SRX3395625 16SAMP-13734_S5_L001_R1 SRP125056 PRJNA418409 Ten ng of extracted DNA was used as template and the PCR reaction (25 ?L) contained dNTPs (400nM of each), MgSO4 (1.5 mM), Platinum Taq DNA polymerase HF (2mU), 1X Platinum High Fidelity buffer (Thermo Fisher Scientific, USA), and barcoded library adaptors (400 nM) containing V1-3 specific primers: 27F AGAGTTTGATCCTGGCTCAG and 534R ATTACCGCGGCTGCTGG. SRS2689808 SAMN08026816 16SAMP-13734_S5 AMPLICON METAGENOMIC PCR Illumina MiSeq SRX3395626 16SAMP-13735_S6_L001_R1 SRP125056 PRJNA418409 Ten ng of extracted DNA was used as template and the PCR reaction (25 ?L) contained dNTPs (400nM of each), MgSO4 (1.5 mM), Platinum Taq DNA polymerase HF (2mU), 1X Platinum High Fidelity buffer (Thermo Fisher Scientific, USA), and barcoded library adaptors (400 nM) containing V1-3 specific primers: 27F AGAGTTTGATCCTGGCTCAG and 534R ATTACCGCGGCTGCTGG. SRS2689809 SAMN08026885 16SAMP-13735_S6 AMPLICON METAGENOMIC PCR Illumina MiSeq SRX3395627 16SAMP-13736_S7_L001_R1 SRP125056 PRJNA418409 Ten ng of extracted DNA was used as template and the PCR reaction (25 ?L) contained dNTPs (400nM of each), MgSO4 (1.5 mM), Platinum Taq DNA polymerase HF (2mU), 1X Platinum High Fidelity buffer (Thermo Fisher Scientific, USA), and barcoded library adaptors (400 nM) containing V1-3 specific primers: 27F AGAGTTTGATCCTGGCTCAG and 534R ATTACCGCGGCTGCTGG. SRS2689810 SAMN08027264 16SAMP-13736_S7 AMPLICON METAGENOMIC PCR Illumina MiSeq SRX3395628 16SAMP-13737_S8_L001_R1 SRP125056 PRJNA418409 Ten ng of extracted DNA was used as template and the PCR reaction (25 ?L) contained dNTPs (400nM of each), MgSO4 (1.5 mM), Platinum Taq DNA polymerase HF (2mU), 1X Platinum High Fidelity buffer (Thermo Fisher Scientific, USA), and barcoded library adaptors (400 nM) containing V1-3 specific primers: 27F AGAGTTTGATCCTGGCTCAG and 534R ATTACCGCGGCTGCTGG. SRS2689811 SAMN08027282 16SAMP-13737_S8 AMPLICON METAGENOMIC PCR Illumina MiSeq SRX3395629 16SAMP-13738_S9_L001_R1 SRP125056 PRJNA418409 Ten ng of extracted DNA was used as template and the PCR reaction (25 ?L) contained dNTPs (400nM of each), MgSO4 (1.5 mM), Platinum Taq DNA polymerase HF (2mU), 1X Platinum High Fidelity buffer (Thermo Fisher Scientific, USA), and barcoded library adaptors (400 nM) containing V1-3 specific primers: 27F AGAGTTTGATCCTGGCTCAG and 534R ATTACCGCGGCTGCTGG. SRS2689812 SAMN08027283 16SAMP-13738_S9 AMPLICON METAGENOMIC PCR Illumina MiSeq