SRX5099255 GSM3502439 SRP172675 SRS4109625 GSM3502439 OTHER GENOMIC other 4C-seq libraries were prepared following the published protocol (van de Werken et al., 2012). DpnII was used for the first digestion, and Csp6I was used in the second digestion. For each viewpoint, a total of 1.6 mg of each library was amplified by PCR with the following primers: 4C_Shh_D/C_Read: CCATCCCCAGATGTGAGTGT,4C_Shh_D/C_Rev: CCATCGCAGCCCCAGTCT Samples were sequenced with Ilumina Hi-Seq technology according to standard procedures. Illumina HiSeq 2500 gds 303502439 GSM3502439 GEO Accession GSM3502439 SRX5099256 GSM3502440 SRP172675 SRS4109626 GSM3502440 OTHER GENOMIC other 4C-seq libraries were prepared following the published protocol (van de Werken et al., 2012). DpnII was used for the first digestion, and Csp6I was used in the second digestion. For each viewpoint, a total of 1.6 mg of each library was amplified by PCR with the following primers: 4C_Shh_D/C_Read: CCATCCCCAGATGTGAGTGT,4C_Shh_D/C_Rev: CCATCGCAGCCCCAGTCT Samples were sequenced with Ilumina Hi-Seq technology according to standard procedures. Illumina HiSeq 2500 gds 303502440 GSM3502440 GEO Accession GSM3502440 SRX5099257 GSM3502441 SRP172675 SRS4109627 GSM3502441 OTHER GENOMIC other 4C-seq libraries were prepared following the published protocol (van de Werken et al., 2012). DpnII was used for the first digestion, and Csp6I was used in the second digestion. For each viewpoint, a total of 1.6 mg of each library was amplified by PCR with the following primers: 4C_Shh_D/C_Read: CCATCCCCAGATGTGAGTGT,4C_Shh_D/C_Rev: CCATCGCAGCCCCAGTCT Samples were sequenced with Ilumina Hi-Seq technology according to standard procedures. Illumina HiSeq 2500 gds 303502441 GSM3502441 GEO Accession GSM3502441 SRX5099258 GSM3502442 SRP172675 SRS4109628 GSM3502442 OTHER GENOMIC other 4C-seq libraries were prepared following the published protocol (van de Werken et al., 2012). DpnII was used for the first digestion, and Csp6I was used in the second digestion. For each viewpoint, a total of 1.6 mg of each library was amplified by PCR with the following primers: 4C_Shh_D/C_Read: CCATCCCCAGATGTGAGTGT,4C_Shh_D/C_Rev: CCATCGCAGCCCCAGTCT Samples were sequenced with Ilumina Hi-Seq technology according to standard procedures. Illumina HiSeq 2500 gds 303502442 GSM3502442 GEO Accession GSM3502442