SRX3381309 CX32_ITS_d4m5 SRP124742 bp0 Fungal ITS1-2 regions were PCR amplified using primers ITS1F CTTGGTCATTTAGAGGAAGTAA and TS2R GCTGCGTTCTTCATCGATGC. ITS1 amplicons were generated with 35 cycles using Invitrogen AccuPrime PCR reagents (Carlsbad, CA). Amplicons were then used in the second PCR reaction, using Illumina Nextera XT v2 (San Diego, CA) barcoded primers to uniquely index each sample and 2x300 paired end sequencing was performed on the Illumina MiSeq (Illumina, CA). DNA amplification PCR: Initial denaturation at 94C for 10 min, followed by 40 cycles of denaturation at 94C for 30 s, annealing at 55C for 30 s, and elongation at 72C for 2 min, followed by an elongation step at 72C for 30 min. SRS2676863 CX32d4m5 CX32_ITS_d4m5 AMPLICON METAGENOMIC PCR Illumina MiSeq SRX3381310 CX32_ITS_d4m4 SRP124742 bp0 Fungal ITS1-2 regions were PCR amplified using primers ITS1F CTTGGTCATTTAGAGGAAGTAA and TS2R GCTGCGTTCTTCATCGATGC. ITS1 amplicons were generated with 35 cycles using Invitrogen AccuPrime PCR reagents (Carlsbad, CA). Amplicons were then used in the second PCR reaction, using Illumina Nextera XT v2 (San Diego, CA) barcoded primers to uniquely index each sample and 2x300 paired end sequencing was performed on the Illumina MiSeq (Illumina, CA). DNA amplification PCR: Initial denaturation at 94C for 10 min, followed by 40 cycles of denaturation at 94C for 30 s, annealing at 55C for 30 s, and elongation at 72C for 2 min, followed by an elongation step at 72C for 30 min. SRS2676862 CX32d4m4 CX32_ITS_d4m4 AMPLICON METAGENOMIC PCR Illumina MiSeq SRX3381311 CX32_ITS_d4m18 SRP124742 bp0 Fungal ITS1-2 regions were PCR amplified using primers ITS1F CTTGGTCATTTAGAGGAAGTAA and TS2R GCTGCGTTCTTCATCGATGC. ITS1 amplicons were generated with 35 cycles using Invitrogen AccuPrime PCR reagents (Carlsbad, CA). Amplicons were then used in the second PCR reaction, using Illumina Nextera XT v2 (San Diego, CA) barcoded primers to uniquely index each sample and 2x300 paired end sequencing was performed on the Illumina MiSeq (Illumina, CA). DNA amplification PCR: Initial denaturation at 94C for 10 min, followed by 40 cycles of denaturation at 94C for 30 s, annealing at 55C for 30 s, and elongation at 72C for 2 min, followed by an elongation step at 72C for 30 min. SRS2676861 CX32d4m18 CX32_ITS_d4m18 AMPLICON METAGENOMIC PCR Illumina MiSeq SRX3381312 CX32_ITS_d4m17 SRP124742 bp0 Fungal ITS1-2 regions were PCR amplified using primers ITS1F CTTGGTCATTTAGAGGAAGTAA and TS2R GCTGCGTTCTTCATCGATGC. ITS1 amplicons were generated with 35 cycles using Invitrogen AccuPrime PCR reagents (Carlsbad, CA). Amplicons were then used in the second PCR reaction, using Illumina Nextera XT v2 (San Diego, CA) barcoded primers to uniquely index each sample and 2x300 paired end sequencing was performed on the Illumina MiSeq (Illumina, CA). DNA amplification PCR: Initial denaturation at 94C for 10 min, followed by 40 cycles of denaturation at 94C for 30 s, annealing at 55C for 30 s, and elongation at 72C for 2 min, followed by an elongation step at 72C for 30 min. SRS2676865 CX32d4m17 CX32_ITS_d4m17 AMPLICON METAGENOMIC PCR Illumina MiSeq SRX3381313 CX32_ITS_d4m16 SRP124742 bp0 Fungal ITS1-2 regions were PCR amplified using primers ITS1F CTTGGTCATTTAGAGGAAGTAA and TS2R GCTGCGTTCTTCATCGATGC. ITS1 amplicons were generated with 35 cycles using Invitrogen AccuPrime PCR reagents (Carlsbad, CA). Amplicons were then used in the second PCR reaction, using Illumina Nextera XT v2 (San Diego, CA) barcoded primers to uniquely index each sample and 2x300 paired end sequencing was performed on the Illumina MiSeq (Illumina, CA). DNA amplification PCR: Initial denaturation at 94C for 10 min, followed by 40 cycles of denaturation at 94C for 30 s, annealing at 55C for 30 s, and elongation at 72C for 2 min, followed by an elongation step at 72C for 30 min. SRS2676864 CX32d4m16 CX32_ITS_d4m16 AMPLICON METAGENOMIC PCR Illumina MiSeq SRX3381314 CX32_ITS_d4m14 SRP124742 bp0 Fungal ITS1-2 regions were PCR amplified using primers ITS1F CTTGGTCATTTAGAGGAAGTAA and TS2R GCTGCGTTCTTCATCGATGC. ITS1 amplicons were generated with 35 cycles using Invitrogen AccuPrime PCR reagents (Carlsbad, CA). Amplicons were then used in the second PCR reaction, using Illumina Nextera XT v2 (San Diego, CA) barcoded primers to uniquely index each sample and 2x300 paired end sequencing was performed on the Illumina MiSeq (Illumina, CA). DNA amplification PCR: Initial denaturation at 94C for 10 min, followed by 40 cycles of denaturation at 94C for 30 s, annealing at 55C for 30 s, and elongation at 72C for 2 min, followed by an elongation step at 72C for 30 min. SRS2676866 CX32d4m14 CX32_ITS_d4m14 AMPLICON METAGENOMIC PCR Illumina MiSeq SRX3381315 CX32_ITS_d4m13 SRP124742 bp0 Fungal ITS1-2 regions were PCR amplified using primers ITS1F CTTGGTCATTTAGAGGAAGTAA and TS2R GCTGCGTTCTTCATCGATGC. ITS1 amplicons were generated with 35 cycles using Invitrogen AccuPrime PCR reagents (Carlsbad, CA). Amplicons were then used in the second PCR reaction, using Illumina Nextera XT v2 (San Diego, CA) barcoded primers to uniquely index each sample and 2x300 paired end sequencing was performed on the Illumina MiSeq (Illumina, CA). DNA amplification PCR: Initial denaturation at 94C for 10 min, followed by 40 cycles of denaturation at 94C for 30 s, annealing at 55C for 30 s, and elongation at 72C for 2 min, followed by an elongation step at 72C for 30 min. SRS2676868 CX32d4m13 CX32_ITS_d4m13 AMPLICON METAGENOMIC PCR Illumina MiSeq SRX3381316 CX32_ITS_d4m1 SRP124742 bp0 Fungal ITS1-2 regions were PCR amplified using primers ITS1F CTTGGTCATTTAGAGGAAGTAA and TS2R GCTGCGTTCTTCATCGATGC. ITS1 amplicons were generated with 35 cycles using Invitrogen AccuPrime PCR reagents (Carlsbad, CA). Amplicons were then used in the second PCR reaction, using Illumina Nextera XT v2 (San Diego, CA) barcoded primers to uniquely index each sample and 2x300 paired end sequencing was performed on the Illumina MiSeq (Illumina, CA). DNA amplification PCR: Initial denaturation at 94C for 10 min, followed by 40 cycles of denaturation at 94C for 30 s, annealing at 55C for 30 s, and elongation at 72C for 2 min, followed by an elongation step at 72C for 30 min. SRS2676869 CX32d4m1 CX32_ITS_d4m1 AMPLICON METAGENOMIC PCR Illumina MiSeq SRX3381317 CX32_ITS_d4mB SRP124742 bp0 Fungal ITS1-2 regions were PCR amplified using primers ITS1F CTTGGTCATTTAGAGGAAGTAA and TS2R GCTGCGTTCTTCATCGATGC. ITS1 amplicons were generated with 35 cycles using Invitrogen AccuPrime PCR reagents (Carlsbad, CA). Amplicons were then used in the second PCR reaction, using Illumina Nextera XT v2 (San Diego, CA) barcoded primers to uniquely index each sample and 2x300 paired end sequencing was performed on the Illumina MiSeq (Illumina, CA). DNA amplification PCR: Initial denaturation at 94C for 10 min, followed by 40 cycles of denaturation at 94C for 30 s, annealing at 55C for 30 s, and elongation at 72C for 2 min, followed by an elongation step at 72C for 30 min. SRS2676867 CX32d4mB CX32_ITS_d4mB AMPLICON METAGENOMIC PCR Illumina MiSeq SRX3381318 CX32_ITS_d4mA SRP124742 bp0 Fungal ITS1-2 regions were PCR amplified using primers ITS1F CTTGGTCATTTAGAGGAAGTAA and TS2R GCTGCGTTCTTCATCGATGC. ITS1 amplicons were generated with 35 cycles using Invitrogen AccuPrime PCR reagents (Carlsbad, CA). Amplicons were then used in the second PCR reaction, using Illumina Nextera XT v2 (San Diego, CA) barcoded primers to uniquely index each sample and 2x300 paired end sequencing was performed on the Illumina MiSeq (Illumina, CA). DNA amplification PCR: Initial denaturation at 94C for 10 min, followed by 40 cycles of denaturation at 94C for 30 s, annealing at 55C for 30 s, and elongation at 72C for 2 min, followed by an elongation step at 72C for 30 min. SRS2676870 CX32d4mA CX32_ITS_d4mA AMPLICON METAGENOMIC PCR Illumina MiSeq