SRX3398650 GSM2858910 SRP125099 SRS2692830 GSM2858910 RNA-Seq TRANSCRIPTOMIC cDNA Total RNAs were extracted by using RNeasy Mini Kit (Qiagen). Purified cDNA was digested with anchoring enzymes (NlaIII), resulting fragments were bound to streptavidin-coated beads (Dynabeads streptavidin M-280), and non-biotinylated cDNA fragments were removed by washing. Adapter-1 (5'– ACACTCTTTCCCTACACGACGCTCTTCCGATCTCAGCAGCATG –3', 5'– /Phos/CTGCTGAGATCGGAAGAGCGTCGTGTAGGGAAAGAG TGT/AmMO/ –3') was ligated to cDNA fragments on the beads and after washing digested with EcoP15I. EcoP15I-digested and released fragments (adapter-1- tags) were ligated to adapters-2 (5'– /Phos/AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC/AmMO/ –3', 5'– GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT –3'). Tags sandwiched between two adapters were amplified by PCR using PhusionHigh polymerase and GEX primers (5′- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTT CCGATCT -3′ and 5′- CAAGCAGAAGACGGCATACGAGATXXXXXXGTGACTGGAGTTC -3′, X; barcodes). The PCR regime consisted of 98°C for 30sec, 10–15 cycles at 98°C for 10sec, 60°C for 30sec and 72°C for 30sec. PCR products were run on an 8% non-denaturing polyacrylamide gel. After staining with SYBR green (Takara Bio), the band at 155–160bp was cut out from the gel, and DNA purified after its elution from the gel pieces. Illumina MiniSeq gds 302858910 GSM2858910 GEO Accession GSM2858910 SRX3398651 GSM2858911 SRP125099 SRS2692831 GSM2858911 RNA-Seq TRANSCRIPTOMIC cDNA Total RNAs were extracted by using RNeasy Mini Kit (Qiagen). Purified cDNA was digested with anchoring enzymes (NlaIII), resulting fragments were bound to streptavidin-coated beads (Dynabeads streptavidin M-280), and non-biotinylated cDNA fragments were removed by washing. Adapter-1 (5'– ACACTCTTTCCCTACACGACGCTCTTCCGATCTCAGCAGCATG –3', 5'– /Phos/CTGCTGAGATCGGAAGAGCGTCGTGTAGGGAAAGAG TGT/AmMO/ –3') was ligated to cDNA fragments on the beads and after washing digested with EcoP15I. EcoP15I-digested and released fragments (adapter-1- tags) were ligated to adapters-2 (5'– /Phos/AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC/AmMO/ –3', 5'– GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT –3'). Tags sandwiched between two adapters were amplified by PCR using PhusionHigh polymerase and GEX primers (5′- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTT CCGATCT -3′ and 5′- CAAGCAGAAGACGGCATACGAGATXXXXXXGTGACTGGAGTTC -3′, X; barcodes). The PCR regime consisted of 98°C for 30sec, 10–15 cycles at 98°C for 10sec, 60°C for 30sec and 72°C for 30sec. PCR products were run on an 8% non-denaturing polyacrylamide gel. After staining with SYBR green (Takara Bio), the band at 155–160bp was cut out from the gel, and DNA purified after its elution from the gel pieces. Illumina MiniSeq gds 302858911 GSM2858911 GEO Accession GSM2858911 SRX3398652 GSM2858912 SRP125099 SRS2692832 GSM2858912 RNA-Seq TRANSCRIPTOMIC cDNA Total RNAs were extracted by using RNeasy Mini Kit (Qiagen). Purified cDNA was digested with anchoring enzymes (NlaIII), resulting fragments were bound to streptavidin-coated beads (Dynabeads streptavidin M-280), and non-biotinylated cDNA fragments were removed by washing. Adapter-1 (5'– ACACTCTTTCCCTACACGACGCTCTTCCGATCTCAGCAGCATG –3', 5'– /Phos/CTGCTGAGATCGGAAGAGCGTCGTGTAGGGAAAGAG TGT/AmMO/ –3') was ligated to cDNA fragments on the beads and after washing digested with EcoP15I. EcoP15I-digested and released fragments (adapter-1- tags) were ligated to adapters-2 (5'– /Phos/AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC/AmMO/ –3', 5'– GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT –3'). Tags sandwiched between two adapters were amplified by PCR using PhusionHigh polymerase and GEX primers (5′- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTT CCGATCT -3′ and 5′- CAAGCAGAAGACGGCATACGAGATXXXXXXGTGACTGGAGTTC -3′, X; barcodes). The PCR regime consisted of 98°C for 30sec, 10–15 cycles at 98°C for 10sec, 60°C for 30sec and 72°C for 30sec. PCR products were run on an 8% non-denaturing polyacrylamide gel. After staining with SYBR green (Takara Bio), the band at 155–160bp was cut out from the gel, and DNA purified after its elution from the gel pieces. Illumina MiniSeq gds 302858912 GSM2858912 GEO Accession GSM2858912 SRX3398653 GSM2858913 SRP125099 SRS2692833 GSM2858913 RNA-Seq TRANSCRIPTOMIC cDNA Total RNAs were extracted by using RNeasy Mini Kit (Qiagen). Purified cDNA was digested with anchoring enzymes (NlaIII), resulting fragments were bound to streptavidin-coated beads (Dynabeads streptavidin M-280), and non-biotinylated cDNA fragments were removed by washing. Adapter-1 (5'– ACACTCTTTCCCTACACGACGCTCTTCCGATCTCAGCAGCATG –3', 5'– /Phos/CTGCTGAGATCGGAAGAGCGTCGTGTAGGGAAAGAG TGT/AmMO/ –3') was ligated to cDNA fragments on the beads and after washing digested with EcoP15I. EcoP15I-digested and released fragments (adapter-1- tags) were ligated to adapters-2 (5'– /Phos/AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC/AmMO/ –3', 5'– GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT –3'). Tags sandwiched between two adapters were amplified by PCR using PhusionHigh polymerase and GEX primers (5′- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTT CCGATCT -3′ and 5′- CAAGCAGAAGACGGCATACGAGATXXXXXXGTGACTGGAGTTC -3′, X; barcodes). The PCR regime consisted of 98°C for 30sec, 10–15 cycles at 98°C for 10sec, 60°C for 30sec and 72°C for 30sec. PCR products were run on an 8% non-denaturing polyacrylamide gel. After staining with SYBR green (Takara Bio), the band at 155–160bp was cut out from the gel, and DNA purified after its elution from the gel pieces. Illumina MiniSeq gds 302858913 GSM2858913 GEO Accession GSM2858913