SRX5105090 GSM3504768 SRP172827 PRJNA508883 SRS4114573 SAMN10532326 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504768 GSM3504768 GEO Accession GSM3504768 SRX5105091 GSM3504769 SRP172827 PRJNA508883 SRS4114574 SAMN10532325 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504769 GSM3504769 GEO Accession GSM3504769 SRX5105092 GSM3504770 SRP172827 PRJNA508883 SRS4114575 SAMN10532324 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504770 GSM3504770 GEO Accession GSM3504770 SRX5105093 GSM3504771 SRP172827 PRJNA508883 SRS4114576 SAMN10532323 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504771 GSM3504771 GEO Accession GSM3504771 SRX5105094 GSM3504772 SRP172827 PRJNA508883 SRS4114577 SAMN10532322 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504772 GSM3504772 GEO Accession GSM3504772 SRX5105095 GSM3504773 SRP172827 PRJNA508883 SRS4114578 SAMN10532321 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504773 GSM3504773 GEO Accession GSM3504773 SRX5105096 GSM3504774 SRP172827 PRJNA508883 SRS4114579 SAMN10532320 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504774 GSM3504774 GEO Accession GSM3504774 SRX5105097 GSM3504775 SRP172827 PRJNA508883 SRS4114580 SAMN10532319 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504775 GSM3504775 GEO Accession GSM3504775 SRX5105098 GSM3504776 SRP172827 PRJNA508883 SRS4114581 SAMN10532318 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504776 GSM3504776 GEO Accession GSM3504776 SRX5105099 GSM3504777 SRP172827 PRJNA508883 SRS4114582 SAMN10532317 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504777 GSM3504777 GEO Accession GSM3504777 SRX5105100 GSM3504778 SRP172827 PRJNA508883 SRS4114583 SAMN10532316 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504778 GSM3504778 GEO Accession GSM3504778 SRX5105101 GSM3504779 SRP172827 PRJNA508883 SRS4114584 SAMN10532315 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504779 GSM3504779 GEO Accession GSM3504779 SRX5105102 GSM3504780 SRP172827 PRJNA508883 SRS4114585 SAMN10532314 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504780 GSM3504780 GEO Accession GSM3504780 SRX5105103 GSM3504781 SRP172827 PRJNA508883 SRS4114586 SAMN10532313 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504781 GSM3504781 GEO Accession GSM3504781 SRX5105104 GSM3504782 SRP172827 PRJNA508883 SRS4114587 SAMN10532309 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504782 GSM3504782 GEO Accession GSM3504782 SRX5105105 GSM3504783 SRP172827 PRJNA508883 SRS4114588 SAMN10532308 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504783 GSM3504783 GEO Accession GSM3504783 SRX5105106 GSM3504784 SRP172827 PRJNA508883 SRS4114589 SAMN10532312 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504784 GSM3504784 GEO Accession GSM3504784 SRX5105107 GSM3504785 SRP172827 PRJNA508883 SRS4114590 SAMN10532311 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504785 GSM3504785 GEO Accession GSM3504785 SRX5105108 GSM3504786 SRP172827 PRJNA508883 SRS4114591 SAMN10532310 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504786 GSM3504786 GEO Accession GSM3504786 SRX5105109 GSM3504787 SRP172827 PRJNA508883 SRS4114592 SAMN10532307 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504787 GSM3504787 GEO Accession GSM3504787 SRX5105110 GSM3504788 SRP172827 PRJNA508883 SRS4114593 SAMN10532306 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504788 GSM3504788 GEO Accession GSM3504788 SRX5105111 GSM3504789 SRP172827 PRJNA508883 SRS4114594 SAMN10532305 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504789 GSM3504789 GEO Accession GSM3504789 SRX5105112 GSM3504790 SRP172827 PRJNA508883 SRS4114595 SAMN10532359 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504790 GSM3504790 GEO Accession GSM3504790 SRX5105113 GSM3504791 SRP172827 PRJNA508883 SRS4114596 SAMN10532358 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504791 GSM3504791 GEO Accession GSM3504791 SRX5105114 GSM3504792 SRP172827 PRJNA508883 SRS4114597 SAMN10532357 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504792 GSM3504792 GEO Accession GSM3504792 SRX5105115 GSM3504793 SRP172827 PRJNA508883 SRS4114598 SAMN10532356 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504793 GSM3504793 GEO Accession GSM3504793 SRX5105116 GSM3504794 SRP172827 PRJNA508883 SRS4114599 SAMN10532355 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504794 GSM3504794 GEO Accession GSM3504794 SRX5105117 GSM3504795 SRP172827 PRJNA508883 SRS4114600 SAMN10532354 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504795 GSM3504795 GEO Accession GSM3504795 SRX5105118 GSM3504796 SRP172827 PRJNA508883 SRS4114601 SAMN10532433 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504796 GSM3504796 GEO Accession GSM3504796 SRX5105119 GSM3504797 SRP172827 PRJNA508883 SRS4114602 SAMN10532432 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504797 GSM3504797 GEO Accession GSM3504797 SRX5105120 GSM3504798 SRP172827 PRJNA508883 SRS4114603 SAMN10532431 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504798 GSM3504798 GEO Accession GSM3504798 SRX5105121 GSM3504799 SRP172827 PRJNA508883 SRS4114604 SAMN10532430 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504799 GSM3504799 GEO Accession GSM3504799 SRX5105122 GSM3504800 SRP172827 PRJNA508883 SRS4114605 SAMN10532429 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504800 GSM3504800 GEO Accession GSM3504800 SRX5105123 GSM3504801 SRP172827 PRJNA508883 SRS4114606 SAMN10532428 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504801 GSM3504801 GEO Accession GSM3504801 SRX5105124 GSM3504802 SRP172827 PRJNA508883 SRS4114607 SAMN10532427 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504802 GSM3504802 GEO Accession GSM3504802 SRX5105125 GSM3504803 SRP172827 PRJNA508883 SRS4114608 SAMN10532426 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504803 GSM3504803 GEO Accession GSM3504803 SRX5105126 GSM3504804 SRP172827 PRJNA508883 SRS4114609 SAMN10532425 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504804 GSM3504804 GEO Accession GSM3504804 SRX5105127 GSM3504805 SRP172827 PRJNA508883 SRS4114610 SAMN10532424 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504805 GSM3504805 GEO Accession GSM3504805 SRX5105128 GSM3504806 SRP172827 PRJNA508883 SRS4114611 SAMN10532467 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504806 GSM3504806 GEO Accession GSM3504806 SRX5105129 GSM3504807 SRP172827 PRJNA508883 SRS4114612 SAMN10532466 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504807 GSM3504807 GEO Accession GSM3504807 SRX5105130 GSM3504808 SRP172827 PRJNA508883 SRS4114613 SAMN10532465 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504808 GSM3504808 GEO Accession GSM3504808 SRX5105131 GSM3504809 SRP172827 PRJNA508883 SRS4114614 SAMN10532464 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504809 GSM3504809 GEO Accession GSM3504809 SRX5105132 GSM3504810 SRP172827 PRJNA508883 SRS4114615 SAMN10532462 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504810 GSM3504810 GEO Accession GSM3504810 SRX5105133 GSM3504811 SRP172827 PRJNA508883 SRS4114616 SAMN10532461 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504811 GSM3504811 GEO Accession GSM3504811 SRX5105134 GSM3504812 SRP172827 PRJNA508883 SRS4114617 SAMN10532460 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504812 GSM3504812 GEO Accession GSM3504812 SRX5105135 GSM3504813 SRP172827 PRJNA508883 SRS4114618 SAMN10532459 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504813 GSM3504813 GEO Accession GSM3504813 SRX5105136 GSM3504814 SRP172827 PRJNA508883 SRS4114619 SAMN10532463 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504814 GSM3504814 GEO Accession GSM3504814 SRX5105137 GSM3504815 SRP172827 PRJNA508883 SRS4114620 SAMN10532458 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504815 GSM3504815 GEO Accession GSM3504815 SRX5105138 GSM3504816 SRP172827 PRJNA508883 SRS4114621 SAMN10532457 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504816 GSM3504816 GEO Accession GSM3504816 SRX5105139 GSM3504817 SRP172827 PRJNA508883 SRS4114622 SAMN10532456 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504817 GSM3504817 GEO Accession GSM3504817 SRX5105140 GSM3504818 SRP172827 PRJNA508883 SRS4114623 SAMN10532455 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504818 GSM3504818 GEO Accession GSM3504818 SRX5105141 GSM3504819 SRP172827 PRJNA508883 SRS4114624 SAMN10532454 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504819 GSM3504819 GEO Accession GSM3504819 SRX5105142 GSM3504820 SRP172827 PRJNA508883 SRS4114625 SAMN10532453 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504820 GSM3504820 GEO Accession GSM3504820 SRX5105143 GSM3504821 SRP172827 PRJNA508883 SRS4114626 SAMN10532452 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504821 GSM3504821 GEO Accession GSM3504821 SRX5105144 GSM3504822 SRP172827 PRJNA508883 SRS4114627 SAMN10532451 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504822 GSM3504822 GEO Accession GSM3504822 SRX5105145 GSM3504823 SRP172827 PRJNA508883 SRS4114628 SAMN10532450 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504823 GSM3504823 GEO Accession GSM3504823 SRX5105146 GSM3504824 SRP172827 PRJNA508883 SRS4114629 SAMN10532449 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504824 GSM3504824 GEO Accession GSM3504824 SRX5105147 GSM3504825 SRP172827 PRJNA508883 SRS4114630 SAMN10532413 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504825 GSM3504825 GEO Accession GSM3504825 SRX5105148 GSM3504826 SRP172827 PRJNA508883 SRS4114631 SAMN10532412 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504826 GSM3504826 GEO Accession GSM3504826 SRX5105149 GSM3504827 SRP172827 PRJNA508883 SRS4114632 SAMN10532411 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504827 GSM3504827 GEO Accession GSM3504827 SRX5105150 GSM3504828 SRP172827 PRJNA508883 SRS4114633 SAMN10532410 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504828 GSM3504828 GEO Accession GSM3504828 SRX5105151 GSM3504829 SRP172827 PRJNA508883 SRS4114634 SAMN10532409 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504829 GSM3504829 GEO Accession GSM3504829 SRX5105152 GSM3504830 SRP172827 PRJNA508883 SRS4114635 SAMN10532408 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504830 GSM3504830 GEO Accession GSM3504830 SRX5105153 GSM3504831 SRP172827 PRJNA508883 SRS4114636 SAMN10532407 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504831 GSM3504831 GEO Accession GSM3504831 SRX5105154 GSM3504832 SRP172827 PRJNA508883 SRS4114637 SAMN10532406 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504832 GSM3504832 GEO Accession GSM3504832 SRX5105155 GSM3504833 SRP172827 PRJNA508883 SRS4114638 SAMN10532405 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504833 GSM3504833 GEO Accession GSM3504833 SRX5105156 GSM3504834 SRP172827 PRJNA508883 SRS4114639 SAMN10532404 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504834 GSM3504834 GEO Accession GSM3504834 SRX5105157 GSM3504835 SRP172827 PRJNA508883 SRS4114640 SAMN10532403 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504835 GSM3504835 GEO Accession GSM3504835 SRX5105158 GSM3504836 SRP172827 PRJNA508883 SRS4114641 SAMN10532402 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504836 GSM3504836 GEO Accession GSM3504836 SRX5105159 GSM3504837 SRP172827 PRJNA508883 SRS4114642 SAMN10532401 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504837 GSM3504837 GEO Accession GSM3504837 SRX5105160 GSM3504838 SRP172827 PRJNA508883 SRS4114643 SAMN10532400 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504838 GSM3504838 GEO Accession GSM3504838 SRX5105161 GSM3504839 SRP172827 PRJNA508883 SRS4114644 SAMN10532399 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504839 GSM3504839 GEO Accession GSM3504839 SRX5105162 GSM3504840 SRP172827 PRJNA508883 SRS4114645 SAMN10532448 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504840 GSM3504840 GEO Accession GSM3504840 SRX5105163 GSM3504841 SRP172827 PRJNA508883 SRS4114646 SAMN10532447 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504841 GSM3504841 GEO Accession GSM3504841 SRX5105164 GSM3504842 SRP172827 PRJNA508883 SRS4114647 SAMN10532446 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504842 GSM3504842 GEO Accession GSM3504842 SRX5105165 GSM3504843 SRP172827 PRJNA508883 SRS4114648 SAMN10532445 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504843 GSM3504843 GEO Accession GSM3504843 SRX5105166 GSM3504844 SRP172827 PRJNA508883 SRS4114649 SAMN10532444 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504844 GSM3504844 GEO Accession GSM3504844 SRX5105167 GSM3504845 SRP172827 PRJNA508883 SRS4114650 SAMN10532443 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504845 GSM3504845 GEO Accession GSM3504845 SRX5105168 GSM3504846 SRP172827 PRJNA508883 SRS4114651 SAMN10532442 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504846 GSM3504846 GEO Accession GSM3504846 SRX5105169 GSM3504847 SRP172827 PRJNA508883 SRS4114652 SAMN10532441 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504847 GSM3504847 GEO Accession GSM3504847 SRX5105170 GSM3504848 SRP172827 PRJNA508883 SRS4114653 SAMN10532440 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504848 GSM3504848 GEO Accession GSM3504848 SRX5105171 GSM3504849 SRP172827 PRJNA508883 SRS4114654 SAMN10532439 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504849 GSM3504849 GEO Accession GSM3504849 SRX5105172 GSM3504850 SRP172827 PRJNA508883 SRS4114655 SAMN10532438 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504850 GSM3504850 GEO Accession GSM3504850 SRX5105173 GSM3504851 SRP172827 PRJNA508883 SRS4114656 SAMN10532437 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504851 GSM3504851 GEO Accession GSM3504851 SRX5105174 GSM3504852 SRP172827 PRJNA508883 SRS4114657 SAMN10532436 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504852 GSM3504852 GEO Accession GSM3504852 SRX5105175 GSM3504853 SRP172827 PRJNA508883 SRS4114658 SAMN10532435 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504853 GSM3504853 GEO Accession GSM3504853 SRX5105176 GSM3504854 SRP172827 PRJNA508883 SRS4114659 SAMN10532434 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504854 GSM3504854 GEO Accession GSM3504854 SRX5105177 GSM3504855 SRP172827 PRJNA508883 SRS4114660 SAMN10532398 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504855 GSM3504855 GEO Accession GSM3504855 SRX5105178 GSM3504856 SRP172827 PRJNA508883 SRS4114661 SAMN10532397 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504856 GSM3504856 GEO Accession GSM3504856 SRX5105179 GSM3504857 SRP172827 PRJNA508883 SRS4114662 SAMN10532396 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504857 GSM3504857 GEO Accession GSM3504857 SRX5105180 GSM3504858 SRP172827 PRJNA508883 SRS4114663 SAMN10532395 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504858 GSM3504858 GEO Accession GSM3504858 SRX5105181 GSM3504859 SRP172827 PRJNA508883 SRS4114664 SAMN10532394 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504859 GSM3504859 GEO Accession GSM3504859 SRX5105182 GSM3504860 SRP172827 PRJNA508883 SRS4114665 SAMN10532393 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504860 GSM3504860 GEO Accession GSM3504860 SRX5105183 GSM3504861 SRP172827 PRJNA508883 SRS4114666 SAMN10532392 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504861 GSM3504861 GEO Accession GSM3504861 SRX5105184 GSM3504862 SRP172827 PRJNA508883 SRS4114667 SAMN10532391 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504862 GSM3504862 GEO Accession GSM3504862 SRX5105185 GSM3504863 SRP172827 PRJNA508883 SRS4114668 SAMN10532389 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504863 GSM3504863 GEO Accession GSM3504863 SRX5105186 GSM3504864 SRP172827 PRJNA508883 SRS4114669 SAMN10532388 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504864 GSM3504864 GEO Accession GSM3504864 SRX5105187 GSM3504865 SRP172827 PRJNA508883 SRS4114670 SAMN10532390 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504865 GSM3504865 GEO Accession GSM3504865 SRX5105188 GSM3504866 SRP172827 PRJNA508883 SRS4114671 SAMN10532387 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504866 GSM3504866 GEO Accession GSM3504866 SRX5105189 GSM3504867 SRP172827 PRJNA508883 SRS4114672 SAMN10532386 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504867 GSM3504867 GEO Accession GSM3504867 SRX5105190 GSM3504868 SRP172827 PRJNA508883 SRS4114673 SAMN10532385 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504868 GSM3504868 GEO Accession GSM3504868 SRX5105191 GSM3504869 SRP172827 PRJNA508883 SRS4114674 SAMN10532384 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504869 GSM3504869 GEO Accession GSM3504869 SRX5105192 GSM3504870 SRP172827 PRJNA508883 SRS4114676 SAMN10532383 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504870 GSM3504870 GEO Accession GSM3504870 SRX5105193 GSM3504871 SRP172827 PRJNA508883 SRS4114675 SAMN10532382 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504871 GSM3504871 GEO Accession GSM3504871 SRX5105194 GSM3504872 SRP172827 PRJNA508883 SRS4114677 SAMN10532381 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504872 GSM3504872 GEO Accession GSM3504872 SRX5105195 GSM3504873 SRP172827 PRJNA508883 SRS4114678 SAMN10532380 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504873 GSM3504873 GEO Accession GSM3504873 SRX5105196 GSM3504874 SRP172827 PRJNA508883 SRS4114680 SAMN10532379 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504874 GSM3504874 GEO Accession GSM3504874 SRX5105197 GSM3504875 SRP172827 PRJNA508883 SRS4114679 SAMN10532423 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504875 GSM3504875 GEO Accession GSM3504875 SRX5105198 GSM3504876 SRP172827 PRJNA508883 SRS4114681 SAMN10532422 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504876 GSM3504876 GEO Accession GSM3504876 SRX5105199 GSM3504877 SRP172827 PRJNA508883 SRS4114682 SAMN10532421 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504877 GSM3504877 GEO Accession GSM3504877 SRX5105200 GSM3504878 SRP172827 PRJNA508883 SRS4114683 SAMN10532420 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504878 GSM3504878 GEO Accession GSM3504878 SRX5105201 GSM3504879 SRP172827 PRJNA508883 SRS4114684 SAMN10532419 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504879 GSM3504879 GEO Accession GSM3504879 SRX5105202 GSM3504880 SRP172827 PRJNA508883 SRS4114685 SAMN10532418 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504880 GSM3504880 GEO Accession GSM3504880 SRX5105203 GSM3504881 SRP172827 PRJNA508883 SRS4114686 SAMN10532417 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504881 GSM3504881 GEO Accession GSM3504881 SRX5105204 GSM3504882 SRP172827 PRJNA508883 SRS4114687 SAMN10532416 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504882 GSM3504882 GEO Accession GSM3504882 SRX5105205 GSM3504883 SRP172827 PRJNA508883 SRS4114688 SAMN10532415 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504883 GSM3504883 GEO Accession GSM3504883 SRX5105206 GSM3504884 SRP172827 PRJNA508883 SRS4114689 SAMN10532414 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504884 GSM3504884 GEO Accession GSM3504884 SRX5105207 GSM3504885 SRP172827 PRJNA508883 SRS4114690 SAMN10532338 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504885 GSM3504885 GEO Accession GSM3504885 SRX5105208 GSM3504886 SRP172827 PRJNA508883 SRS4114691 SAMN10532337 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504886 GSM3504886 GEO Accession GSM3504886 SRX5105209 GSM3504887 SRP172827 PRJNA508883 SRS4114692 SAMN10532336 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504887 GSM3504887 GEO Accession GSM3504887 SRX5105210 GSM3504888 SRP172827 PRJNA508883 SRS4114693 SAMN10532335 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504888 GSM3504888 GEO Accession GSM3504888 SRX5105211 GSM3504889 SRP172827 PRJNA508883 SRS4114694 SAMN10532334 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504889 GSM3504889 GEO Accession GSM3504889 SRX5105212 GSM3504890 SRP172827 PRJNA508883 SRS4114695 SAMN10532333 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504890 GSM3504890 GEO Accession GSM3504890 SRX5105213 GSM3504891 SRP172827 PRJNA508883 SRS4114696 SAMN10532332 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504891 GSM3504891 GEO Accession GSM3504891 SRX5105214 GSM3504892 SRP172827 PRJNA508883 SRS4114697 SAMN10532331 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504892 GSM3504892 GEO Accession GSM3504892 SRX5105215 GSM3504893 SRP172827 PRJNA508883 SRS4114698 SAMN10532330 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504893 GSM3504893 GEO Accession GSM3504893 SRX5105216 GSM3504894 SRP172827 PRJNA508883 SRS4114699 SAMN10532329 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504894 GSM3504894 GEO Accession GSM3504894 SRX5105217 GSM3504895 SRP172827 PRJNA508883 SRS4114700 SAMN10532328 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504895 GSM3504895 GEO Accession GSM3504895 SRX5105218 GSM3504896 SRP172827 PRJNA508883 SRS4114701 SAMN10532377 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504896 GSM3504896 GEO Accession GSM3504896 SRX5105219 GSM3504897 SRP172827 PRJNA508883 SRS4114702 SAMN10532376 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504897 GSM3504897 GEO Accession GSM3504897 SRX5105220 GSM3504898 SRP172827 PRJNA508883 SRS4114703 SAMN10532375 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504898 GSM3504898 GEO Accession GSM3504898 SRX5105221 GSM3504899 SRP172827 PRJNA508883 SRS4114704 SAMN10532374 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504899 GSM3504899 GEO Accession GSM3504899 SRX5105222 GSM3504900 SRP172827 PRJNA508883 SRS4114705 SAMN10532373 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504900 GSM3504900 GEO Accession GSM3504900 SRX5105223 GSM3504901 SRP172827 PRJNA508883 SRS4114706 SAMN10532372 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504901 GSM3504901 GEO Accession GSM3504901 SRX5105224 GSM3504902 SRP172827 PRJNA508883 SRS4114707 SAMN10532371 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504902 GSM3504902 GEO Accession GSM3504902 SRX5105225 GSM3504903 SRP172827 PRJNA508883 SRS4114708 SAMN10532370 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504903 GSM3504903 GEO Accession GSM3504903 SRX5105226 GSM3504904 SRP172827 PRJNA508883 SRS4114709 SAMN10532369 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504904 GSM3504904 GEO Accession GSM3504904 SRX5105227 GSM3504905 SRP172827 PRJNA508883 SRS4114710 SAMN10532368 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504905 GSM3504905 GEO Accession GSM3504905 SRX5105228 GSM3504906 SRP172827 PRJNA508883 SRS4114711 SAMN10532367 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504906 GSM3504906 GEO Accession GSM3504906 SRX5105229 GSM3504907 SRP172827 PRJNA508883 SRS4114712 SAMN10532366 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504907 GSM3504907 GEO Accession GSM3504907 SRX5105230 GSM3504908 SRP172827 PRJNA508883 SRS4114713 SAMN10532365 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504908 GSM3504908 GEO Accession GSM3504908 SRX5105231 GSM3504909 SRP172827 PRJNA508883 SRS4114714 SAMN10532364 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504909 GSM3504909 GEO Accession GSM3504909 SRX5105232 GSM3504910 SRP172827 PRJNA508883 SRS4114715 SAMN10532363 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504910 GSM3504910 GEO Accession GSM3504910 SRX5105233 GSM3504911 SRP172827 PRJNA508883 SRS4114716 SAMN10532362 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504911 GSM3504911 GEO Accession GSM3504911 SRX5105234 GSM3504912 SRP172827 PRJNA508883 SRS4114717 SAMN10532361 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504912 GSM3504912 GEO Accession GSM3504912 SRX5105235 GSM3504913 SRP172827 PRJNA508883 SRS4114718 SAMN10532360 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504913 GSM3504913 GEO Accession GSM3504913 SRX5105236 GSM3504914 SRP172827 PRJNA508883 SRS4114719 SAMN10532353 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504914 GSM3504914 GEO Accession GSM3504914 SRX5105237 GSM3504915 SRP172827 PRJNA508883 SRS4114720 SAMN10532352 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504915 GSM3504915 GEO Accession GSM3504915 SRX5105238 GSM3504916 SRP172827 PRJNA508883 SRS4114721 SAMN10532351 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504916 GSM3504916 GEO Accession GSM3504916 SRX5105239 GSM3504917 SRP172827 PRJNA508883 SRS4114722 SAMN10532350 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504917 GSM3504917 GEO Accession GSM3504917 SRX5105240 GSM3504918 SRP172827 PRJNA508883 SRS4114723 SAMN10532349 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504918 GSM3504918 GEO Accession GSM3504918 SRX5105241 GSM3504919 SRP172827 PRJNA508883 SRS4114724 SAMN10532348 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504919 GSM3504919 GEO Accession GSM3504919 SRX5105242 GSM3504920 SRP172827 PRJNA508883 SRS4114725 SAMN10532347 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504920 GSM3504920 GEO Accession GSM3504920 SRX5105243 GSM3504921 SRP172827 PRJNA508883 SRS4114726 SAMN10532346 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504921 GSM3504921 GEO Accession GSM3504921 SRX5105244 GSM3504922 SRP172827 PRJNA508883 SRS4114727 SAMN10532345 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504922 GSM3504922 GEO Accession GSM3504922 SRX5105245 GSM3504923 SRP172827 PRJNA508883 SRS4114728 SAMN10532344 RNA-Seq TRANSCRIPTOMIC cDNA RNA was extracted from 25 OD of yeast corresponding to each sample by modification of a previously described method. Briefly, to each sample, 0.5 g of 0.5 mm acid washed beads (Sigma-Aldrich), 0.5 mL of RNA ISO buffer (500 mM NaCl, 200 mM Tris-Cl pH 7.5, 10 mM EDTA, 1 % SDS) and 0.5 mL of phenol-chloroform-isoamyl alcohol pH 6.7 (PCA, Fisher Scientific) was added. Samples were lysed with 10 cycles that each consisted of vortexing for 20 seconds and incubation on ice for 30 seconds. 1.5 volumes (relative to starting amount of ISO Buffer) of RNA ISO Buffer and of PCA were added, and samples were centrifuged at 4°C to separate phases. The aqueous layer was transferred to a pre-spun phase-lock gel (heavy) tube (5PRIME/Quantabio); an equal volume of PCA was added and mixed prior to centrifugation at room temperature to separate phases. The aqueous layer was transferred to 2 new tubes for ethanol precipitation with 2 volumes of 100% ethanol followed incubation at -80°C for 1 hour to overnight. Precipitated RNA was pelleted by centrifugation at 4°C. Each pellet was dissolved in 25 μL nuclease-free water and combined into 1 tube per sample. Co-purifying DNA was digested with 20 U of Turbo DNase (Invitrogen) at 37°C for 4 hours, and RNA was cleaned up with the GeneJET RNA Purification Kit (Thermo Scientific), and eluted with 50 μL of DEPC-treated water. Total RNA (100 ng) was ligated with 20 pmol of a 5ʹ adenylated primer containing a 7-nucleotide random DNA sequence (random heptamer), Illumina TruSeq adapter sequence and a 3ʹ dideoxycytidine (5ʹ-A(pp) NNNNNNN TGGAATTCTCGGGTGCCAAGG ddC-3ʹ) using 200 U of T4 RNA ligase 2, truncated KQ (New England BioLabs) in a 20μL reaction with 16°C overnight incubation. This ligation added the random heptamer and Illumina TruSeq adapter sequence to the 3ʹ end of the RNAs in the sample. Half of the ligation reaction (10 μL) was reverse transcribed using 5 pmol of Illumina RNA RT primer (5ʹ-GCCTTGGCACCCGAGAATTCCA-3ʹ) and ImProm-II Reverse Transcriptase (Promega Corporation) with 1.5 mM MgCl2 and 0.5 mM dNTPs, according to manufacturer's instructions. Samples were then PCR-amplified with a forward primer consisting of Illumina-specific sequences and sequence (underlined), specific to the tRNA reporter (5ʹ-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCGAGGATCACCCATGTCGCAG-3ʹ) and a reverse Illumina RNA PCR Primer with various indices used for multiplexing, using GoTaq Green PCR Master Mix (Promega Corporation). PCR products were run on an 8% polyacrylamide 8M urea gel and gel extracted. Resulting samples for each sequencing run were combined in equimolar amounts and run on an Illumina HiSeq2000 or HiSeq2500 (2x50 bp or 2x100 bp), to produce approximately 1 x 106 reads per sample. Illumina HiSeq 2000 gds 303504923 GSM3504923 GEO Accession GSM3504923