIC PCR 502 0 Application Read Forward 1 1 Application Read Reverse 252 Illumina MiSeq SRX957037 B6_16S_rDNA SRP056183 Without centrifugation of bile samples, total DNA of 400 μL bile per patient was extracted using Invitrogen Purelink Genomic DNA mini kit (Life Technologies, Carlsbad, CA, USA), following manufacturer’s blood DNA extraction protocol. DNA concentration was quantified by Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA), and quality was examined by agarose gel electrophoresis using E-Gel electrophoresis system (L ife Technologies, Carlsbad, CA, USA). Universal primer pairs 356F (forward, 5’CCTACGGGNGGCWGCAG3’) and reverse 803R (backward, 5’GACTACHVGGGTATCTAATCC3’) targeting V3-V4 region of bacterial 16S ribosome DNA (rDNA) gene were used for amplification. We employed a two-step PCR 16S rDNA gene amplification protocol used by Ottesen et. al. (2014) for amplification and library preparation. In brief, at the first step, target region of 16S rDNA was amplified using 16S primers with overhang adapters attached (forward primer overhang adapter 5’TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG3’ and reverse primer overhang adapter 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG3’). These overhang adapters are compatible with the Illumina Nextera DNA indices. Then, P5/P7 adapters and sample barcodes in Illumina Nextera XT index kit (Illumina, San Diego, CA, USA) were added to the cleaned-up PCR products by the second-round PCR. The final PCR products were cleaned up and sequenced by Illumina MiSeq platform to generate 2x250 bp paired-end reads, which could cover amplified 16S V3-V4 region. SRS874486 SAMN03417500 B6_16S_library AMPLICON METAGENOMIC PCR 502 0 Application Read Forward 1 1 Application Read Reverse 252 Illumina MiSeq SRX957038 C1_16S_rDNA SRP056183 Without centrifugation of bile samples, total DNA of 400 μL bile per patient was extracted using Invitrogen Purelink Genomic DNA mini kit (Life Technologies, Carlsbad, CA, USA), following manufacturer’s blood DNA extraction protocol. DNA concentration was quantified by Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA), and quality was examined by agarose gel electrophoresis using E-Gel electrophoresis system (L ife Technologies, Carlsbad, CA, USA). Universal primer pairs 356F (forward, 5’CCTACGGGNGGCWGCAG3’) and reverse 803R (backward, 5’GACTACHVGGGTATCTAATCC3’) targeting V3-V4 region of bacterial 16S ribosome DNA (rDNA) gene were used for amplification. We employed a two-step PCR 16S rDNA gene amplification protocol used by Ottesen et. al. (2014) for amplification and library preparation. In brief, at the first step, target region of 16S rDNA was amplified using 16S primers with overhang adapters attached (forward primer overhang adapter 5’TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG3’ and reverse primer overhang adapter 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG3’). These overhang adapters are compatible with the Illumina Nextera DNA indices. Then, P5/P7 adapters and sample barcodes in Illumina Nextera XT index kit (Illumina, San Diego, CA, USA) were added to the cleaned-up PCR products by the second-round PCR. The final PCR products were cleaned up and sequenced by Illumina MiSeq platform to generate 2x250 bp paired-end reads, which could cover amplified 16S V3-V4 region. SRS874487 SAMN03417501 C1_16S_library AMPLICON METAGENOMIC PCR 502 0 Application Read Forward 1 1 Application Read Reverse 252 Illumina MiSeq SRX957039 C2_16S_rDNA SRP056183 Without centrifugation of bile samples, total DNA of 400 μL bile per patient was extracted using Invitrogen Purelink Genomic DNA mini kit (Life Technologies, Carlsbad, CA, USA), following manufacturer’s blood DNA extraction protocol. DNA concentration was quantified by Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA), and quality was examined by agarose gel electrophoresis using E-Gel electrophoresis system (L ife Technologies, Carlsbad, CA, USA). Universal primer pairs 356F (forward, 5’CCTACGGGNGGCWGCAG3’) and reverse 803R (backward, 5’GACTACHVGGGTATCTAATCC3’) targeting V3-V4 region of bacterial 16S ribosome DNA (rDNA) gene were used for amplification. We employed a two-step PCR 16S rDNA gene amplification protocol used by Ottesen et. al. (2014) for amplification and library preparation. In brief, at the first step, target region of 16S rDNA was amplified using 16S primers with overhang adapters attached (forward primer overhang adapter 5’TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG3’ and reverse primer overhang adapter 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG3’). These overhang adapters are compatible with the Illumina Nextera DNA indices. Then, P5/P7 adapters and sample barcodes in Illumina Nextera XT index kit (Illumina, San Diego, CA, USA) were added to the cleaned-up PCR products by the second-round PCR. The final PCR products were cleaned up and sequenced by Illumina MiSeq platform to generate 2x250 bp paired-end reads, which could cover amplified 16S V3-V4 region. SRS874488 SAMN03417502 C2_16S_library AMPLICON METAGENOMIC PCR 502 0 Application Read Forward 1 1 Application Read Reverse 252 Illumina MiSeq SRX957040 C3_16S_rDNA SRP056183 Without centrifugation of bile samples, total DNA of 400 μL bile per patient was extracted using Invitrogen Purelink Genomic DNA mini kit (Life Technologies, Carlsbad, CA, USA), following manufacturer’s blood DNA extraction protocol. DNA concentration was quantified by Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA), and quality was examined by agarose gel electrophoresis using E-Gel electrophoresis system (L ife Technologies, Carlsbad, CA, USA). Universal primer pairs 356F (forward, 5’CCTACGGGNGGCWGCAG3’) and reverse 803R (backward, 5’GACTACHVGGGTATCTAATCC3’) targeting V3-V4 region of bacterial 16S ribosome DNA (rDNA) gene were used for amplification. We employed a two-step PCR 16S rDNA gene amplification protocol used by Ottesen et. al. (2014) for amplification and library preparation. In brief, at the first step, target region of 16S rDNA was amplified using 16S primers with overhang adapters attached (forward primer overhang adapter 5’TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG3’ and reverse primer overhang adapter 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG3’). These overhang adapters are compatible with the Illumina Nextera DNA indices. Then, P5/P7 adapters and sample barcodes in Illumina Nextera XT index kit (Illumina, San Diego, CA, USA) were added to the cleaned-up PCR products by the second-round PCR. The final PCR products were cleaned up and sequenced by Illumina MiSeq platform to generate 2x250 bp paired-end reads, which could cover amplified 16S V3-V4 region. SRS874489 SAMN03417503 C3_16S_library AMPLICON METAGENOMIC PCR 502 0 Application Read Forward 1 1 Application Read Reverse 252 Illumina MiSeq SRX957041 C4_16S_rDNA SRP056183 Without centrifugation of bile samples, total DNA of 400 μL bile per patient was extracted using Invitrogen Purelink Genomic DNA mini kit (Life Technologies, Carlsbad, CA, USA), following manufacturer’s blood DNA extraction protocol. DNA concentration was quantified by Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA), and quality was examined by agarose gel electrophoresis using E-Gel electrophoresis system (L ife Technologies, Carlsbad, CA, USA). Universal primer pairs 356F (forward, 5’CCTACGGGNGGCWGCAG3’) and reverse 803R (backward, 5’GACTACHVGGGTATCTAATCC3’) targeting V3-V4 region of bacterial 16S ribosome DNA (rDNA) gene were used for amplification. We employed a two-step PCR 16S rDNA gene amplification protocol used by Ottesen et. al. (2014) for amplification and library preparation. In brief, at the first step, target region of 16S rDNA was amplified using 16S primers with overhang adapters attached (forward primer overhang adapter 5’TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG3’ and reverse primer overhang adapter 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG3’). These overhang adapters are compatible with the Illumina Nextera DNA indices. Then, P5/P7 adapters and sample barcodes in Illumina Nextera XT index kit (Illumina, San Diego, CA, USA) were added to the cleaned-up PCR products by the second-round PCR. The final PCR products were cleaned up and sequenced by Illumina MiSeq platform to generate 2x250 bp paired-end reads, which could cover amplified 16S V3-V4 region. SRS874490 SAMN03417504 C4_16S_library AMPLICON METAGENOMIC PCR 502 0 Application Read Forward 1 1 Application Read Reverse 252 Illumina MiSeq