SRX3889266 GSM3082701 SRP137675 SRS3127140 GSM3082701 OTHER GENOMIC other Genomic DNA extraction were preformed by a ammonium acetate and alcohol precipitation precedures. 1*10^8 cells were homogenized in 15 mL 4 M guanidine thiocyanate with RNaseA, after incubated at 37 oC for 30 mins,15 mL 8 M ammonium acetate were added and mixing. To precipitate DNA, 15 mL isopanol were added and mixing vigorously, the DNA were hooked to a new tube and washed by 70% ethanol. DNA were dissolved in 3 mL TE and extacted by 2 round of choloform. Two-step PCR amplification were performed on genomic DNA using Hifi DNA polymerase (Vazyme). The first PCR using Outer-F(CTTGGCTTTATATATCTTGTGGAAAGGAC)and Outer-R(GGAAAAAGGCGGAGCCAGTACACGAC) to primeramplification the region containing sgRNA cassette. The second PCR included amplification to attach Illumina adaptors and to barcode samples(F:AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTgtggaaaggacgaaacaccg, R:CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGCCAGTACACGACATCACTTTCC).The samples were multiplexing and sequencing in a single HiSeq-X run. HiSeq X Ten gds 303082701 GSM3082701 GEO Accession GSM3082701 SRX3889267 GSM3082702 SRP137675 SRS3127151 GSM3082702 OTHER GENOMIC other Genomic DNA extraction were preformed by a ammonium acetate and alcohol precipitation precedures. 1*10^8 cells were homogenized in 15 mL 4 M guanidine thiocyanate with RNaseA, after incubated at 37 oC for 30 mins,15 mL 8 M ammonium acetate were added and mixing. To precipitate DNA, 15 mL isopanol were added and mixing vigorously, the DNA were hooked to a new tube and washed by 70% ethanol. DNA were dissolved in 3 mL TE and extacted by 2 round of choloform. Two-step PCR amplification were performed on genomic DNA using Hifi DNA polymerase (Vazyme). The first PCR using Outer-F(CTTGGCTTTATATATCTTGTGGAAAGGAC)and Outer-R(GGAAAAAGGCGGAGCCAGTACACGAC) to primeramplification the region containing sgRNA cassette. The second PCR included amplification to attach Illumina adaptors and to barcode samples(F:AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTgtggaaaggacgaaacaccg, R:CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGCCAGTACACGACATCACTTTCC).The samples were multiplexing and sequencing in a single HiSeq-X run. HiSeq X Ten gds 303082702 GSM3082702 GEO Accession GSM3082702 SRX3889268 GSM3082703 SRP137675 SRS3127143 GSM3082703 OTHER GENOMIC other Genomic DNA extraction were preformed by a ammonium acetate and alcohol precipitation precedures. 1*10^8 cells were homogenized in 15 mL 4 M guanidine thiocyanate with RNaseA, after incubated at 37 oC for 30 mins,15 mL 8 M ammonium acetate were added and mixing. To precipitate DNA, 15 mL isopanol were added and mixing vigorously, the DNA were hooked to a new tube and washed by 70% ethanol. DNA were dissolved in 3 mL TE and extacted by 2 round of choloform. Two-step PCR amplification were performed on genomic DNA using Hifi DNA polymerase (Vazyme). The first PCR using Outer-F(CTTGGCTTTATATATCTTGTGGAAAGGAC)and Outer-R(GGAAAAAGGCGGAGCCAGTACACGAC) to primeramplification the region containing sgRNA cassette. The second PCR included amplification to attach Illumina adaptors and to barcode samples(F:AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTgtggaaaggacgaaacaccg, R:CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGCCAGTACACGACATCACTTTCC).The samples were multiplexing and sequencing in a single HiSeq-X run. HiSeq X Ten gds 303082703 GSM3082703 GEO Accession GSM3082703 SRX3889269 GSM3082704 SRP137675 SRS3127144 GSM3082704 OTHER GENOMIC other Genomic DNA extraction were preformed by a ammonium acetate and alcohol precipitation precedures. 1*10^8 cells were homogenized in 15 mL 4 M guanidine thiocyanate with RNaseA, after incubated at 37 oC for 30 mins,15 mL 8 M ammonium acetate were added and mixing. To precipitate DNA, 15 mL isopanol were added and mixing vigorously, the DNA were hooked to a new tube and washed by 70% ethanol. DNA were dissolved in 3 mL TE and extacted by 2 round of choloform. Two-step PCR amplification were performed on genomic DNA using Hifi DNA polymerase (Vazyme). The first PCR using Outer-F(CTTGGCTTTATATATCTTGTGGAAAGGAC)and Outer-R(GGAAAAAGGCGGAGCCAGTACACGAC) to primeramplification the region containing sgRNA cassette. The second PCR included amplification to attach Illumina adaptors and to barcode samples(F:AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTgtggaaaggacgaaacaccg, R:CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGCCAGTACACGACATCACTTTCC).The samples were multiplexing and sequencing in a single HiSeq-X run. HiSeq X Ten gds 303082704 GSM3082704 GEO Accession GSM3082704 SRX3889270 GSM3082705 SRP137675 SRS3127150 GSM3082705 OTHER GENOMIC other Genomic DNA extraction were preformed by a ammonium acetate and alcohol precipitation precedures. 1*10^8 cells were homogenized in 15 mL 4 M guanidine thiocyanate with RNaseA, after incubated at 37 oC for 30 mins,15 mL 8 M ammonium acetate were added and mixing. To precipitate DNA, 15 mL isopanol were added and mixing vigorously, the DNA were hooked to a new tube and washed by 70% ethanol. DNA were dissolved in 3 mL TE and extacted by 2 round of choloform. Two-step PCR amplification were performed on genomic DNA using Hifi DNA polymerase (Vazyme). The first PCR using Outer-F(CTTGGCTTTATATATCTTGTGGAAAGGAC)and Outer-R(GGAAAAAGGCGGAGCCAGTACACGAC) to primeramplification the region containing sgRNA cassette. The second PCR included amplification to attach Illumina adaptors and to barcode samples(F:AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTgtggaaaggacgaaacaccg, R:CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGCCAGTACACGACATCACTTTCC).The samples were multiplexing and sequencing in a single HiSeq-X run. HiSeq X Ten gds 303082705 GSM3082705 GEO Accession GSM3082705 SRX3889271 GSM3082706 SRP137675 SRS3127147 GSM3082706 OTHER GENOMIC other Genomic DNA extraction were preformed by a ammonium acetate and alcohol precipitation precedures. 1*10^8 cells were homogenized in 15 mL 4 M guanidine thiocyanate with RNaseA, after incubated at 37 oC for 30 mins,15 mL 8 M ammonium acetate were added and mixing. To precipitate DNA, 15 mL isopanol were added and mixing vigorously, the DNA were hooked to a new tube and washed by 70% ethanol. DNA were dissolved in 3 mL TE and extacted by 2 round of choloform. Two-step PCR amplification were performed on genomic DNA using Hifi DNA polymerase (Vazyme). The first PCR using Outer-F(CTTGGCTTTATATATCTTGTGGAAAGGAC)and Outer-R(GGAAAAAGGCGGAGCCAGTACACGAC) to primeramplification the region containing sgRNA cassette. The second PCR included amplification to attach Illumina adaptors and to barcode samples(F:AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTgtggaaaggacgaaacaccg, R:CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGCCAGTACACGACATCACTTTCC).The samples were multiplexing and sequencing in a single HiSeq-X run. HiSeq X Ten gds 303082706 GSM3082706 GEO Accession GSM3082706 SRX3889272 GSM3082707 SRP137675 SRS3127148 GSM3082707 OTHER GENOMIC other Genomic DNA extraction were preformed by a ammonium acetate and alcohol precipitation precedures. 1*10^8 cells were homogenized in 15 mL 4 M guanidine thiocyanate with RNaseA, after incubated at 37 oC for 30 mins,15 mL 8 M ammonium acetate were added and mixing. To precipitate DNA, 15 mL isopanol were added and mixing vigorously, the DNA were hooked to a new tube and washed by 70% ethanol. DNA were dissolved in 3 mL TE and extacted by 2 round of choloform. Two-step PCR amplification were performed on genomic DNA using Hifi DNA polymerase (Vazyme). The first PCR using Outer-F(CTTGGCTTTATATATCTTGTGGAAAGGAC)and Outer-R(GGAAAAAGGCGGAGCCAGTACACGAC) to primeramplification the region containing sgRNA cassette. The second PCR included amplification to attach Illumina adaptors and to barcode samples(F:AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTgtggaaaggacgaaacaccg, R:CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGCCAGTACACGACATCACTTTCC).The samples were multiplexing and sequencing in a single HiSeq-X run. HiSeq X Ten gds 303082707 GSM3082707 GEO Accession GSM3082707 SRX3889273 GSM3082708 SRP137675 SRS3127145 GSM3082708 OTHER GENOMIC other Genomic DNA extraction were preformed by a ammonium acetate and alcohol precipitation precedures. 1*10^8 cells were homogenized in 15 mL 4 M guanidine thiocyanate with RNaseA, after incubated at 37 oC for 30 mins,15 mL 8 M ammonium acetate were added and mixing. To precipitate DNA, 15 mL isopanol were added and mixing vigorously, the DNA were hooked to a new tube and washed by 70% ethanol. DNA were dissolved in 3 mL TE and extacted by 2 round of choloform. Two-step PCR amplification were performed on genomic DNA using Hifi DNA polymerase (Vazyme). The first PCR using Outer-F(CTTGGCTTTATATATCTTGTGGAAAGGAC)and Outer-R(GGAAAAAGGCGGAGCCAGTACACGAC) to primeramplification the region containing sgRNA cassette. The second PCR included amplification to attach Illumina adaptors and to barcode samples(F:AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTgtggaaaggacgaaacaccg, R:CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGCCAGTACACGACATCACTTTCC).The samples were multiplexing and sequencing in a single HiSeq-X run. HiSeq X Ten gds 303082708 GSM3082708 GEO Accession GSM3082708 SRX3889274 GSM3082709 SRP137675 SRS3127146 GSM3082709 OTHER GENOMIC other Genomic DNA extraction were preformed by a ammonium acetate and alcohol precipitation precedures. 1*10^8 cells were homogenized in 15 mL 4 M guanidine thiocyanate with RNaseA, after incubated at 37 oC for 30 mins,15 mL 8 M ammonium acetate were added and mixing. To precipitate DNA, 15 mL isopanol were added and mixing vigorously, the DNA were hooked to a new tube and washed by 70% ethanol. DNA were dissolved in 3 mL TE and extacted by 2 round of choloform. Two-step PCR amplification were performed on genomic DNA using Hifi DNA polymerase (Vazyme). The first PCR using Outer-F(CTTGGCTTTATATATCTTGTGGAAAGGAC)and Outer-R(GGAAAAAGGCGGAGCCAGTACACGAC) to primeramplification the region containing sgRNA cassette. The second PCR included amplification to attach Illumina adaptors and to barcode samples(F:AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTgtggaaaggacgaaacaccg, R:CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGCCAGTACACGACATCACTTTCC).The samples were multiplexing and sequencing in a single HiSeq-X run. HiSeq X Ten gds 303082709 GSM3082709 GEO Accession GSM3082709 SRX3889275 GSM3082710 SRP137675 SRS3127149 GSM3082710 OTHER GENOMIC other Genomic DNA extraction were preformed by a ammonium acetate and alcohol precipitation precedures. 1*10^8 cells were homogenized in 15 mL 4 M guanidine thiocyanate with RNaseA, after incubated at 37 oC for 30 mins,15 mL 8 M ammonium acetate were added and mixing. To precipitate DNA, 15 mL isopanol were added and mixing vigorously, the DNA were hooked to a new tube and washed by 70% ethanol. DNA were dissolved in 3 mL TE and extacted by 2 round of choloform. Two-step PCR amplification were performed on genomic DNA using Hifi DNA polymerase (Vazyme). The first PCR using Outer-F(CTTGGCTTTATATATCTTGTGGAAAGGAC)and Outer-R(GGAAAAAGGCGGAGCCAGTACACGAC) to primeramplification the region containing sgRNA cassette. The second PCR included amplification to attach Illumina adaptors and to barcode samples(F:AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTgtggaaaggacgaaacaccg, R:CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGCCAGTACACGACATCACTTTCC).The samples were multiplexing and sequencing in a single HiSeq-X run. HiSeq X Ten gds 303082710 GSM3082710 GEO Accession GSM3082710