<?xml version="1.0" encoding="UTF-8"?>
<EXPERIMENT_SET xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance">
  <EXPERIMENT alias="GSM3759946" accession="SRX5818716">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX5818716</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM3759946</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM3759946: Bic H3K27ac ChIP IP; Mus musculus; ChIP-Seq</TITLE>
    <STUDY_REF accession="SRP197612" refname="GSE131025">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS4747468">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS4747468</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM3759946</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>ChIP-Seq</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>GENOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>ChIP</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <SINGLE/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>RNA-seq: At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. RNA-seq:We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library. ChIP-seq: At DIV16, neuronal cultures were fixed in 1% formaldehyde for 10 minutes (room temp) via the addition (1:10 vol/vol) of the following fixation solution: 50 mM Hepes-KOH (pH 7.5), 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 11% Formaldehyde. Fixation was quenched via the addition of 2.5 M glycine (1:20 vol/vol) and scraped into pellets of 8 million cells. Each pellet was washed once with cold PBS, flash frozen, and stored at -80oC. Immunoprecipitation was performed as described previously (Beagan et al., 2016) with slight modifications. Briefly, IP reactions were prepared a day prior to cell lysis by combining 20 uL of protein A and protein G conjugated agarose beads (Invitrogen# 15918-014 and 15920-010, respectively) with 10 uL of anti-H3K27ac antibody (Abcam# ab4729) in 1 mL of cold PBS and rotated overnight. The next day cell pellets were resuspended in 1 mL lysis buffer (10 mM Tris pH 8.0, 10 mM NaCl, 0.2% NP-40/Igepal, Protease Inhibitor, PMSF) and incubated on ice for 10 min. Cells were further lysed with 30 strokes of a dounce homogenizer (pestle A) and then nuclei were pelleted. Nuclei were lysed on ice in 50 mM Tris pH 8.0, 10 mM EDTA, 1% SDS, Protease Inhibitor, PMSF for 20 min. SDS concentration was reduced before sonication by the addition of 300 uL IP Dilution Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 150 mM NaCl, 1% Triston X-100, 0.01% SDS, Protease Inhibitor, PMSF), after which samples were sonicated for 60 minutes (30 seconds on, 30 seconds off cycle, 100% amplitude) using a Qsonica Q800R2 Sonicator. Insoluble fractions were removed via spin, and the supernatant was removed of non-specific binding chromatin via rotation with preclearing solution (3.7 mL IP Dilution Buffer, 0.5 mL Nuclear Lysis Buffer, 175 uL of Agarose Protein A/G beads, and 50 ug Rabbit IgG) for 2 hours at 4°C. Beads were pelleted and 4.7 mL of supernatant was removed. 200 uL of supernatant was retained as input control (stored at -20°C) while the remaining 4.5 mL was transferred to the beads that had been pre-bound with the H3K27ac antibody overnight; the IP reaction then rotated overnight again at 4°C. Bound bead complexes were washed once with 1 mL IP Wash Buffer 1 (20 mM Tris pH 8.0, 2 mM EDTA, 50 mM NaCl, 1% Triton X-100, 0.1% SDS), twice with 1 mL High-Salt Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 500 mM NaCl, 1% Triton X-100, 0.01% SDS), once with IP Wash Buffer 2 (10 mM Tris pH 8.0, 1 mM EDTA, 0.25 M LiCl, 1% NP-40/Igepal, 1% Na-deoxycholate), and finally twice with 1x TE. Complexes were eluted by twice resuspending bound beads in 110 uL Elution Buffer (100 mM NaHCO3, 1% SDS), pelleting the beads after each elution and transferring 100 uL supernatant to a new tube. Finally, 12 uL of 5M NaCl and 20 ug RNase A were added to both 200 uL IP and input samples and incubated at 65 degrees for 1 hour, followed by the addition of 60 ug of Proteinase K and overnight incubation at 65 degrees. DNA was isolated via phenol-chloroform extraction and ethanol precipitation and concentration was quantified using Qubit fluorometer. ChIP-seq libraries were prepared for sequencing using the NEBNext Ultra II DNA Library Prep Kit (NEB# E7645S), following manufacturer's protocol with the following user-chosen specifications. 3 ng DNA from all IP and input samples was used as starting material. NEBNext Adaptors were diluted 15x in 10 mM Tris-HCL, pH 8.0 with 10 mM NaCl prior to adaptor ligation. Large DNA fragments were removed via a size selection by adding 15 uL of AMPure XP beads at the first bead addition step and 87 uL of beads at the second bead addition step. Size-selected DNA was amplified using 9 cycles of PCR enrichment. The size-range of the final libraries was confirmed to be between 200-1000 bp using an Agilent Bioanalyzer High Sensitivity DNA test. H3K27ac enrichment was confirmed prior to sequencing by querying the IP/input qPCR enrichment of primer pairs designed to the Arc, Synaptotagmin-1, and Tcf25 promoter regions. Library concentrations were calculated and normalized using the KAPA Illumina Library Quantification Kit (#KK4835) so that libraries could be equally pooled before sequencing 75 bp single-end reads on the NextSeq500. All IP libraries were sequenced to a depth greater than 48 million reads and all input libraries were sequenced to greater than 67 million reads. 5C-seq: Neuronal cultures were formaldehyde fixed as described for ChIP-seq and stored at -80oC. For each condition (Bic, Untreat, TTX), in situ 3C was performed on 4 replicates (divided evenly across two animal/culture batches) of 4-5 million cells. Briefly, cells were thawed on ice and resuspended (gently) in 250 uL of lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630) with 50 uL protease inhibitors (Sigma P8340). Cell suspension was incubated on ice for 15 minutes and pelleted. Pelleted nuclei were washed once in lysis buffer (resuspension and spin), then resuspended and incubated in 50 uL of 0.5% SDS at 62oC for 10 min. SDS was inactivated via the addition of 145 uL H2O, 25 uL 10% Triton X-100, and incubation at 37oC for 15 min. Subsequently, chromatin was digested overnight at 37oC with the addition of 25 uL 10X NEBuffer2 and 100U (5 uL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62oC to inactivate the HindIII. Chromatin was re-ligated via the addition of 100 uL 10% Triton X-100, 120 uL NEB T4 DNA Ligation buffer (NEB B0202S), 12 uL 10 mg/mL BSA, 718 uL H2O, and 2000 U (5 uL) of T4 DNA Ligase (NEB M0202S) and incubation at 16oC for 2 hours (NOTE: This is a deviation from in situ HiC (Rao et al. 2010) in order to promote sticky-end ligation over blunt-end). Following ligation nuclei were pelleted, resuspended in 300 uL of 10 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 1% SDS, plus 25 uL of 20 mg/mL proteinase K (NEB P8107), and incubated at 65oC for 4 hours at which point an additional 25 uL of proteinase K was added and incubated overnight. 3C templates were isolated next day via RNaseA treatment, phenol-chloroform extraction, ethanol precipitation, and Amicon filtration (Millipore MFC5030BKS) (for more details see Beagan et al. 2016). Template size distribution and quantity were assessed with a 0.8% agarose gel. 5C primers were designed according to the double-alternating design scheme using the My5C primer design software (http://my5c.umassmed.edu/my5Cprimers/5C.php)10 with universal “Emulsion” primer tails. Regions were designed to capture TAD structures immediately surrounding the genes of interest (Bdnf, Fos, Arc, Neurexin-1, Neuroligin-3, Synaptotagmin-1) in published mouse cortex HiC data. 5C reactions were carried out as previously described. 600 ng (~200,000 genome copies) of 3C template for each replicate was mixed with 1 fmole of each</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>303759946</ID>
          <LABEL>GSM3759946</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM3759947" accession="SRX5818717">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX5818717</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM3759947</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM3759947: Bic H3K27ac ChIP Input; Mus musculus; ChIP-Seq</TITLE>
    <STUDY_REF accession="SRP197612" refname="GSE131025">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS4747469">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS4747469</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM3759947</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>ChIP-Seq</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>GENOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>ChIP</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <SINGLE/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>RNA-seq: At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. RNA-seq:We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library. ChIP-seq: At DIV16, neuronal cultures were fixed in 1% formaldehyde for 10 minutes (room temp) via the addition (1:10 vol/vol) of the following fixation solution: 50 mM Hepes-KOH (pH 7.5), 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 11% Formaldehyde. Fixation was quenched via the addition of 2.5 M glycine (1:20 vol/vol) and scraped into pellets of 8 million cells. Each pellet was washed once with cold PBS, flash frozen, and stored at -80oC. Immunoprecipitation was performed as described previously (Beagan et al., 2016) with slight modifications. Briefly, IP reactions were prepared a day prior to cell lysis by combining 20 uL of protein A and protein G conjugated agarose beads (Invitrogen# 15918-014 and 15920-010, respectively) with 10 uL of anti-H3K27ac antibody (Abcam# ab4729) in 1 mL of cold PBS and rotated overnight. The next day cell pellets were resuspended in 1 mL lysis buffer (10 mM Tris pH 8.0, 10 mM NaCl, 0.2% NP-40/Igepal, Protease Inhibitor, PMSF) and incubated on ice for 10 min. Cells were further lysed with 30 strokes of a dounce homogenizer (pestle A) and then nuclei were pelleted. Nuclei were lysed on ice in 50 mM Tris pH 8.0, 10 mM EDTA, 1% SDS, Protease Inhibitor, PMSF for 20 min. SDS concentration was reduced before sonication by the addition of 300 uL IP Dilution Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 150 mM NaCl, 1% Triston X-100, 0.01% SDS, Protease Inhibitor, PMSF), after which samples were sonicated for 60 minutes (30 seconds on, 30 seconds off cycle, 100% amplitude) using a Qsonica Q800R2 Sonicator. Insoluble fractions were removed via spin, and the supernatant was removed of non-specific binding chromatin via rotation with preclearing solution (3.7 mL IP Dilution Buffer, 0.5 mL Nuclear Lysis Buffer, 175 uL of Agarose Protein A/G beads, and 50 ug Rabbit IgG) for 2 hours at 4°C. Beads were pelleted and 4.7 mL of supernatant was removed. 200 uL of supernatant was retained as input control (stored at -20°C) while the remaining 4.5 mL was transferred to the beads that had been pre-bound with the H3K27ac antibody overnight; the IP reaction then rotated overnight again at 4°C. Bound bead complexes were washed once with 1 mL IP Wash Buffer 1 (20 mM Tris pH 8.0, 2 mM EDTA, 50 mM NaCl, 1% Triton X-100, 0.1% SDS), twice with 1 mL High-Salt Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 500 mM NaCl, 1% Triton X-100, 0.01% SDS), once with IP Wash Buffer 2 (10 mM Tris pH 8.0, 1 mM EDTA, 0.25 M LiCl, 1% NP-40/Igepal, 1% Na-deoxycholate), and finally twice with 1x TE. Complexes were eluted by twice resuspending bound beads in 110 uL Elution Buffer (100 mM NaHCO3, 1% SDS), pelleting the beads after each elution and transferring 100 uL supernatant to a new tube. Finally, 12 uL of 5M NaCl and 20 ug RNase A were added to both 200 uL IP and input samples and incubated at 65 degrees for 1 hour, followed by the addition of 60 ug of Proteinase K and overnight incubation at 65 degrees. DNA was isolated via phenol-chloroform extraction and ethanol precipitation and concentration was quantified using Qubit fluorometer. ChIP-seq libraries were prepared for sequencing using the NEBNext Ultra II DNA Library Prep Kit (NEB# E7645S), following manufacturer's protocol with the following user-chosen specifications. 3 ng DNA from all IP and input samples was used as starting material. NEBNext Adaptors were diluted 15x in 10 mM Tris-HCL, pH 8.0 with 10 mM NaCl prior to adaptor ligation. Large DNA fragments were removed via a size selection by adding 15 uL of AMPure XP beads at the first bead addition step and 87 uL of beads at the second bead addition step. Size-selected DNA was amplified using 9 cycles of PCR enrichment. The size-range of the final libraries was confirmed to be between 200-1000 bp using an Agilent Bioanalyzer High Sensitivity DNA test. H3K27ac enrichment was confirmed prior to sequencing by querying the IP/input qPCR enrichment of primer pairs designed to the Arc, Synaptotagmin-1, and Tcf25 promoter regions. Library concentrations were calculated and normalized using the KAPA Illumina Library Quantification Kit (#KK4835) so that libraries could be equally pooled before sequencing 75 bp single-end reads on the NextSeq500. All IP libraries were sequenced to a depth greater than 48 million reads and all input libraries were sequenced to greater than 67 million reads. 5C-seq: Neuronal cultures were formaldehyde fixed as described for ChIP-seq and stored at -80oC. For each condition (Bic, Untreat, TTX), in situ 3C was performed on 4 replicates (divided evenly across two animal/culture batches) of 4-5 million cells. Briefly, cells were thawed on ice and resuspended (gently) in 250 uL of lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630) with 50 uL protease inhibitors (Sigma P8340). Cell suspension was incubated on ice for 15 minutes and pelleted. Pelleted nuclei were washed once in lysis buffer (resuspension and spin), then resuspended and incubated in 50 uL of 0.5% SDS at 62oC for 10 min. SDS was inactivated via the addition of 145 uL H2O, 25 uL 10% Triton X-100, and incubation at 37oC for 15 min. Subsequently, chromatin was digested overnight at 37oC with the addition of 25 uL 10X NEBuffer2 and 100U (5 uL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62oC to inactivate the HindIII. Chromatin was re-ligated via the addition of 100 uL 10% Triton X-100, 120 uL NEB T4 DNA Ligation buffer (NEB B0202S), 12 uL 10 mg/mL BSA, 718 uL H2O, and 2000 U (5 uL) of T4 DNA Ligase (NEB M0202S) and incubation at 16oC for 2 hours (NOTE: This is a deviation from in situ HiC (Rao et al. 2010) in order to promote sticky-end ligation over blunt-end). Following ligation nuclei were pelleted, resuspended in 300 uL of 10 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 1% SDS, plus 25 uL of 20 mg/mL proteinase K (NEB P8107), and incubated at 65oC for 4 hours at which point an additional 25 uL of proteinase K was added and incubated overnight. 3C templates were isolated next day via RNaseA treatment, phenol-chloroform extraction, ethanol precipitation, and Amicon filtration (Millipore MFC5030BKS) (for more details see Beagan et al. 2016). Template size distribution and quantity were assessed with a 0.8% agarose gel. 5C primers were designed according to the double-alternating design scheme using the My5C primer design software (http://my5c.umassmed.edu/my5Cprimers/5C.php)10 with universal “Emulsion” primer tails. Regions were designed to capture TAD structures immediately surrounding the genes of interest (Bdnf, Fos, Arc, Neurexin-1, Neuroligin-3, Synaptotagmin-1) in published mouse cortex HiC data. 5C reactions were carried out as previously described. 600 ng (~200,000 genome copies) of 3C template for each replicate was mixed with 1 fmole of each</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>303759947</ID>
          <LABEL>GSM3759947</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM3759948" accession="SRX5818718">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX5818718</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM3759948</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM3759948: Untreat H3K27ac ChIP IP; Mus musculus; ChIP-Seq</TITLE>
    <STUDY_REF accession="SRP197612" refname="GSE131025">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS4747470">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS4747470</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM3759948</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>ChIP-Seq</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>GENOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>ChIP</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <SINGLE/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>RNA-seq: At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. RNA-seq:We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library. ChIP-seq: At DIV16, neuronal cultures were fixed in 1% formaldehyde for 10 minutes (room temp) via the addition (1:10 vol/vol) of the following fixation solution: 50 mM Hepes-KOH (pH 7.5), 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 11% Formaldehyde. Fixation was quenched via the addition of 2.5 M glycine (1:20 vol/vol) and scraped into pellets of 8 million cells. Each pellet was washed once with cold PBS, flash frozen, and stored at -80oC. Immunoprecipitation was performed as described previously (Beagan et al., 2016) with slight modifications. Briefly, IP reactions were prepared a day prior to cell lysis by combining 20 uL of protein A and protein G conjugated agarose beads (Invitrogen# 15918-014 and 15920-010, respectively) with 10 uL of anti-H3K27ac antibody (Abcam# ab4729) in 1 mL of cold PBS and rotated overnight. The next day cell pellets were resuspended in 1 mL lysis buffer (10 mM Tris pH 8.0, 10 mM NaCl, 0.2% NP-40/Igepal, Protease Inhibitor, PMSF) and incubated on ice for 10 min. Cells were further lysed with 30 strokes of a dounce homogenizer (pestle A) and then nuclei were pelleted. Nuclei were lysed on ice in 50 mM Tris pH 8.0, 10 mM EDTA, 1% SDS, Protease Inhibitor, PMSF for 20 min. SDS concentration was reduced before sonication by the addition of 300 uL IP Dilution Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 150 mM NaCl, 1% Triston X-100, 0.01% SDS, Protease Inhibitor, PMSF), after which samples were sonicated for 60 minutes (30 seconds on, 30 seconds off cycle, 100% amplitude) using a Qsonica Q800R2 Sonicator. Insoluble fractions were removed via spin, and the supernatant was removed of non-specific binding chromatin via rotation with preclearing solution (3.7 mL IP Dilution Buffer, 0.5 mL Nuclear Lysis Buffer, 175 uL of Agarose Protein A/G beads, and 50 ug Rabbit IgG) for 2 hours at 4°C. Beads were pelleted and 4.7 mL of supernatant was removed. 200 uL of supernatant was retained as input control (stored at -20°C) while the remaining 4.5 mL was transferred to the beads that had been pre-bound with the H3K27ac antibody overnight; the IP reaction then rotated overnight again at 4°C. Bound bead complexes were washed once with 1 mL IP Wash Buffer 1 (20 mM Tris pH 8.0, 2 mM EDTA, 50 mM NaCl, 1% Triton X-100, 0.1% SDS), twice with 1 mL High-Salt Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 500 mM NaCl, 1% Triton X-100, 0.01% SDS), once with IP Wash Buffer 2 (10 mM Tris pH 8.0, 1 mM EDTA, 0.25 M LiCl, 1% NP-40/Igepal, 1% Na-deoxycholate), and finally twice with 1x TE. Complexes were eluted by twice resuspending bound beads in 110 uL Elution Buffer (100 mM NaHCO3, 1% SDS), pelleting the beads after each elution and transferring 100 uL supernatant to a new tube. Finally, 12 uL of 5M NaCl and 20 ug RNase A were added to both 200 uL IP and input samples and incubated at 65 degrees for 1 hour, followed by the addition of 60 ug of Proteinase K and overnight incubation at 65 degrees. DNA was isolated via phenol-chloroform extraction and ethanol precipitation and concentration was quantified using Qubit fluorometer. ChIP-seq libraries were prepared for sequencing using the NEBNext Ultra II DNA Library Prep Kit (NEB# E7645S), following manufacturer's protocol with the following user-chosen specifications. 3 ng DNA from all IP and input samples was used as starting material. NEBNext Adaptors were diluted 15x in 10 mM Tris-HCL, pH 8.0 with 10 mM NaCl prior to adaptor ligation. Large DNA fragments were removed via a size selection by adding 15 uL of AMPure XP beads at the first bead addition step and 87 uL of beads at the second bead addition step. Size-selected DNA was amplified using 9 cycles of PCR enrichment. The size-range of the final libraries was confirmed to be between 200-1000 bp using an Agilent Bioanalyzer High Sensitivity DNA test. H3K27ac enrichment was confirmed prior to sequencing by querying the IP/input qPCR enrichment of primer pairs designed to the Arc, Synaptotagmin-1, and Tcf25 promoter regions. Library concentrations were calculated and normalized using the KAPA Illumina Library Quantification Kit (#KK4835) so that libraries could be equally pooled before sequencing 75 bp single-end reads on the NextSeq500. All IP libraries were sequenced to a depth greater than 48 million reads and all input libraries were sequenced to greater than 67 million reads. 5C-seq: Neuronal cultures were formaldehyde fixed as described for ChIP-seq and stored at -80oC. For each condition (Bic, Untreat, TTX), in situ 3C was performed on 4 replicates (divided evenly across two animal/culture batches) of 4-5 million cells. Briefly, cells were thawed on ice and resuspended (gently) in 250 uL of lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630) with 50 uL protease inhibitors (Sigma P8340). Cell suspension was incubated on ice for 15 minutes and pelleted. Pelleted nuclei were washed once in lysis buffer (resuspension and spin), then resuspended and incubated in 50 uL of 0.5% SDS at 62oC for 10 min. SDS was inactivated via the addition of 145 uL H2O, 25 uL 10% Triton X-100, and incubation at 37oC for 15 min. Subsequently, chromatin was digested overnight at 37oC with the addition of 25 uL 10X NEBuffer2 and 100U (5 uL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62oC to inactivate the HindIII. Chromatin was re-ligated via the addition of 100 uL 10% Triton X-100, 120 uL NEB T4 DNA Ligation buffer (NEB B0202S), 12 uL 10 mg/mL BSA, 718 uL H2O, and 2000 U (5 uL) of T4 DNA Ligase (NEB M0202S) and incubation at 16oC for 2 hours (NOTE: This is a deviation from in situ HiC (Rao et al. 2010) in order to promote sticky-end ligation over blunt-end). Following ligation nuclei were pelleted, resuspended in 300 uL of 10 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 1% SDS, plus 25 uL of 20 mg/mL proteinase K (NEB P8107), and incubated at 65oC for 4 hours at which point an additional 25 uL of proteinase K was added and incubated overnight. 3C templates were isolated next day via RNaseA treatment, phenol-chloroform extraction, ethanol precipitation, and Amicon filtration (Millipore MFC5030BKS) (for more details see Beagan et al. 2016). Template size distribution and quantity were assessed with a 0.8% agarose gel. 5C primers were designed according to the double-alternating design scheme using the My5C primer design software (http://my5c.umassmed.edu/my5Cprimers/5C.php)10 with universal “Emulsion” primer tails. Regions were designed to capture TAD structures immediately surrounding the genes of interest (Bdnf, Fos, Arc, Neurexin-1, Neuroligin-3, Synaptotagmin-1) in published mouse cortex HiC data. 5C reactions were carried out as previously described. 600 ng (~200,000 genome copies) of 3C template for each replicate was mixed with 1 fmole of each</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>303759948</ID>
          <LABEL>GSM3759948</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM3759949" accession="SRX5818719">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX5818719</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM3759949</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM3759949: Untreat H3K27ac ChIP Input; Mus musculus; ChIP-Seq</TITLE>
    <STUDY_REF accession="SRP197612" refname="GSE131025">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS4747471">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS4747471</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM3759949</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>ChIP-Seq</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>GENOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>ChIP</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <SINGLE/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>RNA-seq: At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. RNA-seq:We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library. ChIP-seq: At DIV16, neuronal cultures were fixed in 1% formaldehyde for 10 minutes (room temp) via the addition (1:10 vol/vol) of the following fixation solution: 50 mM Hepes-KOH (pH 7.5), 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 11% Formaldehyde. Fixation was quenched via the addition of 2.5 M glycine (1:20 vol/vol) and scraped into pellets of 8 million cells. Each pellet was washed once with cold PBS, flash frozen, and stored at -80oC. Immunoprecipitation was performed as described previously (Beagan et al., 2016) with slight modifications. Briefly, IP reactions were prepared a day prior to cell lysis by combining 20 uL of protein A and protein G conjugated agarose beads (Invitrogen# 15918-014 and 15920-010, respectively) with 10 uL of anti-H3K27ac antibody (Abcam# ab4729) in 1 mL of cold PBS and rotated overnight. The next day cell pellets were resuspended in 1 mL lysis buffer (10 mM Tris pH 8.0, 10 mM NaCl, 0.2% NP-40/Igepal, Protease Inhibitor, PMSF) and incubated on ice for 10 min. Cells were further lysed with 30 strokes of a dounce homogenizer (pestle A) and then nuclei were pelleted. Nuclei were lysed on ice in 50 mM Tris pH 8.0, 10 mM EDTA, 1% SDS, Protease Inhibitor, PMSF for 20 min. SDS concentration was reduced before sonication by the addition of 300 uL IP Dilution Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 150 mM NaCl, 1% Triston X-100, 0.01% SDS, Protease Inhibitor, PMSF), after which samples were sonicated for 60 minutes (30 seconds on, 30 seconds off cycle, 100% amplitude) using a Qsonica Q800R2 Sonicator. Insoluble fractions were removed via spin, and the supernatant was removed of non-specific binding chromatin via rotation with preclearing solution (3.7 mL IP Dilution Buffer, 0.5 mL Nuclear Lysis Buffer, 175 uL of Agarose Protein A/G beads, and 50 ug Rabbit IgG) for 2 hours at 4°C. Beads were pelleted and 4.7 mL of supernatant was removed. 200 uL of supernatant was retained as input control (stored at -20°C) while the remaining 4.5 mL was transferred to the beads that had been pre-bound with the H3K27ac antibody overnight; the IP reaction then rotated overnight again at 4°C. Bound bead complexes were washed once with 1 mL IP Wash Buffer 1 (20 mM Tris pH 8.0, 2 mM EDTA, 50 mM NaCl, 1% Triton X-100, 0.1% SDS), twice with 1 mL High-Salt Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 500 mM NaCl, 1% Triton X-100, 0.01% SDS), once with IP Wash Buffer 2 (10 mM Tris pH 8.0, 1 mM EDTA, 0.25 M LiCl, 1% NP-40/Igepal, 1% Na-deoxycholate), and finally twice with 1x TE. Complexes were eluted by twice resuspending bound beads in 110 uL Elution Buffer (100 mM NaHCO3, 1% SDS), pelleting the beads after each elution and transferring 100 uL supernatant to a new tube. Finally, 12 uL of 5M NaCl and 20 ug RNase A were added to both 200 uL IP and input samples and incubated at 65 degrees for 1 hour, followed by the addition of 60 ug of Proteinase K and overnight incubation at 65 degrees. DNA was isolated via phenol-chloroform extraction and ethanol precipitation and concentration was quantified using Qubit fluorometer. ChIP-seq libraries were prepared for sequencing using the NEBNext Ultra II DNA Library Prep Kit (NEB# E7645S), following manufacturer's protocol with the following user-chosen specifications. 3 ng DNA from all IP and input samples was used as starting material. NEBNext Adaptors were diluted 15x in 10 mM Tris-HCL, pH 8.0 with 10 mM NaCl prior to adaptor ligation. Large DNA fragments were removed via a size selection by adding 15 uL of AMPure XP beads at the first bead addition step and 87 uL of beads at the second bead addition step. Size-selected DNA was amplified using 9 cycles of PCR enrichment. The size-range of the final libraries was confirmed to be between 200-1000 bp using an Agilent Bioanalyzer High Sensitivity DNA test. H3K27ac enrichment was confirmed prior to sequencing by querying the IP/input qPCR enrichment of primer pairs designed to the Arc, Synaptotagmin-1, and Tcf25 promoter regions. Library concentrations were calculated and normalized using the KAPA Illumina Library Quantification Kit (#KK4835) so that libraries could be equally pooled before sequencing 75 bp single-end reads on the NextSeq500. All IP libraries were sequenced to a depth greater than 48 million reads and all input libraries were sequenced to greater than 67 million reads. 5C-seq: Neuronal cultures were formaldehyde fixed as described for ChIP-seq and stored at -80oC. For each condition (Bic, Untreat, TTX), in situ 3C was performed on 4 replicates (divided evenly across two animal/culture batches) of 4-5 million cells. Briefly, cells were thawed on ice and resuspended (gently) in 250 uL of lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630) with 50 uL protease inhibitors (Sigma P8340). Cell suspension was incubated on ice for 15 minutes and pelleted. Pelleted nuclei were washed once in lysis buffer (resuspension and spin), then resuspended and incubated in 50 uL of 0.5% SDS at 62oC for 10 min. SDS was inactivated via the addition of 145 uL H2O, 25 uL 10% Triton X-100, and incubation at 37oC for 15 min. Subsequently, chromatin was digested overnight at 37oC with the addition of 25 uL 10X NEBuffer2 and 100U (5 uL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62oC to inactivate the HindIII. Chromatin was re-ligated via the addition of 100 uL 10% Triton X-100, 120 uL NEB T4 DNA Ligation buffer (NEB B0202S), 12 uL 10 mg/mL BSA, 718 uL H2O, and 2000 U (5 uL) of T4 DNA Ligase (NEB M0202S) and incubation at 16oC for 2 hours (NOTE: This is a deviation from in situ HiC (Rao et al. 2010) in order to promote sticky-end ligation over blunt-end). Following ligation nuclei were pelleted, resuspended in 300 uL of 10 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 1% SDS, plus 25 uL of 20 mg/mL proteinase K (NEB P8107), and incubated at 65oC for 4 hours at which point an additional 25 uL of proteinase K was added and incubated overnight. 3C templates were isolated next day via RNaseA treatment, phenol-chloroform extraction, ethanol precipitation, and Amicon filtration (Millipore MFC5030BKS) (for more details see Beagan et al. 2016). Template size distribution and quantity were assessed with a 0.8% agarose gel. 5C primers were designed according to the double-alternating design scheme using the My5C primer design software (http://my5c.umassmed.edu/my5Cprimers/5C.php)10 with universal “Emulsion” primer tails. Regions were designed to capture TAD structures immediately surrounding the genes of interest (Bdnf, Fos, Arc, Neurexin-1, Neuroligin-3, Synaptotagmin-1) in published mouse cortex HiC data. 5C reactions were carried out as previously described. 600 ng (~200,000 genome copies) of 3C template for each replicate was mixed with 1 fmole of each</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>303759949</ID>
          <LABEL>GSM3759949</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM3759950" accession="SRX5818720">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX5818720</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM3759950</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM3759950: TTX H3K27ac ChIP IP; Mus musculus; ChIP-Seq</TITLE>
    <STUDY_REF accession="SRP197612" refname="GSE131025">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS4747472">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS4747472</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM3759950</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>ChIP-Seq</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>GENOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>ChIP</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <SINGLE/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>RNA-seq: At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. RNA-seq:We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library. ChIP-seq: At DIV16, neuronal cultures were fixed in 1% formaldehyde for 10 minutes (room temp) via the addition (1:10 vol/vol) of the following fixation solution: 50 mM Hepes-KOH (pH 7.5), 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 11% Formaldehyde. Fixation was quenched via the addition of 2.5 M glycine (1:20 vol/vol) and scraped into pellets of 8 million cells. Each pellet was washed once with cold PBS, flash frozen, and stored at -80oC. Immunoprecipitation was performed as described previously (Beagan et al., 2016) with slight modifications. Briefly, IP reactions were prepared a day prior to cell lysis by combining 20 uL of protein A and protein G conjugated agarose beads (Invitrogen# 15918-014 and 15920-010, respectively) with 10 uL of anti-H3K27ac antibody (Abcam# ab4729) in 1 mL of cold PBS and rotated overnight. The next day cell pellets were resuspended in 1 mL lysis buffer (10 mM Tris pH 8.0, 10 mM NaCl, 0.2% NP-40/Igepal, Protease Inhibitor, PMSF) and incubated on ice for 10 min. Cells were further lysed with 30 strokes of a dounce homogenizer (pestle A) and then nuclei were pelleted. Nuclei were lysed on ice in 50 mM Tris pH 8.0, 10 mM EDTA, 1% SDS, Protease Inhibitor, PMSF for 20 min. SDS concentration was reduced before sonication by the addition of 300 uL IP Dilution Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 150 mM NaCl, 1% Triston X-100, 0.01% SDS, Protease Inhibitor, PMSF), after which samples were sonicated for 60 minutes (30 seconds on, 30 seconds off cycle, 100% amplitude) using a Qsonica Q800R2 Sonicator. Insoluble fractions were removed via spin, and the supernatant was removed of non-specific binding chromatin via rotation with preclearing solution (3.7 mL IP Dilution Buffer, 0.5 mL Nuclear Lysis Buffer, 175 uL of Agarose Protein A/G beads, and 50 ug Rabbit IgG) for 2 hours at 4°C. Beads were pelleted and 4.7 mL of supernatant was removed. 200 uL of supernatant was retained as input control (stored at -20°C) while the remaining 4.5 mL was transferred to the beads that had been pre-bound with the H3K27ac antibody overnight; the IP reaction then rotated overnight again at 4°C. Bound bead complexes were washed once with 1 mL IP Wash Buffer 1 (20 mM Tris pH 8.0, 2 mM EDTA, 50 mM NaCl, 1% Triton X-100, 0.1% SDS), twice with 1 mL High-Salt Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 500 mM NaCl, 1% Triton X-100, 0.01% SDS), once with IP Wash Buffer 2 (10 mM Tris pH 8.0, 1 mM EDTA, 0.25 M LiCl, 1% NP-40/Igepal, 1% Na-deoxycholate), and finally twice with 1x TE. Complexes were eluted by twice resuspending bound beads in 110 uL Elution Buffer (100 mM NaHCO3, 1% SDS), pelleting the beads after each elution and transferring 100 uL supernatant to a new tube. Finally, 12 uL of 5M NaCl and 20 ug RNase A were added to both 200 uL IP and input samples and incubated at 65 degrees for 1 hour, followed by the addition of 60 ug of Proteinase K and overnight incubation at 65 degrees. DNA was isolated via phenol-chloroform extraction and ethanol precipitation and concentration was quantified using Qubit fluorometer. ChIP-seq libraries were prepared for sequencing using the NEBNext Ultra II DNA Library Prep Kit (NEB# E7645S), following manufacturer's protocol with the following user-chosen specifications. 3 ng DNA from all IP and input samples was used as starting material. NEBNext Adaptors were diluted 15x in 10 mM Tris-HCL, pH 8.0 with 10 mM NaCl prior to adaptor ligation. Large DNA fragments were removed via a size selection by adding 15 uL of AMPure XP beads at the first bead addition step and 87 uL of beads at the second bead addition step. Size-selected DNA was amplified using 9 cycles of PCR enrichment. The size-range of the final libraries was confirmed to be between 200-1000 bp using an Agilent Bioanalyzer High Sensitivity DNA test. H3K27ac enrichment was confirmed prior to sequencing by querying the IP/input qPCR enrichment of primer pairs designed to the Arc, Synaptotagmin-1, and Tcf25 promoter regions. Library concentrations were calculated and normalized using the KAPA Illumina Library Quantification Kit (#KK4835) so that libraries could be equally pooled before sequencing 75 bp single-end reads on the NextSeq500. All IP libraries were sequenced to a depth greater than 48 million reads and all input libraries were sequenced to greater than 67 million reads. 5C-seq: Neuronal cultures were formaldehyde fixed as described for ChIP-seq and stored at -80oC. For each condition (Bic, Untreat, TTX), in situ 3C was performed on 4 replicates (divided evenly across two animal/culture batches) of 4-5 million cells. Briefly, cells were thawed on ice and resuspended (gently) in 250 uL of lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630) with 50 uL protease inhibitors (Sigma P8340). Cell suspension was incubated on ice for 15 minutes and pelleted. Pelleted nuclei were washed once in lysis buffer (resuspension and spin), then resuspended and incubated in 50 uL of 0.5% SDS at 62oC for 10 min. SDS was inactivated via the addition of 145 uL H2O, 25 uL 10% Triton X-100, and incubation at 37oC for 15 min. Subsequently, chromatin was digested overnight at 37oC with the addition of 25 uL 10X NEBuffer2 and 100U (5 uL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62oC to inactivate the HindIII. Chromatin was re-ligated via the addition of 100 uL 10% Triton X-100, 120 uL NEB T4 DNA Ligation buffer (NEB B0202S), 12 uL 10 mg/mL BSA, 718 uL H2O, and 2000 U (5 uL) of T4 DNA Ligase (NEB M0202S) and incubation at 16oC for 2 hours (NOTE: This is a deviation from in situ HiC (Rao et al. 2010) in order to promote sticky-end ligation over blunt-end). Following ligation nuclei were pelleted, resuspended in 300 uL of 10 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 1% SDS, plus 25 uL of 20 mg/mL proteinase K (NEB P8107), and incubated at 65oC for 4 hours at which point an additional 25 uL of proteinase K was added and incubated overnight. 3C templates were isolated next day via RNaseA treatment, phenol-chloroform extraction, ethanol precipitation, and Amicon filtration (Millipore MFC5030BKS) (for more details see Beagan et al. 2016). Template size distribution and quantity were assessed with a 0.8% agarose gel. 5C primers were designed according to the double-alternating design scheme using the My5C primer design software (http://my5c.umassmed.edu/my5Cprimers/5C.php)10 with universal “Emulsion” primer tails. Regions were designed to capture TAD structures immediately surrounding the genes of interest (Bdnf, Fos, Arc, Neurexin-1, Neuroligin-3, Synaptotagmin-1) in published mouse cortex HiC data. 5C reactions were carried out as previously described. 600 ng (~200,000 genome copies) of 3C template for each replicate was mixed with 1 fmole of each</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>303759950</ID>
          <LABEL>GSM3759950</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM3759951" accession="SRX5818721">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX5818721</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM3759951</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM3759951: TTX H3K27ac ChIP Input; Mus musculus; ChIP-Seq</TITLE>
    <STUDY_REF accession="SRP197612" refname="GSE131025">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS4747473">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS4747473</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM3759951</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>ChIP-Seq</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>GENOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>ChIP</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <SINGLE/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>RNA-seq: At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. RNA-seq:We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library. ChIP-seq: At DIV16, neuronal cultures were fixed in 1% formaldehyde for 10 minutes (room temp) via the addition (1:10 vol/vol) of the following fixation solution: 50 mM Hepes-KOH (pH 7.5), 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 11% Formaldehyde. Fixation was quenched via the addition of 2.5 M glycine (1:20 vol/vol) and scraped into pellets of 8 million cells. Each pellet was washed once with cold PBS, flash frozen, and stored at -80oC. Immunoprecipitation was performed as described previously (Beagan et al., 2016) with slight modifications. Briefly, IP reactions were prepared a day prior to cell lysis by combining 20 uL of protein A and protein G conjugated agarose beads (Invitrogen# 15918-014 and 15920-010, respectively) with 10 uL of anti-H3K27ac antibody (Abcam# ab4729) in 1 mL of cold PBS and rotated overnight. The next day cell pellets were resuspended in 1 mL lysis buffer (10 mM Tris pH 8.0, 10 mM NaCl, 0.2% NP-40/Igepal, Protease Inhibitor, PMSF) and incubated on ice for 10 min. Cells were further lysed with 30 strokes of a dounce homogenizer (pestle A) and then nuclei were pelleted. Nuclei were lysed on ice in 50 mM Tris pH 8.0, 10 mM EDTA, 1% SDS, Protease Inhibitor, PMSF for 20 min. SDS concentration was reduced before sonication by the addition of 300 uL IP Dilution Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 150 mM NaCl, 1% Triston X-100, 0.01% SDS, Protease Inhibitor, PMSF), after which samples were sonicated for 60 minutes (30 seconds on, 30 seconds off cycle, 100% amplitude) using a Qsonica Q800R2 Sonicator. Insoluble fractions were removed via spin, and the supernatant was removed of non-specific binding chromatin via rotation with preclearing solution (3.7 mL IP Dilution Buffer, 0.5 mL Nuclear Lysis Buffer, 175 uL of Agarose Protein A/G beads, and 50 ug Rabbit IgG) for 2 hours at 4°C. Beads were pelleted and 4.7 mL of supernatant was removed. 200 uL of supernatant was retained as input control (stored at -20°C) while the remaining 4.5 mL was transferred to the beads that had been pre-bound with the H3K27ac antibody overnight; the IP reaction then rotated overnight again at 4°C. Bound bead complexes were washed once with 1 mL IP Wash Buffer 1 (20 mM Tris pH 8.0, 2 mM EDTA, 50 mM NaCl, 1% Triton X-100, 0.1% SDS), twice with 1 mL High-Salt Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 500 mM NaCl, 1% Triton X-100, 0.01% SDS), once with IP Wash Buffer 2 (10 mM Tris pH 8.0, 1 mM EDTA, 0.25 M LiCl, 1% NP-40/Igepal, 1% Na-deoxycholate), and finally twice with 1x TE. Complexes were eluted by twice resuspending bound beads in 110 uL Elution Buffer (100 mM NaHCO3, 1% SDS), pelleting the beads after each elution and transferring 100 uL supernatant to a new tube. Finally, 12 uL of 5M NaCl and 20 ug RNase A were added to both 200 uL IP and input samples and incubated at 65 degrees for 1 hour, followed by the addition of 60 ug of Proteinase K and overnight incubation at 65 degrees. DNA was isolated via phenol-chloroform extraction and ethanol precipitation and concentration was quantified using Qubit fluorometer. ChIP-seq libraries were prepared for sequencing using the NEBNext Ultra II DNA Library Prep Kit (NEB# E7645S), following manufacturer's protocol with the following user-chosen specifications. 3 ng DNA from all IP and input samples was used as starting material. NEBNext Adaptors were diluted 15x in 10 mM Tris-HCL, pH 8.0 with 10 mM NaCl prior to adaptor ligation. Large DNA fragments were removed via a size selection by adding 15 uL of AMPure XP beads at the first bead addition step and 87 uL of beads at the second bead addition step. Size-selected DNA was amplified using 9 cycles of PCR enrichment. The size-range of the final libraries was confirmed to be between 200-1000 bp using an Agilent Bioanalyzer High Sensitivity DNA test. H3K27ac enrichment was confirmed prior to sequencing by querying the IP/input qPCR enrichment of primer pairs designed to the Arc, Synaptotagmin-1, and Tcf25 promoter regions. Library concentrations were calculated and normalized using the KAPA Illumina Library Quantification Kit (#KK4835) so that libraries could be equally pooled before sequencing 75 bp single-end reads on the NextSeq500. All IP libraries were sequenced to a depth greater than 48 million reads and all input libraries were sequenced to greater than 67 million reads. 5C-seq: Neuronal cultures were formaldehyde fixed as described for ChIP-seq and stored at -80oC. For each condition (Bic, Untreat, TTX), in situ 3C was performed on 4 replicates (divided evenly across two animal/culture batches) of 4-5 million cells. Briefly, cells were thawed on ice and resuspended (gently) in 250 uL of lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630) with 50 uL protease inhibitors (Sigma P8340). Cell suspension was incubated on ice for 15 minutes and pelleted. Pelleted nuclei were washed once in lysis buffer (resuspension and spin), then resuspended and incubated in 50 uL of 0.5% SDS at 62oC for 10 min. SDS was inactivated via the addition of 145 uL H2O, 25 uL 10% Triton X-100, and incubation at 37oC for 15 min. Subsequently, chromatin was digested overnight at 37oC with the addition of 25 uL 10X NEBuffer2 and 100U (5 uL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62oC to inactivate the HindIII. Chromatin was re-ligated via the addition of 100 uL 10% Triton X-100, 120 uL NEB T4 DNA Ligation buffer (NEB B0202S), 12 uL 10 mg/mL BSA, 718 uL H2O, and 2000 U (5 uL) of T4 DNA Ligase (NEB M0202S) and incubation at 16oC for 2 hours (NOTE: This is a deviation from in situ HiC (Rao et al. 2010) in order to promote sticky-end ligation over blunt-end). Following ligation nuclei were pelleted, resuspended in 300 uL of 10 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 1% SDS, plus 25 uL of 20 mg/mL proteinase K (NEB P8107), and incubated at 65oC for 4 hours at which point an additional 25 uL of proteinase K was added and incubated overnight. 3C templates were isolated next day via RNaseA treatment, phenol-chloroform extraction, ethanol precipitation, and Amicon filtration (Millipore MFC5030BKS) (for more details see Beagan et al. 2016). Template size distribution and quantity were assessed with a 0.8% agarose gel. 5C primers were designed according to the double-alternating design scheme using the My5C primer design software (http://my5c.umassmed.edu/my5Cprimers/5C.php)10 with universal “Emulsion” primer tails. Regions were designed to capture TAD structures immediately surrounding the genes of interest (Bdnf, Fos, Arc, Neurexin-1, Neuroligin-3, Synaptotagmin-1) in published mouse cortex HiC data. 5C reactions were carried out as previously described. 600 ng (~200,000 genome copies) of 3C template for each replicate was mixed with 1 fmole of each</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>303759951</ID>
          <LABEL>GSM3759951</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM3759952" accession="SRX5818722">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX5818722</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM3759952</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM3759952: Bic 5C Rep1; Mus musculus; OTHER</TITLE>
    <STUDY_REF accession="SRP197612" refname="GSE131025">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS4747474">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS4747474</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM3759952</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>OTHER</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>GENOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>other</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>RNA-seq: At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. RNA-seq:We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library. ChIP-seq: At DIV16, neuronal cultures were fixed in 1% formaldehyde for 10 minutes (room temp) via the addition (1:10 vol/vol) of the following fixation solution: 50 mM Hepes-KOH (pH 7.5), 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 11% Formaldehyde. Fixation was quenched via the addition of 2.5 M glycine (1:20 vol/vol) and scraped into pellets of 8 million cells. Each pellet was washed once with cold PBS, flash frozen, and stored at -80oC. Immunoprecipitation was performed as described previously (Beagan et al., 2016) with slight modifications. Briefly, IP reactions were prepared a day prior to cell lysis by combining 20 uL of protein A and protein G conjugated agarose beads (Invitrogen# 15918-014 and 15920-010, respectively) with 10 uL of anti-H3K27ac antibody (Abcam# ab4729) in 1 mL of cold PBS and rotated overnight. The next day cell pellets were resuspended in 1 mL lysis buffer (10 mM Tris pH 8.0, 10 mM NaCl, 0.2% NP-40/Igepal, Protease Inhibitor, PMSF) and incubated on ice for 10 min. Cells were further lysed with 30 strokes of a dounce homogenizer (pestle A) and then nuclei were pelleted. Nuclei were lysed on ice in 50 mM Tris pH 8.0, 10 mM EDTA, 1% SDS, Protease Inhibitor, PMSF for 20 min. SDS concentration was reduced before sonication by the addition of 300 uL IP Dilution Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 150 mM NaCl, 1% Triston X-100, 0.01% SDS, Protease Inhibitor, PMSF), after which samples were sonicated for 60 minutes (30 seconds on, 30 seconds off cycle, 100% amplitude) using a Qsonica Q800R2 Sonicator. Insoluble fractions were removed via spin, and the supernatant was removed of non-specific binding chromatin via rotation with preclearing solution (3.7 mL IP Dilution Buffer, 0.5 mL Nuclear Lysis Buffer, 175 uL of Agarose Protein A/G beads, and 50 ug Rabbit IgG) for 2 hours at 4°C. Beads were pelleted and 4.7 mL of supernatant was removed. 200 uL of supernatant was retained as input control (stored at -20°C) while the remaining 4.5 mL was transferred to the beads that had been pre-bound with the H3K27ac antibody overnight; the IP reaction then rotated overnight again at 4°C. Bound bead complexes were washed once with 1 mL IP Wash Buffer 1 (20 mM Tris pH 8.0, 2 mM EDTA, 50 mM NaCl, 1% Triton X-100, 0.1% SDS), twice with 1 mL High-Salt Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 500 mM NaCl, 1% Triton X-100, 0.01% SDS), once with IP Wash Buffer 2 (10 mM Tris pH 8.0, 1 mM EDTA, 0.25 M LiCl, 1% NP-40/Igepal, 1% Na-deoxycholate), and finally twice with 1x TE. Complexes were eluted by twice resuspending bound beads in 110 uL Elution Buffer (100 mM NaHCO3, 1% SDS), pelleting the beads after each elution and transferring 100 uL supernatant to a new tube. Finally, 12 uL of 5M NaCl and 20 ug RNase A were added to both 200 uL IP and input samples and incubated at 65 degrees for 1 hour, followed by the addition of 60 ug of Proteinase K and overnight incubation at 65 degrees. DNA was isolated via phenol-chloroform extraction and ethanol precipitation and concentration was quantified using Qubit fluorometer. ChIP-seq libraries were prepared for sequencing using the NEBNext Ultra II DNA Library Prep Kit (NEB# E7645S), following manufacturer's protocol with the following user-chosen specifications. 3 ng DNA from all IP and input samples was used as starting material. NEBNext Adaptors were diluted 15x in 10 mM Tris-HCL, pH 8.0 with 10 mM NaCl prior to adaptor ligation. Large DNA fragments were removed via a size selection by adding 15 uL of AMPure XP beads at the first bead addition step and 87 uL of beads at the second bead addition step. Size-selected DNA was amplified using 9 cycles of PCR enrichment. The size-range of the final libraries was confirmed to be between 200-1000 bp using an Agilent Bioanalyzer High Sensitivity DNA test. H3K27ac enrichment was confirmed prior to sequencing by querying the IP/input qPCR enrichment of primer pairs designed to the Arc, Synaptotagmin-1, and Tcf25 promoter regions. Library concentrations were calculated and normalized using the KAPA Illumina Library Quantification Kit (#KK4835) so that libraries could be equally pooled before sequencing 75 bp single-end reads on the NextSeq500. All IP libraries were sequenced to a depth greater than 48 million reads and all input libraries were sequenced to greater than 67 million reads. 5C-seq: Neuronal cultures were formaldehyde fixed as described for ChIP-seq and stored at -80oC. For each condition (Bic, Untreat, TTX), in situ 3C was performed on 4 replicates (divided evenly across two animal/culture batches) of 4-5 million cells. Briefly, cells were thawed on ice and resuspended (gently) in 250 uL of lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630) with 50 uL protease inhibitors (Sigma P8340). Cell suspension was incubated on ice for 15 minutes and pelleted. Pelleted nuclei were washed once in lysis buffer (resuspension and spin), then resuspended and incubated in 50 uL of 0.5% SDS at 62oC for 10 min. SDS was inactivated via the addition of 145 uL H2O, 25 uL 10% Triton X-100, and incubation at 37oC for 15 min. Subsequently, chromatin was digested overnight at 37oC with the addition of 25 uL 10X NEBuffer2 and 100U (5 uL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62oC to inactivate the HindIII. Chromatin was re-ligated via the addition of 100 uL 10% Triton X-100, 120 uL NEB T4 DNA Ligation buffer (NEB B0202S), 12 uL 10 mg/mL BSA, 718 uL H2O, and 2000 U (5 uL) of T4 DNA Ligase (NEB M0202S) and incubation at 16oC for 2 hours (NOTE: This is a deviation from in situ HiC (Rao et al. 2010) in order to promote sticky-end ligation over blunt-end). Following ligation nuclei were pelleted, resuspended in 300 uL of 10 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 1% SDS, plus 25 uL of 20 mg/mL proteinase K (NEB P8107), and incubated at 65oC for 4 hours at which point an additional 25 uL of proteinase K was added and incubated overnight. 3C templates were isolated next day via RNaseA treatment, phenol-chloroform extraction, ethanol precipitation, and Amicon filtration (Millipore MFC5030BKS) (for more details see Beagan et al. 2016). Template size distribution and quantity were assessed with a 0.8% agarose gel. 5C primers were designed according to the double-alternating design scheme using the My5C primer design software (http://my5c.umassmed.edu/my5Cprimers/5C.php)10 with universal “Emulsion” primer tails. Regions were designed to capture TAD structures immediately surrounding the genes of interest (Bdnf, Fos, Arc, Neurexin-1, Neuroligin-3, Synaptotagmin-1) in published mouse cortex HiC data. 5C reactions were carried out as previously described. 600 ng (~200,000 genome copies) of 3C template for each replicate was mixed with 1 fmole of each</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>303759952</ID>
          <LABEL>GSM3759952</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM3759953" accession="SRX5818723">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX5818723</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM3759953</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM3759953: Bic 5C Rep2; Mus musculus; OTHER</TITLE>
    <STUDY_REF accession="SRP197612" refname="GSE131025">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS4747475">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS4747475</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM3759953</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>OTHER</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>GENOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>other</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>RNA-seq: At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. RNA-seq:We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library. ChIP-seq: At DIV16, neuronal cultures were fixed in 1% formaldehyde for 10 minutes (room temp) via the addition (1:10 vol/vol) of the following fixation solution: 50 mM Hepes-KOH (pH 7.5), 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 11% Formaldehyde. Fixation was quenched via the addition of 2.5 M glycine (1:20 vol/vol) and scraped into pellets of 8 million cells. Each pellet was washed once with cold PBS, flash frozen, and stored at -80oC. Immunoprecipitation was performed as described previously (Beagan et al., 2016) with slight modifications. Briefly, IP reactions were prepared a day prior to cell lysis by combining 20 uL of protein A and protein G conjugated agarose beads (Invitrogen# 15918-014 and 15920-010, respectively) with 10 uL of anti-H3K27ac antibody (Abcam# ab4729) in 1 mL of cold PBS and rotated overnight. The next day cell pellets were resuspended in 1 mL lysis buffer (10 mM Tris pH 8.0, 10 mM NaCl, 0.2% NP-40/Igepal, Protease Inhibitor, PMSF) and incubated on ice for 10 min. Cells were further lysed with 30 strokes of a dounce homogenizer (pestle A) and then nuclei were pelleted. Nuclei were lysed on ice in 50 mM Tris pH 8.0, 10 mM EDTA, 1% SDS, Protease Inhibitor, PMSF for 20 min. SDS concentration was reduced before sonication by the addition of 300 uL IP Dilution Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 150 mM NaCl, 1% Triston X-100, 0.01% SDS, Protease Inhibitor, PMSF), after which samples were sonicated for 60 minutes (30 seconds on, 30 seconds off cycle, 100% amplitude) using a Qsonica Q800R2 Sonicator. Insoluble fractions were removed via spin, and the supernatant was removed of non-specific binding chromatin via rotation with preclearing solution (3.7 mL IP Dilution Buffer, 0.5 mL Nuclear Lysis Buffer, 175 uL of Agarose Protein A/G beads, and 50 ug Rabbit IgG) for 2 hours at 4°C. Beads were pelleted and 4.7 mL of supernatant was removed. 200 uL of supernatant was retained as input control (stored at -20°C) while the remaining 4.5 mL was transferred to the beads that had been pre-bound with the H3K27ac antibody overnight; the IP reaction then rotated overnight again at 4°C. Bound bead complexes were washed once with 1 mL IP Wash Buffer 1 (20 mM Tris pH 8.0, 2 mM EDTA, 50 mM NaCl, 1% Triton X-100, 0.1% SDS), twice with 1 mL High-Salt Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 500 mM NaCl, 1% Triton X-100, 0.01% SDS), once with IP Wash Buffer 2 (10 mM Tris pH 8.0, 1 mM EDTA, 0.25 M LiCl, 1% NP-40/Igepal, 1% Na-deoxycholate), and finally twice with 1x TE. Complexes were eluted by twice resuspending bound beads in 110 uL Elution Buffer (100 mM NaHCO3, 1% SDS), pelleting the beads after each elution and transferring 100 uL supernatant to a new tube. Finally, 12 uL of 5M NaCl and 20 ug RNase A were added to both 200 uL IP and input samples and incubated at 65 degrees for 1 hour, followed by the addition of 60 ug of Proteinase K and overnight incubation at 65 degrees. DNA was isolated via phenol-chloroform extraction and ethanol precipitation and concentration was quantified using Qubit fluorometer. ChIP-seq libraries were prepared for sequencing using the NEBNext Ultra II DNA Library Prep Kit (NEB# E7645S), following manufacturer's protocol with the following user-chosen specifications. 3 ng DNA from all IP and input samples was used as starting material. NEBNext Adaptors were diluted 15x in 10 mM Tris-HCL, pH 8.0 with 10 mM NaCl prior to adaptor ligation. Large DNA fragments were removed via a size selection by adding 15 uL of AMPure XP beads at the first bead addition step and 87 uL of beads at the second bead addition step. Size-selected DNA was amplified using 9 cycles of PCR enrichment. The size-range of the final libraries was confirmed to be between 200-1000 bp using an Agilent Bioanalyzer High Sensitivity DNA test. H3K27ac enrichment was confirmed prior to sequencing by querying the IP/input qPCR enrichment of primer pairs designed to the Arc, Synaptotagmin-1, and Tcf25 promoter regions. Library concentrations were calculated and normalized using the KAPA Illumina Library Quantification Kit (#KK4835) so that libraries could be equally pooled before sequencing 75 bp single-end reads on the NextSeq500. All IP libraries were sequenced to a depth greater than 48 million reads and all input libraries were sequenced to greater than 67 million reads. 5C-seq: Neuronal cultures were formaldehyde fixed as described for ChIP-seq and stored at -80oC. For each condition (Bic, Untreat, TTX), in situ 3C was performed on 4 replicates (divided evenly across two animal/culture batches) of 4-5 million cells. Briefly, cells were thawed on ice and resuspended (gently) in 250 uL of lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630) with 50 uL protease inhibitors (Sigma P8340). Cell suspension was incubated on ice for 15 minutes and pelleted. Pelleted nuclei were washed once in lysis buffer (resuspension and spin), then resuspended and incubated in 50 uL of 0.5% SDS at 62oC for 10 min. SDS was inactivated via the addition of 145 uL H2O, 25 uL 10% Triton X-100, and incubation at 37oC for 15 min. Subsequently, chromatin was digested overnight at 37oC with the addition of 25 uL 10X NEBuffer2 and 100U (5 uL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62oC to inactivate the HindIII. Chromatin was re-ligated via the addition of 100 uL 10% Triton X-100, 120 uL NEB T4 DNA Ligation buffer (NEB B0202S), 12 uL 10 mg/mL BSA, 718 uL H2O, and 2000 U (5 uL) of T4 DNA Ligase (NEB M0202S) and incubation at 16oC for 2 hours (NOTE: This is a deviation from in situ HiC (Rao et al. 2010) in order to promote sticky-end ligation over blunt-end). Following ligation nuclei were pelleted, resuspended in 300 uL of 10 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 1% SDS, plus 25 uL of 20 mg/mL proteinase K (NEB P8107), and incubated at 65oC for 4 hours at which point an additional 25 uL of proteinase K was added and incubated overnight. 3C templates were isolated next day via RNaseA treatment, phenol-chloroform extraction, ethanol precipitation, and Amicon filtration (Millipore MFC5030BKS) (for more details see Beagan et al. 2016). Template size distribution and quantity were assessed with a 0.8% agarose gel. 5C primers were designed according to the double-alternating design scheme using the My5C primer design software (http://my5c.umassmed.edu/my5Cprimers/5C.php)10 with universal “Emulsion” primer tails. Regions were designed to capture TAD structures immediately surrounding the genes of interest (Bdnf, Fos, Arc, Neurexin-1, Neuroligin-3, Synaptotagmin-1) in published mouse cortex HiC data. 5C reactions were carried out as previously described. 600 ng (~200,000 genome copies) of 3C template for each replicate was mixed with 1 fmole of each</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>303759953</ID>
          <LABEL>GSM3759953</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM3759954" accession="SRX5818724">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX5818724</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM3759954</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM3759954: Bic 5C Rep 3; Mus musculus; OTHER</TITLE>
    <STUDY_REF accession="SRP197612" refname="GSE131025">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS4747476">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS4747476</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM3759954</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>OTHER</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>GENOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>other</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>RNA-seq: At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. RNA-seq:We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library. ChIP-seq: At DIV16, neuronal cultures were fixed in 1% formaldehyde for 10 minutes (room temp) via the addition (1:10 vol/vol) of the following fixation solution: 50 mM Hepes-KOH (pH 7.5), 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 11% Formaldehyde. Fixation was quenched via the addition of 2.5 M glycine (1:20 vol/vol) and scraped into pellets of 8 million cells. Each pellet was washed once with cold PBS, flash frozen, and stored at -80oC. Immunoprecipitation was performed as described previously (Beagan et al., 2016) with slight modifications. Briefly, IP reactions were prepared a day prior to cell lysis by combining 20 uL of protein A and protein G conjugated agarose beads (Invitrogen# 15918-014 and 15920-010, respectively) with 10 uL of anti-H3K27ac antibody (Abcam# ab4729) in 1 mL of cold PBS and rotated overnight. The next day cell pellets were resuspended in 1 mL lysis buffer (10 mM Tris pH 8.0, 10 mM NaCl, 0.2% NP-40/Igepal, Protease Inhibitor, PMSF) and incubated on ice for 10 min. Cells were further lysed with 30 strokes of a dounce homogenizer (pestle A) and then nuclei were pelleted. Nuclei were lysed on ice in 50 mM Tris pH 8.0, 10 mM EDTA, 1% SDS, Protease Inhibitor, PMSF for 20 min. SDS concentration was reduced before sonication by the addition of 300 uL IP Dilution Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 150 mM NaCl, 1% Triston X-100, 0.01% SDS, Protease Inhibitor, PMSF), after which samples were sonicated for 60 minutes (30 seconds on, 30 seconds off cycle, 100% amplitude) using a Qsonica Q800R2 Sonicator. Insoluble fractions were removed via spin, and the supernatant was removed of non-specific binding chromatin via rotation with preclearing solution (3.7 mL IP Dilution Buffer, 0.5 mL Nuclear Lysis Buffer, 175 uL of Agarose Protein A/G beads, and 50 ug Rabbit IgG) for 2 hours at 4°C. Beads were pelleted and 4.7 mL of supernatant was removed. 200 uL of supernatant was retained as input control (stored at -20°C) while the remaining 4.5 mL was transferred to the beads that had been pre-bound with the H3K27ac antibody overnight; the IP reaction then rotated overnight again at 4°C. Bound bead complexes were washed once with 1 mL IP Wash Buffer 1 (20 mM Tris pH 8.0, 2 mM EDTA, 50 mM NaCl, 1% Triton X-100, 0.1% SDS), twice with 1 mL High-Salt Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 500 mM NaCl, 1% Triton X-100, 0.01% SDS), once with IP Wash Buffer 2 (10 mM Tris pH 8.0, 1 mM EDTA, 0.25 M LiCl, 1% NP-40/Igepal, 1% Na-deoxycholate), and finally twice with 1x TE. Complexes were eluted by twice resuspending bound beads in 110 uL Elution Buffer (100 mM NaHCO3, 1% SDS), pelleting the beads after each elution and transferring 100 uL supernatant to a new tube. Finally, 12 uL of 5M NaCl and 20 ug RNase A were added to both 200 uL IP and input samples and incubated at 65 degrees for 1 hour, followed by the addition of 60 ug of Proteinase K and overnight incubation at 65 degrees. DNA was isolated via phenol-chloroform extraction and ethanol precipitation and concentration was quantified using Qubit fluorometer. ChIP-seq libraries were prepared for sequencing using the NEBNext Ultra II DNA Library Prep Kit (NEB# E7645S), following manufacturer's protocol with the following user-chosen specifications. 3 ng DNA from all IP and input samples was used as starting material. NEBNext Adaptors were diluted 15x in 10 mM Tris-HCL, pH 8.0 with 10 mM NaCl prior to adaptor ligation. Large DNA fragments were removed via a size selection by adding 15 uL of AMPure XP beads at the first bead addition step and 87 uL of beads at the second bead addition step. Size-selected DNA was amplified using 9 cycles of PCR enrichment. The size-range of the final libraries was confirmed to be between 200-1000 bp using an Agilent Bioanalyzer High Sensitivity DNA test. H3K27ac enrichment was confirmed prior to sequencing by querying the IP/input qPCR enrichment of primer pairs designed to the Arc, Synaptotagmin-1, and Tcf25 promoter regions. Library concentrations were calculated and normalized using the KAPA Illumina Library Quantification Kit (#KK4835) so that libraries could be equally pooled before sequencing 75 bp single-end reads on the NextSeq500. All IP libraries were sequenced to a depth greater than 48 million reads and all input libraries were sequenced to greater than 67 million reads. 5C-seq: Neuronal cultures were formaldehyde fixed as described for ChIP-seq and stored at -80oC. For each condition (Bic, Untreat, TTX), in situ 3C was performed on 4 replicates (divided evenly across two animal/culture batches) of 4-5 million cells. Briefly, cells were thawed on ice and resuspended (gently) in 250 uL of lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630) with 50 uL protease inhibitors (Sigma P8340). Cell suspension was incubated on ice for 15 minutes and pelleted. Pelleted nuclei were washed once in lysis buffer (resuspension and spin), then resuspended and incubated in 50 uL of 0.5% SDS at 62oC for 10 min. SDS was inactivated via the addition of 145 uL H2O, 25 uL 10% Triton X-100, and incubation at 37oC for 15 min. Subsequently, chromatin was digested overnight at 37oC with the addition of 25 uL 10X NEBuffer2 and 100U (5 uL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62oC to inactivate the HindIII. Chromatin was re-ligated via the addition of 100 uL 10% Triton X-100, 120 uL NEB T4 DNA Ligation buffer (NEB B0202S), 12 uL 10 mg/mL BSA, 718 uL H2O, and 2000 U (5 uL) of T4 DNA Ligase (NEB M0202S) and incubation at 16oC for 2 hours (NOTE: This is a deviation from in situ HiC (Rao et al. 2010) in order to promote sticky-end ligation over blunt-end). Following ligation nuclei were pelleted, resuspended in 300 uL of 10 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 1% SDS, plus 25 uL of 20 mg/mL proteinase K (NEB P8107), and incubated at 65oC for 4 hours at which point an additional 25 uL of proteinase K was added and incubated overnight. 3C templates were isolated next day via RNaseA treatment, phenol-chloroform extraction, ethanol precipitation, and Amicon filtration (Millipore MFC5030BKS) (for more details see Beagan et al. 2016). Template size distribution and quantity were assessed with a 0.8% agarose gel. 5C primers were designed according to the double-alternating design scheme using the My5C primer design software (http://my5c.umassmed.edu/my5Cprimers/5C.php)10 with universal “Emulsion” primer tails. Regions were designed to capture TAD structures immediately surrounding the genes of interest (Bdnf, Fos, Arc, Neurexin-1, Neuroligin-3, Synaptotagmin-1) in published mouse cortex HiC data. 5C reactions were carried out as previously described. 600 ng (~200,000 genome copies) of 3C template for each replicate was mixed with 1 fmole of each</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>303759954</ID>
          <LABEL>GSM3759954</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM3759955" accession="SRX5818725">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX5818725</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM3759955</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM3759955: Bic 5C Rep 4; Mus musculus; OTHER</TITLE>
    <STUDY_REF accession="SRP197612" refname="GSE131025">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS4747477">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS4747477</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM3759955</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>OTHER</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>GENOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>other</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>RNA-seq: At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. RNA-seq:We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library. ChIP-seq: At DIV16, neuronal cultures were fixed in 1% formaldehyde for 10 minutes (room temp) via the addition (1:10 vol/vol) of the following fixation solution: 50 mM Hepes-KOH (pH 7.5), 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 11% Formaldehyde. Fixation was quenched via the addition of 2.5 M glycine (1:20 vol/vol) and scraped into pellets of 8 million cells. Each pellet was washed once with cold PBS, flash frozen, and stored at -80oC. Immunoprecipitation was performed as described previously (Beagan et al., 2016) with slight modifications. Briefly, IP reactions were prepared a day prior to cell lysis by combining 20 uL of protein A and protein G conjugated agarose beads (Invitrogen# 15918-014 and 15920-010, respectively) with 10 uL of anti-H3K27ac antibody (Abcam# ab4729) in 1 mL of cold PBS and rotated overnight. The next day cell pellets were resuspended in 1 mL lysis buffer (10 mM Tris pH 8.0, 10 mM NaCl, 0.2% NP-40/Igepal, Protease Inhibitor, PMSF) and incubated on ice for 10 min. Cells were further lysed with 30 strokes of a dounce homogenizer (pestle A) and then nuclei were pelleted. Nuclei were lysed on ice in 50 mM Tris pH 8.0, 10 mM EDTA, 1% SDS, Protease Inhibitor, PMSF for 20 min. SDS concentration was reduced before sonication by the addition of 300 uL IP Dilution Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 150 mM NaCl, 1% Triston X-100, 0.01% SDS, Protease Inhibitor, PMSF), after which samples were sonicated for 60 minutes (30 seconds on, 30 seconds off cycle, 100% amplitude) using a Qsonica Q800R2 Sonicator. Insoluble fractions were removed via spin, and the supernatant was removed of non-specific binding chromatin via rotation with preclearing solution (3.7 mL IP Dilution Buffer, 0.5 mL Nuclear Lysis Buffer, 175 uL of Agarose Protein A/G beads, and 50 ug Rabbit IgG) for 2 hours at 4°C. Beads were pelleted and 4.7 mL of supernatant was removed. 200 uL of supernatant was retained as input control (stored at -20°C) while the remaining 4.5 mL was transferred to the beads that had been pre-bound with the H3K27ac antibody overnight; the IP reaction then rotated overnight again at 4°C. Bound bead complexes were washed once with 1 mL IP Wash Buffer 1 (20 mM Tris pH 8.0, 2 mM EDTA, 50 mM NaCl, 1% Triton X-100, 0.1% SDS), twice with 1 mL High-Salt Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 500 mM NaCl, 1% Triton X-100, 0.01% SDS), once with IP Wash Buffer 2 (10 mM Tris pH 8.0, 1 mM EDTA, 0.25 M LiCl, 1% NP-40/Igepal, 1% Na-deoxycholate), and finally twice with 1x TE. Complexes were eluted by twice resuspending bound beads in 110 uL Elution Buffer (100 mM NaHCO3, 1% SDS), pelleting the beads after each elution and transferring 100 uL supernatant to a new tube. Finally, 12 uL of 5M NaCl and 20 ug RNase A were added to both 200 uL IP and input samples and incubated at 65 degrees for 1 hour, followed by the addition of 60 ug of Proteinase K and overnight incubation at 65 degrees. DNA was isolated via phenol-chloroform extraction and ethanol precipitation and concentration was quantified using Qubit fluorometer. ChIP-seq libraries were prepared for sequencing using the NEBNext Ultra II DNA Library Prep Kit (NEB# E7645S), following manufacturer's protocol with the following user-chosen specifications. 3 ng DNA from all IP and input samples was used as starting material. NEBNext Adaptors were diluted 15x in 10 mM Tris-HCL, pH 8.0 with 10 mM NaCl prior to adaptor ligation. Large DNA fragments were removed via a size selection by adding 15 uL of AMPure XP beads at the first bead addition step and 87 uL of beads at the second bead addition step. Size-selected DNA was amplified using 9 cycles of PCR enrichment. The size-range of the final libraries was confirmed to be between 200-1000 bp using an Agilent Bioanalyzer High Sensitivity DNA test. H3K27ac enrichment was confirmed prior to sequencing by querying the IP/input qPCR enrichment of primer pairs designed to the Arc, Synaptotagmin-1, and Tcf25 promoter regions. Library concentrations were calculated and normalized using the KAPA Illumina Library Quantification Kit (#KK4835) so that libraries could be equally pooled before sequencing 75 bp single-end reads on the NextSeq500. All IP libraries were sequenced to a depth greater than 48 million reads and all input libraries were sequenced to greater than 67 million reads. 5C-seq: Neuronal cultures were formaldehyde fixed as described for ChIP-seq and stored at -80oC. For each condition (Bic, Untreat, TTX), in situ 3C was performed on 4 replicates (divided evenly across two animal/culture batches) of 4-5 million cells. Briefly, cells were thawed on ice and resuspended (gently) in 250 uL of lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630) with 50 uL protease inhibitors (Sigma P8340). Cell suspension was incubated on ice for 15 minutes and pelleted. Pelleted nuclei were washed once in lysis buffer (resuspension and spin), then resuspended and incubated in 50 uL of 0.5% SDS at 62oC for 10 min. SDS was inactivated via the addition of 145 uL H2O, 25 uL 10% Triton X-100, and incubation at 37oC for 15 min. Subsequently, chromatin was digested overnight at 37oC with the addition of 25 uL 10X NEBuffer2 and 100U (5 uL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62oC to inactivate the HindIII. Chromatin was re-ligated via the addition of 100 uL 10% Triton X-100, 120 uL NEB T4 DNA Ligation buffer (NEB B0202S), 12 uL 10 mg/mL BSA, 718 uL H2O, and 2000 U (5 uL) of T4 DNA Ligase (NEB M0202S) and incubation at 16oC for 2 hours (NOTE: This is a deviation from in situ HiC (Rao et al. 2010) in order to promote sticky-end ligation over blunt-end). Following ligation nuclei were pelleted, resuspended in 300 uL of 10 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 1% SDS, plus 25 uL of 20 mg/mL proteinase K (NEB P8107), and incubated at 65oC for 4 hours at which point an additional 25 uL of proteinase K was added and incubated overnight. 3C templates were isolated next day via RNaseA treatment, phenol-chloroform extraction, ethanol precipitation, and Amicon filtration (Millipore MFC5030BKS) (for more details see Beagan et al. 2016). Template size distribution and quantity were assessed with a 0.8% agarose gel. 5C primers were designed according to the double-alternating design scheme using the My5C primer design software (http://my5c.umassmed.edu/my5Cprimers/5C.php)10 with universal “Emulsion” primer tails. Regions were designed to capture TAD structures immediately surrounding the genes of interest (Bdnf, Fos, Arc, Neurexin-1, Neuroligin-3, Synaptotagmin-1) in published mouse cortex HiC data. 5C reactions were carried out as previously described. 600 ng (~200,000 genome copies) of 3C template for each replicate was mixed with 1 fmole of each</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>303759955</ID>
          <LABEL>GSM3759955</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM3759956" accession="SRX5818726">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX5818726</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM3759956</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM3759956: TTX 5C Rep1; Mus musculus; OTHER</TITLE>
    <STUDY_REF accession="SRP197612" refname="GSE131025">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS4747478">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS4747478</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM3759956</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>OTHER</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>GENOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>other</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>RNA-seq: At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. RNA-seq:We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library. ChIP-seq: At DIV16, neuronal cultures were fixed in 1% formaldehyde for 10 minutes (room temp) via the addition (1:10 vol/vol) of the following fixation solution: 50 mM Hepes-KOH (pH 7.5), 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 11% Formaldehyde. Fixation was quenched via the addition of 2.5 M glycine (1:20 vol/vol) and scraped into pellets of 8 million cells. Each pellet was washed once with cold PBS, flash frozen, and stored at -80oC. Immunoprecipitation was performed as described previously (Beagan et al., 2016) with slight modifications. Briefly, IP reactions were prepared a day prior to cell lysis by combining 20 uL of protein A and protein G conjugated agarose beads (Invitrogen# 15918-014 and 15920-010, respectively) with 10 uL of anti-H3K27ac antibody (Abcam# ab4729) in 1 mL of cold PBS and rotated overnight. The next day cell pellets were resuspended in 1 mL lysis buffer (10 mM Tris pH 8.0, 10 mM NaCl, 0.2% NP-40/Igepal, Protease Inhibitor, PMSF) and incubated on ice for 10 min. Cells were further lysed with 30 strokes of a dounce homogenizer (pestle A) and then nuclei were pelleted. Nuclei were lysed on ice in 50 mM Tris pH 8.0, 10 mM EDTA, 1% SDS, Protease Inhibitor, PMSF for 20 min. SDS concentration was reduced before sonication by the addition of 300 uL IP Dilution Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 150 mM NaCl, 1% Triston X-100, 0.01% SDS, Protease Inhibitor, PMSF), after which samples were sonicated for 60 minutes (30 seconds on, 30 seconds off cycle, 100% amplitude) using a Qsonica Q800R2 Sonicator. Insoluble fractions were removed via spin, and the supernatant was removed of non-specific binding chromatin via rotation with preclearing solution (3.7 mL IP Dilution Buffer, 0.5 mL Nuclear Lysis Buffer, 175 uL of Agarose Protein A/G beads, and 50 ug Rabbit IgG) for 2 hours at 4°C. Beads were pelleted and 4.7 mL of supernatant was removed. 200 uL of supernatant was retained as input control (stored at -20°C) while the remaining 4.5 mL was transferred to the beads that had been pre-bound with the H3K27ac antibody overnight; the IP reaction then rotated overnight again at 4°C. Bound bead complexes were washed once with 1 mL IP Wash Buffer 1 (20 mM Tris pH 8.0, 2 mM EDTA, 50 mM NaCl, 1% Triton X-100, 0.1% SDS), twice with 1 mL High-Salt Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 500 mM NaCl, 1% Triton X-100, 0.01% SDS), once with IP Wash Buffer 2 (10 mM Tris pH 8.0, 1 mM EDTA, 0.25 M LiCl, 1% NP-40/Igepal, 1% Na-deoxycholate), and finally twice with 1x TE. Complexes were eluted by twice resuspending bound beads in 110 uL Elution Buffer (100 mM NaHCO3, 1% SDS), pelleting the beads after each elution and transferring 100 uL supernatant to a new tube. Finally, 12 uL of 5M NaCl and 20 ug RNase A were added to both 200 uL IP and input samples and incubated at 65 degrees for 1 hour, followed by the addition of 60 ug of Proteinase K and overnight incubation at 65 degrees. DNA was isolated via phenol-chloroform extraction and ethanol precipitation and concentration was quantified using Qubit fluorometer. ChIP-seq libraries were prepared for sequencing using the NEBNext Ultra II DNA Library Prep Kit (NEB# E7645S), following manufacturer's protocol with the following user-chosen specifications. 3 ng DNA from all IP and input samples was used as starting material. NEBNext Adaptors were diluted 15x in 10 mM Tris-HCL, pH 8.0 with 10 mM NaCl prior to adaptor ligation. Large DNA fragments were removed via a size selection by adding 15 uL of AMPure XP beads at the first bead addition step and 87 uL of beads at the second bead addition step. Size-selected DNA was amplified using 9 cycles of PCR enrichment. The size-range of the final libraries was confirmed to be between 200-1000 bp using an Agilent Bioanalyzer High Sensitivity DNA test. H3K27ac enrichment was confirmed prior to sequencing by querying the IP/input qPCR enrichment of primer pairs designed to the Arc, Synaptotagmin-1, and Tcf25 promoter regions. Library concentrations were calculated and normalized using the KAPA Illumina Library Quantification Kit (#KK4835) so that libraries could be equally pooled before sequencing 75 bp single-end reads on the NextSeq500. All IP libraries were sequenced to a depth greater than 48 million reads and all input libraries were sequenced to greater than 67 million reads. 5C-seq: Neuronal cultures were formaldehyde fixed as described for ChIP-seq and stored at -80oC. For each condition (Bic, Untreat, TTX), in situ 3C was performed on 4 replicates (divided evenly across two animal/culture batches) of 4-5 million cells. Briefly, cells were thawed on ice and resuspended (gently) in 250 uL of lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630) with 50 uL protease inhibitors (Sigma P8340). Cell suspension was incubated on ice for 15 minutes and pelleted. Pelleted nuclei were washed once in lysis buffer (resuspension and spin), then resuspended and incubated in 50 uL of 0.5% SDS at 62oC for 10 min. SDS was inactivated via the addition of 145 uL H2O, 25 uL 10% Triton X-100, and incubation at 37oC for 15 min. Subsequently, chromatin was digested overnight at 37oC with the addition of 25 uL 10X NEBuffer2 and 100U (5 uL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62oC to inactivate the HindIII. Chromatin was re-ligated via the addition of 100 uL 10% Triton X-100, 120 uL NEB T4 DNA Ligation buffer (NEB B0202S), 12 uL 10 mg/mL BSA, 718 uL H2O, and 2000 U (5 uL) of T4 DNA Ligase (NEB M0202S) and incubation at 16oC for 2 hours (NOTE: This is a deviation from in situ HiC (Rao et al. 2010) in order to promote sticky-end ligation over blunt-end). Following ligation nuclei were pelleted, resuspended in 300 uL of 10 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 1% SDS, plus 25 uL of 20 mg/mL proteinase K (NEB P8107), and incubated at 65oC for 4 hours at which point an additional 25 uL of proteinase K was added and incubated overnight. 3C templates were isolated next day via RNaseA treatment, phenol-chloroform extraction, ethanol precipitation, and Amicon filtration (Millipore MFC5030BKS) (for more details see Beagan et al. 2016). Template size distribution and quantity were assessed with a 0.8% agarose gel. 5C primers were designed according to the double-alternating design scheme using the My5C primer design software (http://my5c.umassmed.edu/my5Cprimers/5C.php)10 with universal “Emulsion” primer tails. Regions were designed to capture TAD structures immediately surrounding the genes of interest (Bdnf, Fos, Arc, Neurexin-1, Neuroligin-3, Synaptotagmin-1) in published mouse cortex HiC data. 5C reactions were carried out as previously described. 600 ng (~200,000 genome copies) of 3C template for each replicate was mixed with 1 fmole of each</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>303759956</ID>
          <LABEL>GSM3759956</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM3759957" accession="SRX5818727">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX5818727</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM3759957</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM3759957: TTX 5C Rep2; Mus musculus; OTHER</TITLE>
    <STUDY_REF accession="SRP197612" refname="GSE131025">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS4747479">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS4747479</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM3759957</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>OTHER</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>GENOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>other</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>RNA-seq: At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. RNA-seq:We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library. ChIP-seq: At DIV16, neuronal cultures were fixed in 1% formaldehyde for 10 minutes (room temp) via the addition (1:10 vol/vol) of the following fixation solution: 50 mM Hepes-KOH (pH 7.5), 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 11% Formaldehyde. Fixation was quenched via the addition of 2.5 M glycine (1:20 vol/vol) and scraped into pellets of 8 million cells. Each pellet was washed once with cold PBS, flash frozen, and stored at -80oC. Immunoprecipitation was performed as described previously (Beagan et al., 2016) with slight modifications. Briefly, IP reactions were prepared a day prior to cell lysis by combining 20 uL of protein A and protein G conjugated agarose beads (Invitrogen# 15918-014 and 15920-010, respectively) with 10 uL of anti-H3K27ac antibody (Abcam# ab4729) in 1 mL of cold PBS and rotated overnight. The next day cell pellets were resuspended in 1 mL lysis buffer (10 mM Tris pH 8.0, 10 mM NaCl, 0.2% NP-40/Igepal, Protease Inhibitor, PMSF) and incubated on ice for 10 min. Cells were further lysed with 30 strokes of a dounce homogenizer (pestle A) and then nuclei were pelleted. Nuclei were lysed on ice in 50 mM Tris pH 8.0, 10 mM EDTA, 1% SDS, Protease Inhibitor, PMSF for 20 min. SDS concentration was reduced before sonication by the addition of 300 uL IP Dilution Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 150 mM NaCl, 1% Triston X-100, 0.01% SDS, Protease Inhibitor, PMSF), after which samples were sonicated for 60 minutes (30 seconds on, 30 seconds off cycle, 100% amplitude) using a Qsonica Q800R2 Sonicator. Insoluble fractions were removed via spin, and the supernatant was removed of non-specific binding chromatin via rotation with preclearing solution (3.7 mL IP Dilution Buffer, 0.5 mL Nuclear Lysis Buffer, 175 uL of Agarose Protein A/G beads, and 50 ug Rabbit IgG) for 2 hours at 4°C. Beads were pelleted and 4.7 mL of supernatant was removed. 200 uL of supernatant was retained as input control (stored at -20°C) while the remaining 4.5 mL was transferred to the beads that had been pre-bound with the H3K27ac antibody overnight; the IP reaction then rotated overnight again at 4°C. Bound bead complexes were washed once with 1 mL IP Wash Buffer 1 (20 mM Tris pH 8.0, 2 mM EDTA, 50 mM NaCl, 1% Triton X-100, 0.1% SDS), twice with 1 mL High-Salt Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 500 mM NaCl, 1% Triton X-100, 0.01% SDS), once with IP Wash Buffer 2 (10 mM Tris pH 8.0, 1 mM EDTA, 0.25 M LiCl, 1% NP-40/Igepal, 1% Na-deoxycholate), and finally twice with 1x TE. Complexes were eluted by twice resuspending bound beads in 110 uL Elution Buffer (100 mM NaHCO3, 1% SDS), pelleting the beads after each elution and transferring 100 uL supernatant to a new tube. Finally, 12 uL of 5M NaCl and 20 ug RNase A were added to both 200 uL IP and input samples and incubated at 65 degrees for 1 hour, followed by the addition of 60 ug of Proteinase K and overnight incubation at 65 degrees. DNA was isolated via phenol-chloroform extraction and ethanol precipitation and concentration was quantified using Qubit fluorometer. ChIP-seq libraries were prepared for sequencing using the NEBNext Ultra II DNA Library Prep Kit (NEB# E7645S), following manufacturer's protocol with the following user-chosen specifications. 3 ng DNA from all IP and input samples was used as starting material. NEBNext Adaptors were diluted 15x in 10 mM Tris-HCL, pH 8.0 with 10 mM NaCl prior to adaptor ligation. Large DNA fragments were removed via a size selection by adding 15 uL of AMPure XP beads at the first bead addition step and 87 uL of beads at the second bead addition step. Size-selected DNA was amplified using 9 cycles of PCR enrichment. The size-range of the final libraries was confirmed to be between 200-1000 bp using an Agilent Bioanalyzer High Sensitivity DNA test. H3K27ac enrichment was confirmed prior to sequencing by querying the IP/input qPCR enrichment of primer pairs designed to the Arc, Synaptotagmin-1, and Tcf25 promoter regions. Library concentrations were calculated and normalized using the KAPA Illumina Library Quantification Kit (#KK4835) so that libraries could be equally pooled before sequencing 75 bp single-end reads on the NextSeq500. All IP libraries were sequenced to a depth greater than 48 million reads and all input libraries were sequenced to greater than 67 million reads. 5C-seq: Neuronal cultures were formaldehyde fixed as described for ChIP-seq and stored at -80oC. For each condition (Bic, Untreat, TTX), in situ 3C was performed on 4 replicates (divided evenly across two animal/culture batches) of 4-5 million cells. Briefly, cells were thawed on ice and resuspended (gently) in 250 uL of lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630) with 50 uL protease inhibitors (Sigma P8340). Cell suspension was incubated on ice for 15 minutes and pelleted. Pelleted nuclei were washed once in lysis buffer (resuspension and spin), then resuspended and incubated in 50 uL of 0.5% SDS at 62oC for 10 min. SDS was inactivated via the addition of 145 uL H2O, 25 uL 10% Triton X-100, and incubation at 37oC for 15 min. Subsequently, chromatin was digested overnight at 37oC with the addition of 25 uL 10X NEBuffer2 and 100U (5 uL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62oC to inactivate the HindIII. Chromatin was re-ligated via the addition of 100 uL 10% Triton X-100, 120 uL NEB T4 DNA Ligation buffer (NEB B0202S), 12 uL 10 mg/mL BSA, 718 uL H2O, and 2000 U (5 uL) of T4 DNA Ligase (NEB M0202S) and incubation at 16oC for 2 hours (NOTE: This is a deviation from in situ HiC (Rao et al. 2010) in order to promote sticky-end ligation over blunt-end). Following ligation nuclei were pelleted, resuspended in 300 uL of 10 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 1% SDS, plus 25 uL of 20 mg/mL proteinase K (NEB P8107), and incubated at 65oC for 4 hours at which point an additional 25 uL of proteinase K was added and incubated overnight. 3C templates were isolated next day via RNaseA treatment, phenol-chloroform extraction, ethanol precipitation, and Amicon filtration (Millipore MFC5030BKS) (for more details see Beagan et al. 2016). Template size distribution and quantity were assessed with a 0.8% agarose gel. 5C primers were designed according to the double-alternating design scheme using the My5C primer design software (http://my5c.umassmed.edu/my5Cprimers/5C.php)10 with universal “Emulsion” primer tails. Regions were designed to capture TAD structures immediately surrounding the genes of interest (Bdnf, Fos, Arc, Neurexin-1, Neuroligin-3, Synaptotagmin-1) in published mouse cortex HiC data. 5C reactions were carried out as previously described. 600 ng (~200,000 genome copies) of 3C template for each replicate was mixed with 1 fmole of each</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>303759957</ID>
          <LABEL>GSM3759957</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM3759958" accession="SRX5818728">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX5818728</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM3759958</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM3759958: TTX 5C Rep 3; Mus musculus; OTHER</TITLE>
    <STUDY_REF accession="SRP197612" refname="GSE131025">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS4747480">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS4747480</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM3759958</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>OTHER</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>GENOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>other</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>RNA-seq: At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. RNA-seq:We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library. ChIP-seq: At DIV16, neuronal cultures were fixed in 1% formaldehyde for 10 minutes (room temp) via the addition (1:10 vol/vol) of the following fixation solution: 50 mM Hepes-KOH (pH 7.5), 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 11% Formaldehyde. Fixation was quenched via the addition of 2.5 M glycine (1:20 vol/vol) and scraped into pellets of 8 million cells. Each pellet was washed once with cold PBS, flash frozen, and stored at -80oC. Immunoprecipitation was performed as described previously (Beagan et al., 2016) with slight modifications. Briefly, IP reactions were prepared a day prior to cell lysis by combining 20 uL of protein A and protein G conjugated agarose beads (Invitrogen# 15918-014 and 15920-010, respectively) with 10 uL of anti-H3K27ac antibody (Abcam# ab4729) in 1 mL of cold PBS and rotated overnight. The next day cell pellets were resuspended in 1 mL lysis buffer (10 mM Tris pH 8.0, 10 mM NaCl, 0.2% NP-40/Igepal, Protease Inhibitor, PMSF) and incubated on ice for 10 min. Cells were further lysed with 30 strokes of a dounce homogenizer (pestle A) and then nuclei were pelleted. Nuclei were lysed on ice in 50 mM Tris pH 8.0, 10 mM EDTA, 1% SDS, Protease Inhibitor, PMSF for 20 min. SDS concentration was reduced before sonication by the addition of 300 uL IP Dilution Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 150 mM NaCl, 1% Triston X-100, 0.01% SDS, Protease Inhibitor, PMSF), after which samples were sonicated for 60 minutes (30 seconds on, 30 seconds off cycle, 100% amplitude) using a Qsonica Q800R2 Sonicator. Insoluble fractions were removed via spin, and the supernatant was removed of non-specific binding chromatin via rotation with preclearing solution (3.7 mL IP Dilution Buffer, 0.5 mL Nuclear Lysis Buffer, 175 uL of Agarose Protein A/G beads, and 50 ug Rabbit IgG) for 2 hours at 4°C. Beads were pelleted and 4.7 mL of supernatant was removed. 200 uL of supernatant was retained as input control (stored at -20°C) while the remaining 4.5 mL was transferred to the beads that had been pre-bound with the H3K27ac antibody overnight; the IP reaction then rotated overnight again at 4°C. Bound bead complexes were washed once with 1 mL IP Wash Buffer 1 (20 mM Tris pH 8.0, 2 mM EDTA, 50 mM NaCl, 1% Triton X-100, 0.1% SDS), twice with 1 mL High-Salt Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 500 mM NaCl, 1% Triton X-100, 0.01% SDS), once with IP Wash Buffer 2 (10 mM Tris pH 8.0, 1 mM EDTA, 0.25 M LiCl, 1% NP-40/Igepal, 1% Na-deoxycholate), and finally twice with 1x TE. Complexes were eluted by twice resuspending bound beads in 110 uL Elution Buffer (100 mM NaHCO3, 1% SDS), pelleting the beads after each elution and transferring 100 uL supernatant to a new tube. Finally, 12 uL of 5M NaCl and 20 ug RNase A were added to both 200 uL IP and input samples and incubated at 65 degrees for 1 hour, followed by the addition of 60 ug of Proteinase K and overnight incubation at 65 degrees. DNA was isolated via phenol-chloroform extraction and ethanol precipitation and concentration was quantified using Qubit fluorometer. ChIP-seq libraries were prepared for sequencing using the NEBNext Ultra II DNA Library Prep Kit (NEB# E7645S), following manufacturer's protocol with the following user-chosen specifications. 3 ng DNA from all IP and input samples was used as starting material. NEBNext Adaptors were diluted 15x in 10 mM Tris-HCL, pH 8.0 with 10 mM NaCl prior to adaptor ligation. Large DNA fragments were removed via a size selection by adding 15 uL of AMPure XP beads at the first bead addition step and 87 uL of beads at the second bead addition step. Size-selected DNA was amplified using 9 cycles of PCR enrichment. The size-range of the final libraries was confirmed to be between 200-1000 bp using an Agilent Bioanalyzer High Sensitivity DNA test. H3K27ac enrichment was confirmed prior to sequencing by querying the IP/input qPCR enrichment of primer pairs designed to the Arc, Synaptotagmin-1, and Tcf25 promoter regions. Library concentrations were calculated and normalized using the KAPA Illumina Library Quantification Kit (#KK4835) so that libraries could be equally pooled before sequencing 75 bp single-end reads on the NextSeq500. All IP libraries were sequenced to a depth greater than 48 million reads and all input libraries were sequenced to greater than 67 million reads. 5C-seq: Neuronal cultures were formaldehyde fixed as described for ChIP-seq and stored at -80oC. For each condition (Bic, Untreat, TTX), in situ 3C was performed on 4 replicates (divided evenly across two animal/culture batches) of 4-5 million cells. Briefly, cells were thawed on ice and resuspended (gently) in 250 uL of lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630) with 50 uL protease inhibitors (Sigma P8340). Cell suspension was incubated on ice for 15 minutes and pelleted. Pelleted nuclei were washed once in lysis buffer (resuspension and spin), then resuspended and incubated in 50 uL of 0.5% SDS at 62oC for 10 min. SDS was inactivated via the addition of 145 uL H2O, 25 uL 10% Triton X-100, and incubation at 37oC for 15 min. Subsequently, chromatin was digested overnight at 37oC with the addition of 25 uL 10X NEBuffer2 and 100U (5 uL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62oC to inactivate the HindIII. Chromatin was re-ligated via the addition of 100 uL 10% Triton X-100, 120 uL NEB T4 DNA Ligation buffer (NEB B0202S), 12 uL 10 mg/mL BSA, 718 uL H2O, and 2000 U (5 uL) of T4 DNA Ligase (NEB M0202S) and incubation at 16oC for 2 hours (NOTE: This is a deviation from in situ HiC (Rao et al. 2010) in order to promote sticky-end ligation over blunt-end). Following ligation nuclei were pelleted, resuspended in 300 uL of 10 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 1% SDS, plus 25 uL of 20 mg/mL proteinase K (NEB P8107), and incubated at 65oC for 4 hours at which point an additional 25 uL of proteinase K was added and incubated overnight. 3C templates were isolated next day via RNaseA treatment, phenol-chloroform extraction, ethanol precipitation, and Amicon filtration (Millipore MFC5030BKS) (for more details see Beagan et al. 2016). Template size distribution and quantity were assessed with a 0.8% agarose gel. 5C primers were designed according to the double-alternating design scheme using the My5C primer design software (http://my5c.umassmed.edu/my5Cprimers/5C.php)10 with universal “Emulsion” primer tails. Regions were designed to capture TAD structures immediately surrounding the genes of interest (Bdnf, Fos, Arc, Neurexin-1, Neuroligin-3, Synaptotagmin-1) in published mouse cortex HiC data. 5C reactions were carried out as previously described. 600 ng (~200,000 genome copies) of 3C template for each replicate was mixed with 1 fmole of each</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>303759958</ID>
          <LABEL>GSM3759958</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM3759959" accession="SRX5818729">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX5818729</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM3759959</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM3759959: TTX 5C Rep 4; Mus musculus; OTHER</TITLE>
    <STUDY_REF accession="SRP197612" refname="GSE131025">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS4747481">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS4747481</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM3759959</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>OTHER</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>GENOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>other</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>RNA-seq: At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. RNA-seq:We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library. ChIP-seq: At DIV16, neuronal cultures were fixed in 1% formaldehyde for 10 minutes (room temp) via the addition (1:10 vol/vol) of the following fixation solution: 50 mM Hepes-KOH (pH 7.5), 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 11% Formaldehyde. Fixation was quenched via the addition of 2.5 M glycine (1:20 vol/vol) and scraped into pellets of 8 million cells. Each pellet was washed once with cold PBS, flash frozen, and stored at -80oC. Immunoprecipitation was performed as described previously (Beagan et al., 2016) with slight modifications. Briefly, IP reactions were prepared a day prior to cell lysis by combining 20 uL of protein A and protein G conjugated agarose beads (Invitrogen# 15918-014 and 15920-010, respectively) with 10 uL of anti-H3K27ac antibody (Abcam# ab4729) in 1 mL of cold PBS and rotated overnight. The next day cell pellets were resuspended in 1 mL lysis buffer (10 mM Tris pH 8.0, 10 mM NaCl, 0.2% NP-40/Igepal, Protease Inhibitor, PMSF) and incubated on ice for 10 min. Cells were further lysed with 30 strokes of a dounce homogenizer (pestle A) and then nuclei were pelleted. Nuclei were lysed on ice in 50 mM Tris pH 8.0, 10 mM EDTA, 1% SDS, Protease Inhibitor, PMSF for 20 min. SDS concentration was reduced before sonication by the addition of 300 uL IP Dilution Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 150 mM NaCl, 1% Triston X-100, 0.01% SDS, Protease Inhibitor, PMSF), after which samples were sonicated for 60 minutes (30 seconds on, 30 seconds off cycle, 100% amplitude) using a Qsonica Q800R2 Sonicator. Insoluble fractions were removed via spin, and the supernatant was removed of non-specific binding chromatin via rotation with preclearing solution (3.7 mL IP Dilution Buffer, 0.5 mL Nuclear Lysis Buffer, 175 uL of Agarose Protein A/G beads, and 50 ug Rabbit IgG) for 2 hours at 4°C. Beads were pelleted and 4.7 mL of supernatant was removed. 200 uL of supernatant was retained as input control (stored at -20°C) while the remaining 4.5 mL was transferred to the beads that had been pre-bound with the H3K27ac antibody overnight; the IP reaction then rotated overnight again at 4°C. Bound bead complexes were washed once with 1 mL IP Wash Buffer 1 (20 mM Tris pH 8.0, 2 mM EDTA, 50 mM NaCl, 1% Triton X-100, 0.1% SDS), twice with 1 mL High-Salt Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 500 mM NaCl, 1% Triton X-100, 0.01% SDS), once with IP Wash Buffer 2 (10 mM Tris pH 8.0, 1 mM EDTA, 0.25 M LiCl, 1% NP-40/Igepal, 1% Na-deoxycholate), and finally twice with 1x TE. Complexes were eluted by twice resuspending bound beads in 110 uL Elution Buffer (100 mM NaHCO3, 1% SDS), pelleting the beads after each elution and transferring 100 uL supernatant to a new tube. Finally, 12 uL of 5M NaCl and 20 ug RNase A were added to both 200 uL IP and input samples and incubated at 65 degrees for 1 hour, followed by the addition of 60 ug of Proteinase K and overnight incubation at 65 degrees. DNA was isolated via phenol-chloroform extraction and ethanol precipitation and concentration was quantified using Qubit fluorometer. ChIP-seq libraries were prepared for sequencing using the NEBNext Ultra II DNA Library Prep Kit (NEB# E7645S), following manufacturer's protocol with the following user-chosen specifications. 3 ng DNA from all IP and input samples was used as starting material. NEBNext Adaptors were diluted 15x in 10 mM Tris-HCL, pH 8.0 with 10 mM NaCl prior to adaptor ligation. Large DNA fragments were removed via a size selection by adding 15 uL of AMPure XP beads at the first bead addition step and 87 uL of beads at the second bead addition step. Size-selected DNA was amplified using 9 cycles of PCR enrichment. The size-range of the final libraries was confirmed to be between 200-1000 bp using an Agilent Bioanalyzer High Sensitivity DNA test. H3K27ac enrichment was confirmed prior to sequencing by querying the IP/input qPCR enrichment of primer pairs designed to the Arc, Synaptotagmin-1, and Tcf25 promoter regions. Library concentrations were calculated and normalized using the KAPA Illumina Library Quantification Kit (#KK4835) so that libraries could be equally pooled before sequencing 75 bp single-end reads on the NextSeq500. All IP libraries were sequenced to a depth greater than 48 million reads and all input libraries were sequenced to greater than 67 million reads. 5C-seq: Neuronal cultures were formaldehyde fixed as described for ChIP-seq and stored at -80oC. For each condition (Bic, Untreat, TTX), in situ 3C was performed on 4 replicates (divided evenly across two animal/culture batches) of 4-5 million cells. Briefly, cells were thawed on ice and resuspended (gently) in 250 uL of lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630) with 50 uL protease inhibitors (Sigma P8340). Cell suspension was incubated on ice for 15 minutes and pelleted. Pelleted nuclei were washed once in lysis buffer (resuspension and spin), then resuspended and incubated in 50 uL of 0.5% SDS at 62oC for 10 min. SDS was inactivated via the addition of 145 uL H2O, 25 uL 10% Triton X-100, and incubation at 37oC for 15 min. Subsequently, chromatin was digested overnight at 37oC with the addition of 25 uL 10X NEBuffer2 and 100U (5 uL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62oC to inactivate the HindIII. Chromatin was re-ligated via the addition of 100 uL 10% Triton X-100, 120 uL NEB T4 DNA Ligation buffer (NEB B0202S), 12 uL 10 mg/mL BSA, 718 uL H2O, and 2000 U (5 uL) of T4 DNA Ligase (NEB M0202S) and incubation at 16oC for 2 hours (NOTE: This is a deviation from in situ HiC (Rao et al. 2010) in order to promote sticky-end ligation over blunt-end). Following ligation nuclei were pelleted, resuspended in 300 uL of 10 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 1% SDS, plus 25 uL of 20 mg/mL proteinase K (NEB P8107), and incubated at 65oC for 4 hours at which point an additional 25 uL of proteinase K was added and incubated overnight. 3C templates were isolated next day via RNaseA treatment, phenol-chloroform extraction, ethanol precipitation, and Amicon filtration (Millipore MFC5030BKS) (for more details see Beagan et al. 2016). Template size distribution and quantity were assessed with a 0.8% agarose gel. 5C primers were designed according to the double-alternating design scheme using the My5C primer design software (http://my5c.umassmed.edu/my5Cprimers/5C.php)10 with universal “Emulsion” primer tails. Regions were designed to capture TAD structures immediately surrounding the genes of interest (Bdnf, Fos, Arc, Neurexin-1, Neuroligin-3, Synaptotagmin-1) in published mouse cortex HiC data. 5C reactions were carried out as previously described. 600 ng (~200,000 genome copies) of 3C template for each replicate was mixed with 1 fmole of each</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>303759959</ID>
          <LABEL>GSM3759959</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM3759960" accession="SRX5818730">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX5818730</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM3759960</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM3759960: Untreat 5C Rep1; Mus musculus; OTHER</TITLE>
    <STUDY_REF accession="SRP197612" refname="GSE131025">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS4747482">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS4747482</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM3759960</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>OTHER</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>GENOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>other</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>RNA-seq: At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. RNA-seq:We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library. ChIP-seq: At DIV16, neuronal cultures were fixed in 1% formaldehyde for 10 minutes (room temp) via the addition (1:10 vol/vol) of the following fixation solution: 50 mM Hepes-KOH (pH 7.5), 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 11% Formaldehyde. Fixation was quenched via the addition of 2.5 M glycine (1:20 vol/vol) and scraped into pellets of 8 million cells. Each pellet was washed once with cold PBS, flash frozen, and stored at -80oC. Immunoprecipitation was performed as described previously (Beagan et al., 2016) with slight modifications. Briefly, IP reactions were prepared a day prior to cell lysis by combining 20 uL of protein A and protein G conjugated agarose beads (Invitrogen# 15918-014 and 15920-010, respectively) with 10 uL of anti-H3K27ac antibody (Abcam# ab4729) in 1 mL of cold PBS and rotated overnight. The next day cell pellets were resuspended in 1 mL lysis buffer (10 mM Tris pH 8.0, 10 mM NaCl, 0.2% NP-40/Igepal, Protease Inhibitor, PMSF) and incubated on ice for 10 min. Cells were further lysed with 30 strokes of a dounce homogenizer (pestle A) and then nuclei were pelleted. Nuclei were lysed on ice in 50 mM Tris pH 8.0, 10 mM EDTA, 1% SDS, Protease Inhibitor, PMSF for 20 min. SDS concentration was reduced before sonication by the addition of 300 uL IP Dilution Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 150 mM NaCl, 1% Triston X-100, 0.01% SDS, Protease Inhibitor, PMSF), after which samples were sonicated for 60 minutes (30 seconds on, 30 seconds off cycle, 100% amplitude) using a Qsonica Q800R2 Sonicator. Insoluble fractions were removed via spin, and the supernatant was removed of non-specific binding chromatin via rotation with preclearing solution (3.7 mL IP Dilution Buffer, 0.5 mL Nuclear Lysis Buffer, 175 uL of Agarose Protein A/G beads, and 50 ug Rabbit IgG) for 2 hours at 4°C. Beads were pelleted and 4.7 mL of supernatant was removed. 200 uL of supernatant was retained as input control (stored at -20°C) while the remaining 4.5 mL was transferred to the beads that had been pre-bound with the H3K27ac antibody overnight; the IP reaction then rotated overnight again at 4°C. Bound bead complexes were washed once with 1 mL IP Wash Buffer 1 (20 mM Tris pH 8.0, 2 mM EDTA, 50 mM NaCl, 1% Triton X-100, 0.1% SDS), twice with 1 mL High-Salt Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 500 mM NaCl, 1% Triton X-100, 0.01% SDS), once with IP Wash Buffer 2 (10 mM Tris pH 8.0, 1 mM EDTA, 0.25 M LiCl, 1% NP-40/Igepal, 1% Na-deoxycholate), and finally twice with 1x TE. Complexes were eluted by twice resuspending bound beads in 110 uL Elution Buffer (100 mM NaHCO3, 1% SDS), pelleting the beads after each elution and transferring 100 uL supernatant to a new tube. Finally, 12 uL of 5M NaCl and 20 ug RNase A were added to both 200 uL IP and input samples and incubated at 65 degrees for 1 hour, followed by the addition of 60 ug of Proteinase K and overnight incubation at 65 degrees. DNA was isolated via phenol-chloroform extraction and ethanol precipitation and concentration was quantified using Qubit fluorometer. ChIP-seq libraries were prepared for sequencing using the NEBNext Ultra II DNA Library Prep Kit (NEB# E7645S), following manufacturer's protocol with the following user-chosen specifications. 3 ng DNA from all IP and input samples was used as starting material. NEBNext Adaptors were diluted 15x in 10 mM Tris-HCL, pH 8.0 with 10 mM NaCl prior to adaptor ligation. Large DNA fragments were removed via a size selection by adding 15 uL of AMPure XP beads at the first bead addition step and 87 uL of beads at the second bead addition step. Size-selected DNA was amplified using 9 cycles of PCR enrichment. The size-range of the final libraries was confirmed to be between 200-1000 bp using an Agilent Bioanalyzer High Sensitivity DNA test. H3K27ac enrichment was confirmed prior to sequencing by querying the IP/input qPCR enrichment of primer pairs designed to the Arc, Synaptotagmin-1, and Tcf25 promoter regions. Library concentrations were calculated and normalized using the KAPA Illumina Library Quantification Kit (#KK4835) so that libraries could be equally pooled before sequencing 75 bp single-end reads on the NextSeq500. All IP libraries were sequenced to a depth greater than 48 million reads and all input libraries were sequenced to greater than 67 million reads. 5C-seq: Neuronal cultures were formaldehyde fixed as described for ChIP-seq and stored at -80oC. For each condition (Bic, Untreat, TTX), in situ 3C was performed on 4 replicates (divided evenly across two animal/culture batches) of 4-5 million cells. Briefly, cells were thawed on ice and resuspended (gently) in 250 uL of lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630) with 50 uL protease inhibitors (Sigma P8340). Cell suspension was incubated on ice for 15 minutes and pelleted. Pelleted nuclei were washed once in lysis buffer (resuspension and spin), then resuspended and incubated in 50 uL of 0.5% SDS at 62oC for 10 min. SDS was inactivated via the addition of 145 uL H2O, 25 uL 10% Triton X-100, and incubation at 37oC for 15 min. Subsequently, chromatin was digested overnight at 37oC with the addition of 25 uL 10X NEBuffer2 and 100U (5 uL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62oC to inactivate the HindIII. Chromatin was re-ligated via the addition of 100 uL 10% Triton X-100, 120 uL NEB T4 DNA Ligation buffer (NEB B0202S), 12 uL 10 mg/mL BSA, 718 uL H2O, and 2000 U (5 uL) of T4 DNA Ligase (NEB M0202S) and incubation at 16oC for 2 hours (NOTE: This is a deviation from in situ HiC (Rao et al. 2010) in order to promote sticky-end ligation over blunt-end). Following ligation nuclei were pelleted, resuspended in 300 uL of 10 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 1% SDS, plus 25 uL of 20 mg/mL proteinase K (NEB P8107), and incubated at 65oC for 4 hours at which point an additional 25 uL of proteinase K was added and incubated overnight. 3C templates were isolated next day via RNaseA treatment, phenol-chloroform extraction, ethanol precipitation, and Amicon filtration (Millipore MFC5030BKS) (for more details see Beagan et al. 2016). Template size distribution and quantity were assessed with a 0.8% agarose gel. 5C primers were designed according to the double-alternating design scheme using the My5C primer design software (http://my5c.umassmed.edu/my5Cprimers/5C.php)10 with universal “Emulsion” primer tails. Regions were designed to capture TAD structures immediately surrounding the genes of interest (Bdnf, Fos, Arc, Neurexin-1, Neuroligin-3, Synaptotagmin-1) in published mouse cortex HiC data. 5C reactions were carried out as previously described. 600 ng (~200,000 genome copies) of 3C template for each replicate was mixed with 1 fmole of each</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>303759960</ID>
          <LABEL>GSM3759960</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM3759961" accession="SRX5818731">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX5818731</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM3759961</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM3759961: Untreat 5C Rep2; Mus musculus; OTHER</TITLE>
    <STUDY_REF accession="SRP197612" refname="GSE131025">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS4747483">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS4747483</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM3759961</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>OTHER</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>GENOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>other</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>RNA-seq: At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. RNA-seq:We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library. ChIP-seq: At DIV16, neuronal cultures were fixed in 1% formaldehyde for 10 minutes (room temp) via the addition (1:10 vol/vol) of the following fixation solution: 50 mM Hepes-KOH (pH 7.5), 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 11% Formaldehyde. Fixation was quenched via the addition of 2.5 M glycine (1:20 vol/vol) and scraped into pellets of 8 million cells. Each pellet was washed once with cold PBS, flash frozen, and stored at -80oC. Immunoprecipitation was performed as described previously (Beagan et al., 2016) with slight modifications. Briefly, IP reactions were prepared a day prior to cell lysis by combining 20 uL of protein A and protein G conjugated agarose beads (Invitrogen# 15918-014 and 15920-010, respectively) with 10 uL of anti-H3K27ac antibody (Abcam# ab4729) in 1 mL of cold PBS and rotated overnight. The next day cell pellets were resuspended in 1 mL lysis buffer (10 mM Tris pH 8.0, 10 mM NaCl, 0.2% NP-40/Igepal, Protease Inhibitor, PMSF) and incubated on ice for 10 min. Cells were further lysed with 30 strokes of a dounce homogenizer (pestle A) and then nuclei were pelleted. Nuclei were lysed on ice in 50 mM Tris pH 8.0, 10 mM EDTA, 1% SDS, Protease Inhibitor, PMSF for 20 min. SDS concentration was reduced before sonication by the addition of 300 uL IP Dilution Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 150 mM NaCl, 1% Triston X-100, 0.01% SDS, Protease Inhibitor, PMSF), after which samples were sonicated for 60 minutes (30 seconds on, 30 seconds off cycle, 100% amplitude) using a Qsonica Q800R2 Sonicator. Insoluble fractions were removed via spin, and the supernatant was removed of non-specific binding chromatin via rotation with preclearing solution (3.7 mL IP Dilution Buffer, 0.5 mL Nuclear Lysis Buffer, 175 uL of Agarose Protein A/G beads, and 50 ug Rabbit IgG) for 2 hours at 4°C. Beads were pelleted and 4.7 mL of supernatant was removed. 200 uL of supernatant was retained as input control (stored at -20°C) while the remaining 4.5 mL was transferred to the beads that had been pre-bound with the H3K27ac antibody overnight; the IP reaction then rotated overnight again at 4°C. Bound bead complexes were washed once with 1 mL IP Wash Buffer 1 (20 mM Tris pH 8.0, 2 mM EDTA, 50 mM NaCl, 1% Triton X-100, 0.1% SDS), twice with 1 mL High-Salt Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 500 mM NaCl, 1% Triton X-100, 0.01% SDS), once with IP Wash Buffer 2 (10 mM Tris pH 8.0, 1 mM EDTA, 0.25 M LiCl, 1% NP-40/Igepal, 1% Na-deoxycholate), and finally twice with 1x TE. Complexes were eluted by twice resuspending bound beads in 110 uL Elution Buffer (100 mM NaHCO3, 1% SDS), pelleting the beads after each elution and transferring 100 uL supernatant to a new tube. Finally, 12 uL of 5M NaCl and 20 ug RNase A were added to both 200 uL IP and input samples and incubated at 65 degrees for 1 hour, followed by the addition of 60 ug of Proteinase K and overnight incubation at 65 degrees. DNA was isolated via phenol-chloroform extraction and ethanol precipitation and concentration was quantified using Qubit fluorometer. ChIP-seq libraries were prepared for sequencing using the NEBNext Ultra II DNA Library Prep Kit (NEB# E7645S), following manufacturer's protocol with the following user-chosen specifications. 3 ng DNA from all IP and input samples was used as starting material. NEBNext Adaptors were diluted 15x in 10 mM Tris-HCL, pH 8.0 with 10 mM NaCl prior to adaptor ligation. Large DNA fragments were removed via a size selection by adding 15 uL of AMPure XP beads at the first bead addition step and 87 uL of beads at the second bead addition step. Size-selected DNA was amplified using 9 cycles of PCR enrichment. The size-range of the final libraries was confirmed to be between 200-1000 bp using an Agilent Bioanalyzer High Sensitivity DNA test. H3K27ac enrichment was confirmed prior to sequencing by querying the IP/input qPCR enrichment of primer pairs designed to the Arc, Synaptotagmin-1, and Tcf25 promoter regions. Library concentrations were calculated and normalized using the KAPA Illumina Library Quantification Kit (#KK4835) so that libraries could be equally pooled before sequencing 75 bp single-end reads on the NextSeq500. All IP libraries were sequenced to a depth greater than 48 million reads and all input libraries were sequenced to greater than 67 million reads. 5C-seq: Neuronal cultures were formaldehyde fixed as described for ChIP-seq and stored at -80oC. For each condition (Bic, Untreat, TTX), in situ 3C was performed on 4 replicates (divided evenly across two animal/culture batches) of 4-5 million cells. Briefly, cells were thawed on ice and resuspended (gently) in 250 uL of lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630) with 50 uL protease inhibitors (Sigma P8340). Cell suspension was incubated on ice for 15 minutes and pelleted. Pelleted nuclei were washed once in lysis buffer (resuspension and spin), then resuspended and incubated in 50 uL of 0.5% SDS at 62oC for 10 min. SDS was inactivated via the addition of 145 uL H2O, 25 uL 10% Triton X-100, and incubation at 37oC for 15 min. Subsequently, chromatin was digested overnight at 37oC with the addition of 25 uL 10X NEBuffer2 and 100U (5 uL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62oC to inactivate the HindIII. Chromatin was re-ligated via the addition of 100 uL 10% Triton X-100, 120 uL NEB T4 DNA Ligation buffer (NEB B0202S), 12 uL 10 mg/mL BSA, 718 uL H2O, and 2000 U (5 uL) of T4 DNA Ligase (NEB M0202S) and incubation at 16oC for 2 hours (NOTE: This is a deviation from in situ HiC (Rao et al. 2010) in order to promote sticky-end ligation over blunt-end). Following ligation nuclei were pelleted, resuspended in 300 uL of 10 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 1% SDS, plus 25 uL of 20 mg/mL proteinase K (NEB P8107), and incubated at 65oC for 4 hours at which point an additional 25 uL of proteinase K was added and incubated overnight. 3C templates were isolated next day via RNaseA treatment, phenol-chloroform extraction, ethanol precipitation, and Amicon filtration (Millipore MFC5030BKS) (for more details see Beagan et al. 2016). Template size distribution and quantity were assessed with a 0.8% agarose gel. 5C primers were designed according to the double-alternating design scheme using the My5C primer design software (http://my5c.umassmed.edu/my5Cprimers/5C.php)10 with universal “Emulsion” primer tails. Regions were designed to capture TAD structures immediately surrounding the genes of interest (Bdnf, Fos, Arc, Neurexin-1, Neuroligin-3, Synaptotagmin-1) in published mouse cortex HiC data. 5C reactions were carried out as previously described. 600 ng (~200,000 genome copies) of 3C template for each replicate was mixed with 1 fmole of each</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>303759961</ID>
          <LABEL>GSM3759961</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM3759962" accession="SRX5818732">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX5818732</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM3759962</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM3759962: Untreat 5C Rep3; Mus musculus; OTHER</TITLE>
    <STUDY_REF accession="SRP197612" refname="GSE131025">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS4747484">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS4747484</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM3759962</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>OTHER</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>GENOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>other</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>RNA-seq: At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. RNA-seq:We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library. ChIP-seq: At DIV16, neuronal cultures were fixed in 1% formaldehyde for 10 minutes (room temp) via the addition (1:10 vol/vol) of the following fixation solution: 50 mM Hepes-KOH (pH 7.5), 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 11% Formaldehyde. Fixation was quenched via the addition of 2.5 M glycine (1:20 vol/vol) and scraped into pellets of 8 million cells. Each pellet was washed once with cold PBS, flash frozen, and stored at -80oC. Immunoprecipitation was performed as described previously (Beagan et al., 2016) with slight modifications. Briefly, IP reactions were prepared a day prior to cell lysis by combining 20 uL of protein A and protein G conjugated agarose beads (Invitrogen# 15918-014 and 15920-010, respectively) with 10 uL of anti-H3K27ac antibody (Abcam# ab4729) in 1 mL of cold PBS and rotated overnight. The next day cell pellets were resuspended in 1 mL lysis buffer (10 mM Tris pH 8.0, 10 mM NaCl, 0.2% NP-40/Igepal, Protease Inhibitor, PMSF) and incubated on ice for 10 min. Cells were further lysed with 30 strokes of a dounce homogenizer (pestle A) and then nuclei were pelleted. Nuclei were lysed on ice in 50 mM Tris pH 8.0, 10 mM EDTA, 1% SDS, Protease Inhibitor, PMSF for 20 min. SDS concentration was reduced before sonication by the addition of 300 uL IP Dilution Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 150 mM NaCl, 1% Triston X-100, 0.01% SDS, Protease Inhibitor, PMSF), after which samples were sonicated for 60 minutes (30 seconds on, 30 seconds off cycle, 100% amplitude) using a Qsonica Q800R2 Sonicator. Insoluble fractions were removed via spin, and the supernatant was removed of non-specific binding chromatin via rotation with preclearing solution (3.7 mL IP Dilution Buffer, 0.5 mL Nuclear Lysis Buffer, 175 uL of Agarose Protein A/G beads, and 50 ug Rabbit IgG) for 2 hours at 4°C. Beads were pelleted and 4.7 mL of supernatant was removed. 200 uL of supernatant was retained as input control (stored at -20°C) while the remaining 4.5 mL was transferred to the beads that had been pre-bound with the H3K27ac antibody overnight; the IP reaction then rotated overnight again at 4°C. Bound bead complexes were washed once with 1 mL IP Wash Buffer 1 (20 mM Tris pH 8.0, 2 mM EDTA, 50 mM NaCl, 1% Triton X-100, 0.1% SDS), twice with 1 mL High-Salt Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 500 mM NaCl, 1% Triton X-100, 0.01% SDS), once with IP Wash Buffer 2 (10 mM Tris pH 8.0, 1 mM EDTA, 0.25 M LiCl, 1% NP-40/Igepal, 1% Na-deoxycholate), and finally twice with 1x TE. Complexes were eluted by twice resuspending bound beads in 110 uL Elution Buffer (100 mM NaHCO3, 1% SDS), pelleting the beads after each elution and transferring 100 uL supernatant to a new tube. Finally, 12 uL of 5M NaCl and 20 ug RNase A were added to both 200 uL IP and input samples and incubated at 65 degrees for 1 hour, followed by the addition of 60 ug of Proteinase K and overnight incubation at 65 degrees. DNA was isolated via phenol-chloroform extraction and ethanol precipitation and concentration was quantified using Qubit fluorometer. ChIP-seq libraries were prepared for sequencing using the NEBNext Ultra II DNA Library Prep Kit (NEB# E7645S), following manufacturer's protocol with the following user-chosen specifications. 3 ng DNA from all IP and input samples was used as starting material. NEBNext Adaptors were diluted 15x in 10 mM Tris-HCL, pH 8.0 with 10 mM NaCl prior to adaptor ligation. Large DNA fragments were removed via a size selection by adding 15 uL of AMPure XP beads at the first bead addition step and 87 uL of beads at the second bead addition step. Size-selected DNA was amplified using 9 cycles of PCR enrichment. The size-range of the final libraries was confirmed to be between 200-1000 bp using an Agilent Bioanalyzer High Sensitivity DNA test. H3K27ac enrichment was confirmed prior to sequencing by querying the IP/input qPCR enrichment of primer pairs designed to the Arc, Synaptotagmin-1, and Tcf25 promoter regions. Library concentrations were calculated and normalized using the KAPA Illumina Library Quantification Kit (#KK4835) so that libraries could be equally pooled before sequencing 75 bp single-end reads on the NextSeq500. All IP libraries were sequenced to a depth greater than 48 million reads and all input libraries were sequenced to greater than 67 million reads. 5C-seq: Neuronal cultures were formaldehyde fixed as described for ChIP-seq and stored at -80oC. For each condition (Bic, Untreat, TTX), in situ 3C was performed on 4 replicates (divided evenly across two animal/culture batches) of 4-5 million cells. Briefly, cells were thawed on ice and resuspended (gently) in 250 uL of lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630) with 50 uL protease inhibitors (Sigma P8340). Cell suspension was incubated on ice for 15 minutes and pelleted. Pelleted nuclei were washed once in lysis buffer (resuspension and spin), then resuspended and incubated in 50 uL of 0.5% SDS at 62oC for 10 min. SDS was inactivated via the addition of 145 uL H2O, 25 uL 10% Triton X-100, and incubation at 37oC for 15 min. Subsequently, chromatin was digested overnight at 37oC with the addition of 25 uL 10X NEBuffer2 and 100U (5 uL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62oC to inactivate the HindIII. Chromatin was re-ligated via the addition of 100 uL 10% Triton X-100, 120 uL NEB T4 DNA Ligation buffer (NEB B0202S), 12 uL 10 mg/mL BSA, 718 uL H2O, and 2000 U (5 uL) of T4 DNA Ligase (NEB M0202S) and incubation at 16oC for 2 hours (NOTE: This is a deviation from in situ HiC (Rao et al. 2010) in order to promote sticky-end ligation over blunt-end). Following ligation nuclei were pelleted, resuspended in 300 uL of 10 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 1% SDS, plus 25 uL of 20 mg/mL proteinase K (NEB P8107), and incubated at 65oC for 4 hours at which point an additional 25 uL of proteinase K was added and incubated overnight. 3C templates were isolated next day via RNaseA treatment, phenol-chloroform extraction, ethanol precipitation, and Amicon filtration (Millipore MFC5030BKS) (for more details see Beagan et al. 2016). Template size distribution and quantity were assessed with a 0.8% agarose gel. 5C primers were designed according to the double-alternating design scheme using the My5C primer design software (http://my5c.umassmed.edu/my5Cprimers/5C.php)10 with universal “Emulsion” primer tails. Regions were designed to capture TAD structures immediately surrounding the genes of interest (Bdnf, Fos, Arc, Neurexin-1, Neuroligin-3, Synaptotagmin-1) in published mouse cortex HiC data. 5C reactions were carried out as previously described. 600 ng (~200,000 genome copies) of 3C template for each replicate was mixed with 1 fmole of each</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>303759962</ID>
          <LABEL>GSM3759962</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM3759963" accession="SRX5818733">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX5818733</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM3759963</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM3759963: Untreat 5C Rep4; Mus musculus; OTHER</TITLE>
    <STUDY_REF accession="SRP197612" refname="GSE131025">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS4747485">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS4747485</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM3759963</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>OTHER</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>GENOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>other</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>RNA-seq: At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. RNA-seq:We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library. ChIP-seq: At DIV16, neuronal cultures were fixed in 1% formaldehyde for 10 minutes (room temp) via the addition (1:10 vol/vol) of the following fixation solution: 50 mM Hepes-KOH (pH 7.5), 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 11% Formaldehyde. Fixation was quenched via the addition of 2.5 M glycine (1:20 vol/vol) and scraped into pellets of 8 million cells. Each pellet was washed once with cold PBS, flash frozen, and stored at -80oC. Immunoprecipitation was performed as described previously (Beagan et al., 2016) with slight modifications. Briefly, IP reactions were prepared a day prior to cell lysis by combining 20 uL of protein A and protein G conjugated agarose beads (Invitrogen# 15918-014 and 15920-010, respectively) with 10 uL of anti-H3K27ac antibody (Abcam# ab4729) in 1 mL of cold PBS and rotated overnight. The next day cell pellets were resuspended in 1 mL lysis buffer (10 mM Tris pH 8.0, 10 mM NaCl, 0.2% NP-40/Igepal, Protease Inhibitor, PMSF) and incubated on ice for 10 min. Cells were further lysed with 30 strokes of a dounce homogenizer (pestle A) and then nuclei were pelleted. Nuclei were lysed on ice in 50 mM Tris pH 8.0, 10 mM EDTA, 1% SDS, Protease Inhibitor, PMSF for 20 min. SDS concentration was reduced before sonication by the addition of 300 uL IP Dilution Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 150 mM NaCl, 1% Triston X-100, 0.01% SDS, Protease Inhibitor, PMSF), after which samples were sonicated for 60 minutes (30 seconds on, 30 seconds off cycle, 100% amplitude) using a Qsonica Q800R2 Sonicator. Insoluble fractions were removed via spin, and the supernatant was removed of non-specific binding chromatin via rotation with preclearing solution (3.7 mL IP Dilution Buffer, 0.5 mL Nuclear Lysis Buffer, 175 uL of Agarose Protein A/G beads, and 50 ug Rabbit IgG) for 2 hours at 4°C. Beads were pelleted and 4.7 mL of supernatant was removed. 200 uL of supernatant was retained as input control (stored at -20°C) while the remaining 4.5 mL was transferred to the beads that had been pre-bound with the H3K27ac antibody overnight; the IP reaction then rotated overnight again at 4°C. Bound bead complexes were washed once with 1 mL IP Wash Buffer 1 (20 mM Tris pH 8.0, 2 mM EDTA, 50 mM NaCl, 1% Triton X-100, 0.1% SDS), twice with 1 mL High-Salt Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 500 mM NaCl, 1% Triton X-100, 0.01% SDS), once with IP Wash Buffer 2 (10 mM Tris pH 8.0, 1 mM EDTA, 0.25 M LiCl, 1% NP-40/Igepal, 1% Na-deoxycholate), and finally twice with 1x TE. Complexes were eluted by twice resuspending bound beads in 110 uL Elution Buffer (100 mM NaHCO3, 1% SDS), pelleting the beads after each elution and transferring 100 uL supernatant to a new tube. Finally, 12 uL of 5M NaCl and 20 ug RNase A were added to both 200 uL IP and input samples and incubated at 65 degrees for 1 hour, followed by the addition of 60 ug of Proteinase K and overnight incubation at 65 degrees. DNA was isolated via phenol-chloroform extraction and ethanol precipitation and concentration was quantified using Qubit fluorometer. ChIP-seq libraries were prepared for sequencing using the NEBNext Ultra II DNA Library Prep Kit (NEB# E7645S), following manufacturer's protocol with the following user-chosen specifications. 3 ng DNA from all IP and input samples was used as starting material. NEBNext Adaptors were diluted 15x in 10 mM Tris-HCL, pH 8.0 with 10 mM NaCl prior to adaptor ligation. Large DNA fragments were removed via a size selection by adding 15 uL of AMPure XP beads at the first bead addition step and 87 uL of beads at the second bead addition step. Size-selected DNA was amplified using 9 cycles of PCR enrichment. The size-range of the final libraries was confirmed to be between 200-1000 bp using an Agilent Bioanalyzer High Sensitivity DNA test. H3K27ac enrichment was confirmed prior to sequencing by querying the IP/input qPCR enrichment of primer pairs designed to the Arc, Synaptotagmin-1, and Tcf25 promoter regions. Library concentrations were calculated and normalized using the KAPA Illumina Library Quantification Kit (#KK4835) so that libraries could be equally pooled before sequencing 75 bp single-end reads on the NextSeq500. All IP libraries were sequenced to a depth greater than 48 million reads and all input libraries were sequenced to greater than 67 million reads. 5C-seq: Neuronal cultures were formaldehyde fixed as described for ChIP-seq and stored at -80oC. For each condition (Bic, Untreat, TTX), in situ 3C was performed on 4 replicates (divided evenly across two animal/culture batches) of 4-5 million cells. Briefly, cells were thawed on ice and resuspended (gently) in 250 uL of lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630) with 50 uL protease inhibitors (Sigma P8340). Cell suspension was incubated on ice for 15 minutes and pelleted. Pelleted nuclei were washed once in lysis buffer (resuspension and spin), then resuspended and incubated in 50 uL of 0.5% SDS at 62oC for 10 min. SDS was inactivated via the addition of 145 uL H2O, 25 uL 10% Triton X-100, and incubation at 37oC for 15 min. Subsequently, chromatin was digested overnight at 37oC with the addition of 25 uL 10X NEBuffer2 and 100U (5 uL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62oC to inactivate the HindIII. Chromatin was re-ligated via the addition of 100 uL 10% Triton X-100, 120 uL NEB T4 DNA Ligation buffer (NEB B0202S), 12 uL 10 mg/mL BSA, 718 uL H2O, and 2000 U (5 uL) of T4 DNA Ligase (NEB M0202S) and incubation at 16oC for 2 hours (NOTE: This is a deviation from in situ HiC (Rao et al. 2010) in order to promote sticky-end ligation over blunt-end). Following ligation nuclei were pelleted, resuspended in 300 uL of 10 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 1% SDS, plus 25 uL of 20 mg/mL proteinase K (NEB P8107), and incubated at 65oC for 4 hours at which point an additional 25 uL of proteinase K was added and incubated overnight. 3C templates were isolated next day via RNaseA treatment, phenol-chloroform extraction, ethanol precipitation, and Amicon filtration (Millipore MFC5030BKS) (for more details see Beagan et al. 2016). Template size distribution and quantity were assessed with a 0.8% agarose gel. 5C primers were designed according to the double-alternating design scheme using the My5C primer design software (http://my5c.umassmed.edu/my5Cprimers/5C.php)10 with universal “Emulsion” primer tails. Regions were designed to capture TAD structures immediately surrounding the genes of interest (Bdnf, Fos, Arc, Neurexin-1, Neuroligin-3, Synaptotagmin-1) in published mouse cortex HiC data. 5C reactions were carried out as previously described. 600 ng (~200,000 genome copies) of 3C template for each replicate was mixed with 1 fmole of each</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>303759963</ID>
          <LABEL>GSM3759963</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM3759964" accession="SRX5818734">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX5818734</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM3759964</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM3759964: Bic RNA Rep1; Mus musculus; RNA-Seq</TITLE>
    <STUDY_REF accession="SRP197612" refname="GSE131025">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS4747486">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS4747486</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM3759964</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>RNA-Seq</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>cDNA</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>RNA-seq: At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. RNA-seq:We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library. ChIP-seq: At DIV16, neuronal cultures were fixed in 1% formaldehyde for 10 minutes (room temp) via the addition (1:10 vol/vol) of the following fixation solution: 50 mM Hepes-KOH (pH 7.5), 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 11% Formaldehyde. Fixation was quenched via the addition of 2.5 M glycine (1:20 vol/vol) and scraped into pellets of 8 million cells. Each pellet was washed once with cold PBS, flash frozen, and stored at -80oC. Immunoprecipitation was performed as described previously (Beagan et al., 2016) with slight modifications. Briefly, IP reactions were prepared a day prior to cell lysis by combining 20 uL of protein A and protein G conjugated agarose beads (Invitrogen# 15918-014 and 15920-010, respectively) with 10 uL of anti-H3K27ac antibody (Abcam# ab4729) in 1 mL of cold PBS and rotated overnight. The next day cell pellets were resuspended in 1 mL lysis buffer (10 mM Tris pH 8.0, 10 mM NaCl, 0.2% NP-40/Igepal, Protease Inhibitor, PMSF) and incubated on ice for 10 min. Cells were further lysed with 30 strokes of a dounce homogenizer (pestle A) and then nuclei were pelleted. Nuclei were lysed on ice in 50 mM Tris pH 8.0, 10 mM EDTA, 1% SDS, Protease Inhibitor, PMSF for 20 min. SDS concentration was reduced before sonication by the addition of 300 uL IP Dilution Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 150 mM NaCl, 1% Triston X-100, 0.01% SDS, Protease Inhibitor, PMSF), after which samples were sonicated for 60 minutes (30 seconds on, 30 seconds off cycle, 100% amplitude) using a Qsonica Q800R2 Sonicator. Insoluble fractions were removed via spin, and the supernatant was removed of non-specific binding chromatin via rotation with preclearing solution (3.7 mL IP Dilution Buffer, 0.5 mL Nuclear Lysis Buffer, 175 uL of Agarose Protein A/G beads, and 50 ug Rabbit IgG) for 2 hours at 4°C. Beads were pelleted and 4.7 mL of supernatant was removed. 200 uL of supernatant was retained as input control (stored at -20°C) while the remaining 4.5 mL was transferred to the beads that had been pre-bound with the H3K27ac antibody overnight; the IP reaction then rotated overnight again at 4°C. Bound bead complexes were washed once with 1 mL IP Wash Buffer 1 (20 mM Tris pH 8.0, 2 mM EDTA, 50 mM NaCl, 1% Triton X-100, 0.1% SDS), twice with 1 mL High-Salt Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 500 mM NaCl, 1% Triton X-100, 0.01% SDS), once with IP Wash Buffer 2 (10 mM Tris pH 8.0, 1 mM EDTA, 0.25 M LiCl, 1% NP-40/Igepal, 1% Na-deoxycholate), and finally twice with 1x TE. Complexes were eluted by twice resuspending bound beads in 110 uL Elution Buffer (100 mM NaHCO3, 1% SDS), pelleting the beads after each elution and transferring 100 uL supernatant to a new tube. Finally, 12 uL of 5M NaCl and 20 ug RNase A were added to both 200 uL IP and input samples and incubated at 65 degrees for 1 hour, followed by the addition of 60 ug of Proteinase K and overnight incubation at 65 degrees. DNA was isolated via phenol-chloroform extraction and ethanol precipitation and concentration was quantified using Qubit fluorometer. ChIP-seq libraries were prepared for sequencing using the NEBNext Ultra II DNA Library Prep Kit (NEB# E7645S), following manufacturer's protocol with the following user-chosen specifications. 3 ng DNA from all IP and input samples was used as starting material. NEBNext Adaptors were diluted 15x in 10 mM Tris-HCL, pH 8.0 with 10 mM NaCl prior to adaptor ligation. Large DNA fragments were removed via a size selection by adding 15 uL of AMPure XP beads at the first bead addition step and 87 uL of beads at the second bead addition step. Size-selected DNA was amplified using 9 cycles of PCR enrichment. The size-range of the final libraries was confirmed to be between 200-1000 bp using an Agilent Bioanalyzer High Sensitivity DNA test. H3K27ac enrichment was confirmed prior to sequencing by querying the IP/input qPCR enrichment of primer pairs designed to the Arc, Synaptotagmin-1, and Tcf25 promoter regions. Library concentrations were calculated and normalized using the KAPA Illumina Library Quantification Kit (#KK4835) so that libraries could be equally pooled before sequencing 75 bp single-end reads on the NextSeq500. All IP libraries were sequenced to a depth greater than 48 million reads and all input libraries were sequenced to greater than 67 million reads. 5C-seq: Neuronal cultures were formaldehyde fixed as described for ChIP-seq and stored at -80oC. For each condition (Bic, Untreat, TTX), in situ 3C was performed on 4 replicates (divided evenly across two animal/culture batches) of 4-5 million cells. Briefly, cells were thawed on ice and resuspended (gently) in 250 uL of lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630) with 50 uL protease inhibitors (Sigma P8340). Cell suspension was incubated on ice for 15 minutes and pelleted. Pelleted nuclei were washed once in lysis buffer (resuspension and spin), then resuspended and incubated in 50 uL of 0.5% SDS at 62oC for 10 min. SDS was inactivated via the addition of 145 uL H2O, 25 uL 10% Triton X-100, and incubation at 37oC for 15 min. Subsequently, chromatin was digested overnight at 37oC with the addition of 25 uL 10X NEBuffer2 and 100U (5 uL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62oC to inactivate the HindIII. Chromatin was re-ligated via the addition of 100 uL 10% Triton X-100, 120 uL NEB T4 DNA Ligation buffer (NEB B0202S), 12 uL 10 mg/mL BSA, 718 uL H2O, and 2000 U (5 uL) of T4 DNA Ligase (NEB M0202S) and incubation at 16oC for 2 hours (NOTE: This is a deviation from in situ HiC (Rao et al. 2010) in order to promote sticky-end ligation over blunt-end). Following ligation nuclei were pelleted, resuspended in 300 uL of 10 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 1% SDS, plus 25 uL of 20 mg/mL proteinase K (NEB P8107), and incubated at 65oC for 4 hours at which point an additional 25 uL of proteinase K was added and incubated overnight. 3C templates were isolated next day via RNaseA treatment, phenol-chloroform extraction, ethanol precipitation, and Amicon filtration (Millipore MFC5030BKS) (for more details see Beagan et al. 2016). Template size distribution and quantity were assessed with a 0.8% agarose gel. 5C primers were designed according to the double-alternating design scheme using the My5C primer design software (http://my5c.umassmed.edu/my5Cprimers/5C.php)10 with universal “Emulsion” primer tails. Regions were designed to capture TAD structures immediately surrounding the genes of interest (Bdnf, Fos, Arc, Neurexin-1, Neuroligin-3, Synaptotagmin-1) in published mouse cortex HiC data. 5C reactions were carried out as previously described. 600 ng (~200,000 genome copies) of 3C template for each replicate was mixed with 1 fmole of each</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>303759964</ID>
          <LABEL>GSM3759964</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM3759965" accession="SRX5818735">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX5818735</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM3759965</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM3759965: Bic RNA Rep2; Mus musculus; RNA-Seq</TITLE>
    <STUDY_REF accession="SRP197612" refname="GSE131025">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS4747487">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS4747487</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM3759965</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>RNA-Seq</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>cDNA</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>RNA-seq: At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. RNA-seq:We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library. ChIP-seq: At DIV16, neuronal cultures were fixed in 1% formaldehyde for 10 minutes (room temp) via the addition (1:10 vol/vol) of the following fixation solution: 50 mM Hepes-KOH (pH 7.5), 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 11% Formaldehyde. Fixation was quenched via the addition of 2.5 M glycine (1:20 vol/vol) and scraped into pellets of 8 million cells. Each pellet was washed once with cold PBS, flash frozen, and stored at -80oC. Immunoprecipitation was performed as described previously (Beagan et al., 2016) with slight modifications. Briefly, IP reactions were prepared a day prior to cell lysis by combining 20 uL of protein A and protein G conjugated agarose beads (Invitrogen# 15918-014 and 15920-010, respectively) with 10 uL of anti-H3K27ac antibody (Abcam# ab4729) in 1 mL of cold PBS and rotated overnight. The next day cell pellets were resuspended in 1 mL lysis buffer (10 mM Tris pH 8.0, 10 mM NaCl, 0.2% NP-40/Igepal, Protease Inhibitor, PMSF) and incubated on ice for 10 min. Cells were further lysed with 30 strokes of a dounce homogenizer (pestle A) and then nuclei were pelleted. Nuclei were lysed on ice in 50 mM Tris pH 8.0, 10 mM EDTA, 1% SDS, Protease Inhibitor, PMSF for 20 min. SDS concentration was reduced before sonication by the addition of 300 uL IP Dilution Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 150 mM NaCl, 1% Triston X-100, 0.01% SDS, Protease Inhibitor, PMSF), after which samples were sonicated for 60 minutes (30 seconds on, 30 seconds off cycle, 100% amplitude) using a Qsonica Q800R2 Sonicator. Insoluble fractions were removed via spin, and the supernatant was removed of non-specific binding chromatin via rotation with preclearing solution (3.7 mL IP Dilution Buffer, 0.5 mL Nuclear Lysis Buffer, 175 uL of Agarose Protein A/G beads, and 50 ug Rabbit IgG) for 2 hours at 4°C. Beads were pelleted and 4.7 mL of supernatant was removed. 200 uL of supernatant was retained as input control (stored at -20°C) while the remaining 4.5 mL was transferred to the beads that had been pre-bound with the H3K27ac antibody overnight; the IP reaction then rotated overnight again at 4°C. Bound bead complexes were washed once with 1 mL IP Wash Buffer 1 (20 mM Tris pH 8.0, 2 mM EDTA, 50 mM NaCl, 1% Triton X-100, 0.1% SDS), twice with 1 mL High-Salt Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 500 mM NaCl, 1% Triton X-100, 0.01% SDS), once with IP Wash Buffer 2 (10 mM Tris pH 8.0, 1 mM EDTA, 0.25 M LiCl, 1% NP-40/Igepal, 1% Na-deoxycholate), and finally twice with 1x TE. Complexes were eluted by twice resuspending bound beads in 110 uL Elution Buffer (100 mM NaHCO3, 1% SDS), pelleting the beads after each elution and transferring 100 uL supernatant to a new tube. Finally, 12 uL of 5M NaCl and 20 ug RNase A were added to both 200 uL IP and input samples and incubated at 65 degrees for 1 hour, followed by the addition of 60 ug of Proteinase K and overnight incubation at 65 degrees. DNA was isolated via phenol-chloroform extraction and ethanol precipitation and concentration was quantified using Qubit fluorometer. ChIP-seq libraries were prepared for sequencing using the NEBNext Ultra II DNA Library Prep Kit (NEB# E7645S), following manufacturer's protocol with the following user-chosen specifications. 3 ng DNA from all IP and input samples was used as starting material. NEBNext Adaptors were diluted 15x in 10 mM Tris-HCL, pH 8.0 with 10 mM NaCl prior to adaptor ligation. Large DNA fragments were removed via a size selection by adding 15 uL of AMPure XP beads at the first bead addition step and 87 uL of beads at the second bead addition step. Size-selected DNA was amplified using 9 cycles of PCR enrichment. The size-range of the final libraries was confirmed to be between 200-1000 bp using an Agilent Bioanalyzer High Sensitivity DNA test. H3K27ac enrichment was confirmed prior to sequencing by querying the IP/input qPCR enrichment of primer pairs designed to the Arc, Synaptotagmin-1, and Tcf25 promoter regions. Library concentrations were calculated and normalized using the KAPA Illumina Library Quantification Kit (#KK4835) so that libraries could be equally pooled before sequencing 75 bp single-end reads on the NextSeq500. All IP libraries were sequenced to a depth greater than 48 million reads and all input libraries were sequenced to greater than 67 million reads. 5C-seq: Neuronal cultures were formaldehyde fixed as described for ChIP-seq and stored at -80oC. For each condition (Bic, Untreat, TTX), in situ 3C was performed on 4 replicates (divided evenly across two animal/culture batches) of 4-5 million cells. Briefly, cells were thawed on ice and resuspended (gently) in 250 uL of lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630) with 50 uL protease inhibitors (Sigma P8340). Cell suspension was incubated on ice for 15 minutes and pelleted. Pelleted nuclei were washed once in lysis buffer (resuspension and spin), then resuspended and incubated in 50 uL of 0.5% SDS at 62oC for 10 min. SDS was inactivated via the addition of 145 uL H2O, 25 uL 10% Triton X-100, and incubation at 37oC for 15 min. Subsequently, chromatin was digested overnight at 37oC with the addition of 25 uL 10X NEBuffer2 and 100U (5 uL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62oC to inactivate the HindIII. Chromatin was re-ligated via the addition of 100 uL 10% Triton X-100, 120 uL NEB T4 DNA Ligation buffer (NEB B0202S), 12 uL 10 mg/mL BSA, 718 uL H2O, and 2000 U (5 uL) of T4 DNA Ligase (NEB M0202S) and incubation at 16oC for 2 hours (NOTE: This is a deviation from in situ HiC (Rao et al. 2010) in order to promote sticky-end ligation over blunt-end). Following ligation nuclei were pelleted, resuspended in 300 uL of 10 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 1% SDS, plus 25 uL of 20 mg/mL proteinase K (NEB P8107), and incubated at 65oC for 4 hours at which point an additional 25 uL of proteinase K was added and incubated overnight. 3C templates were isolated next day via RNaseA treatment, phenol-chloroform extraction, ethanol precipitation, and Amicon filtration (Millipore MFC5030BKS) (for more details see Beagan et al. 2016). Template size distribution and quantity were assessed with a 0.8% agarose gel. 5C primers were designed according to the double-alternating design scheme using the My5C primer design software (http://my5c.umassmed.edu/my5Cprimers/5C.php)10 with universal “Emulsion” primer tails. Regions were designed to capture TAD structures immediately surrounding the genes of interest (Bdnf, Fos, Arc, Neurexin-1, Neuroligin-3, Synaptotagmin-1) in published mouse cortex HiC data. 5C reactions were carried out as previously described. 600 ng (~200,000 genome copies) of 3C template for each replicate was mixed with 1 fmole of each</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>303759965</ID>
          <LABEL>GSM3759965</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM3759966" accession="SRX5818736">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX5818736</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM3759966</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM3759966: Bic RNA Rep 3; Mus musculus; RNA-Seq</TITLE>
    <STUDY_REF accession="SRP197612" refname="GSE131025">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS4747488">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS4747488</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM3759966</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>RNA-Seq</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>cDNA</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>RNA-seq: At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. RNA-seq:We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library. ChIP-seq: At DIV16, neuronal cultures were fixed in 1% formaldehyde for 10 minutes (room temp) via the addition (1:10 vol/vol) of the following fixation solution: 50 mM Hepes-KOH (pH 7.5), 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 11% Formaldehyde. Fixation was quenched via the addition of 2.5 M glycine (1:20 vol/vol) and scraped into pellets of 8 million cells. Each pellet was washed once with cold PBS, flash frozen, and stored at -80oC. Immunoprecipitation was performed as described previously (Beagan et al., 2016) with slight modifications. Briefly, IP reactions were prepared a day prior to cell lysis by combining 20 uL of protein A and protein G conjugated agarose beads (Invitrogen# 15918-014 and 15920-010, respectively) with 10 uL of anti-H3K27ac antibody (Abcam# ab4729) in 1 mL of cold PBS and rotated overnight. The next day cell pellets were resuspended in 1 mL lysis buffer (10 mM Tris pH 8.0, 10 mM NaCl, 0.2% NP-40/Igepal, Protease Inhibitor, PMSF) and incubated on ice for 10 min. Cells were further lysed with 30 strokes of a dounce homogenizer (pestle A) and then nuclei were pelleted. Nuclei were lysed on ice in 50 mM Tris pH 8.0, 10 mM EDTA, 1% SDS, Protease Inhibitor, PMSF for 20 min. SDS concentration was reduced before sonication by the addition of 300 uL IP Dilution Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 150 mM NaCl, 1% Triston X-100, 0.01% SDS, Protease Inhibitor, PMSF), after which samples were sonicated for 60 minutes (30 seconds on, 30 seconds off cycle, 100% amplitude) using a Qsonica Q800R2 Sonicator. Insoluble fractions were removed via spin, and the supernatant was removed of non-specific binding chromatin via rotation with preclearing solution (3.7 mL IP Dilution Buffer, 0.5 mL Nuclear Lysis Buffer, 175 uL of Agarose Protein A/G beads, and 50 ug Rabbit IgG) for 2 hours at 4°C. Beads were pelleted and 4.7 mL of supernatant was removed. 200 uL of supernatant was retained as input control (stored at -20°C) while the remaining 4.5 mL was transferred to the beads that had been pre-bound with the H3K27ac antibody overnight; the IP reaction then rotated overnight again at 4°C. Bound bead complexes were washed once with 1 mL IP Wash Buffer 1 (20 mM Tris pH 8.0, 2 mM EDTA, 50 mM NaCl, 1% Triton X-100, 0.1% SDS), twice with 1 mL High-Salt Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 500 mM NaCl, 1% Triton X-100, 0.01% SDS), once with IP Wash Buffer 2 (10 mM Tris pH 8.0, 1 mM EDTA, 0.25 M LiCl, 1% NP-40/Igepal, 1% Na-deoxycholate), and finally twice with 1x TE. Complexes were eluted by twice resuspending bound beads in 110 uL Elution Buffer (100 mM NaHCO3, 1% SDS), pelleting the beads after each elution and transferring 100 uL supernatant to a new tube. Finally, 12 uL of 5M NaCl and 20 ug RNase A were added to both 200 uL IP and input samples and incubated at 65 degrees for 1 hour, followed by the addition of 60 ug of Proteinase K and overnight incubation at 65 degrees. DNA was isolated via phenol-chloroform extraction and ethanol precipitation and concentration was quantified using Qubit fluorometer. ChIP-seq libraries were prepared for sequencing using the NEBNext Ultra II DNA Library Prep Kit (NEB# E7645S), following manufacturer's protocol with the following user-chosen specifications. 3 ng DNA from all IP and input samples was used as starting material. NEBNext Adaptors were diluted 15x in 10 mM Tris-HCL, pH 8.0 with 10 mM NaCl prior to adaptor ligation. Large DNA fragments were removed via a size selection by adding 15 uL of AMPure XP beads at the first bead addition step and 87 uL of beads at the second bead addition step. Size-selected DNA was amplified using 9 cycles of PCR enrichment. The size-range of the final libraries was confirmed to be between 200-1000 bp using an Agilent Bioanalyzer High Sensitivity DNA test. H3K27ac enrichment was confirmed prior to sequencing by querying the IP/input qPCR enrichment of primer pairs designed to the Arc, Synaptotagmin-1, and Tcf25 promoter regions. Library concentrations were calculated and normalized using the KAPA Illumina Library Quantification Kit (#KK4835) so that libraries could be equally pooled before sequencing 75 bp single-end reads on the NextSeq500. All IP libraries were sequenced to a depth greater than 48 million reads and all input libraries were sequenced to greater than 67 million reads. 5C-seq: Neuronal cultures were formaldehyde fixed as described for ChIP-seq and stored at -80oC. For each condition (Bic, Untreat, TTX), in situ 3C was performed on 4 replicates (divided evenly across two animal/culture batches) of 4-5 million cells. Briefly, cells were thawed on ice and resuspended (gently) in 250 uL of lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630) with 50 uL protease inhibitors (Sigma P8340). Cell suspension was incubated on ice for 15 minutes and pelleted. Pelleted nuclei were washed once in lysis buffer (resuspension and spin), then resuspended and incubated in 50 uL of 0.5% SDS at 62oC for 10 min. SDS was inactivated via the addition of 145 uL H2O, 25 uL 10% Triton X-100, and incubation at 37oC for 15 min. Subsequently, chromatin was digested overnight at 37oC with the addition of 25 uL 10X NEBuffer2 and 100U (5 uL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62oC to inactivate the HindIII. Chromatin was re-ligated via the addition of 100 uL 10% Triton X-100, 120 uL NEB T4 DNA Ligation buffer (NEB B0202S), 12 uL 10 mg/mL BSA, 718 uL H2O, and 2000 U (5 uL) of T4 DNA Ligase (NEB M0202S) and incubation at 16oC for 2 hours (NOTE: This is a deviation from in situ HiC (Rao et al. 2010) in order to promote sticky-end ligation over blunt-end). Following ligation nuclei were pelleted, resuspended in 300 uL of 10 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 1% SDS, plus 25 uL of 20 mg/mL proteinase K (NEB P8107), and incubated at 65oC for 4 hours at which point an additional 25 uL of proteinase K was added and incubated overnight. 3C templates were isolated next day via RNaseA treatment, phenol-chloroform extraction, ethanol precipitation, and Amicon filtration (Millipore MFC5030BKS) (for more details see Beagan et al. 2016). Template size distribution and quantity were assessed with a 0.8% agarose gel. 5C primers were designed according to the double-alternating design scheme using the My5C primer design software (http://my5c.umassmed.edu/my5Cprimers/5C.php)10 with universal “Emulsion” primer tails. Regions were designed to capture TAD structures immediately surrounding the genes of interest (Bdnf, Fos, Arc, Neurexin-1, Neuroligin-3, Synaptotagmin-1) in published mouse cortex HiC data. 5C reactions were carried out as previously described. 600 ng (~200,000 genome copies) of 3C template for each replicate was mixed with 1 fmole of each</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>303759966</ID>
          <LABEL>GSM3759966</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM3759967" accession="SRX5818737">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX5818737</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM3759967</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM3759967: TTX RNA Rep1; Mus musculus; RNA-Seq</TITLE>
    <STUDY_REF accession="SRP197612" refname="GSE131025">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS4747489">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS4747489</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM3759967</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>RNA-Seq</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>cDNA</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>RNA-seq: At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. RNA-seq:We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library. ChIP-seq: At DIV16, neuronal cultures were fixed in 1% formaldehyde for 10 minutes (room temp) via the addition (1:10 vol/vol) of the following fixation solution: 50 mM Hepes-KOH (pH 7.5), 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 11% Formaldehyde. Fixation was quenched via the addition of 2.5 M glycine (1:20 vol/vol) and scraped into pellets of 8 million cells. Each pellet was washed once with cold PBS, flash frozen, and stored at -80oC. Immunoprecipitation was performed as described previously (Beagan et al., 2016) with slight modifications. Briefly, IP reactions were prepared a day prior to cell lysis by combining 20 uL of protein A and protein G conjugated agarose beads (Invitrogen# 15918-014 and 15920-010, respectively) with 10 uL of anti-H3K27ac antibody (Abcam# ab4729) in 1 mL of cold PBS and rotated overnight. The next day cell pellets were resuspended in 1 mL lysis buffer (10 mM Tris pH 8.0, 10 mM NaCl, 0.2% NP-40/Igepal, Protease Inhibitor, PMSF) and incubated on ice for 10 min. Cells were further lysed with 30 strokes of a dounce homogenizer (pestle A) and then nuclei were pelleted. Nuclei were lysed on ice in 50 mM Tris pH 8.0, 10 mM EDTA, 1% SDS, Protease Inhibitor, PMSF for 20 min. SDS concentration was reduced before sonication by the addition of 300 uL IP Dilution Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 150 mM NaCl, 1% Triston X-100, 0.01% SDS, Protease Inhibitor, PMSF), after which samples were sonicated for 60 minutes (30 seconds on, 30 seconds off cycle, 100% amplitude) using a Qsonica Q800R2 Sonicator. Insoluble fractions were removed via spin, and the supernatant was removed of non-specific binding chromatin via rotation with preclearing solution (3.7 mL IP Dilution Buffer, 0.5 mL Nuclear Lysis Buffer, 175 uL of Agarose Protein A/G beads, and 50 ug Rabbit IgG) for 2 hours at 4°C. Beads were pelleted and 4.7 mL of supernatant was removed. 200 uL of supernatant was retained as input control (stored at -20°C) while the remaining 4.5 mL was transferred to the beads that had been pre-bound with the H3K27ac antibody overnight; the IP reaction then rotated overnight again at 4°C. Bound bead complexes were washed once with 1 mL IP Wash Buffer 1 (20 mM Tris pH 8.0, 2 mM EDTA, 50 mM NaCl, 1% Triton X-100, 0.1% SDS), twice with 1 mL High-Salt Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 500 mM NaCl, 1% Triton X-100, 0.01% SDS), once with IP Wash Buffer 2 (10 mM Tris pH 8.0, 1 mM EDTA, 0.25 M LiCl, 1% NP-40/Igepal, 1% Na-deoxycholate), and finally twice with 1x TE. Complexes were eluted by twice resuspending bound beads in 110 uL Elution Buffer (100 mM NaHCO3, 1% SDS), pelleting the beads after each elution and transferring 100 uL supernatant to a new tube. Finally, 12 uL of 5M NaCl and 20 ug RNase A were added to both 200 uL IP and input samples and incubated at 65 degrees for 1 hour, followed by the addition of 60 ug of Proteinase K and overnight incubation at 65 degrees. DNA was isolated via phenol-chloroform extraction and ethanol precipitation and concentration was quantified using Qubit fluorometer. ChIP-seq libraries were prepared for sequencing using the NEBNext Ultra II DNA Library Prep Kit (NEB# E7645S), following manufacturer's protocol with the following user-chosen specifications. 3 ng DNA from all IP and input samples was used as starting material. NEBNext Adaptors were diluted 15x in 10 mM Tris-HCL, pH 8.0 with 10 mM NaCl prior to adaptor ligation. Large DNA fragments were removed via a size selection by adding 15 uL of AMPure XP beads at the first bead addition step and 87 uL of beads at the second bead addition step. Size-selected DNA was amplified using 9 cycles of PCR enrichment. The size-range of the final libraries was confirmed to be between 200-1000 bp using an Agilent Bioanalyzer High Sensitivity DNA test. H3K27ac enrichment was confirmed prior to sequencing by querying the IP/input qPCR enrichment of primer pairs designed to the Arc, Synaptotagmin-1, and Tcf25 promoter regions. Library concentrations were calculated and normalized using the KAPA Illumina Library Quantification Kit (#KK4835) so that libraries could be equally pooled before sequencing 75 bp single-end reads on the NextSeq500. All IP libraries were sequenced to a depth greater than 48 million reads and all input libraries were sequenced to greater than 67 million reads. 5C-seq: Neuronal cultures were formaldehyde fixed as described for ChIP-seq and stored at -80oC. For each condition (Bic, Untreat, TTX), in situ 3C was performed on 4 replicates (divided evenly across two animal/culture batches) of 4-5 million cells. Briefly, cells were thawed on ice and resuspended (gently) in 250 uL of lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630) with 50 uL protease inhibitors (Sigma P8340). Cell suspension was incubated on ice for 15 minutes and pelleted. Pelleted nuclei were washed once in lysis buffer (resuspension and spin), then resuspended and incubated in 50 uL of 0.5% SDS at 62oC for 10 min. SDS was inactivated via the addition of 145 uL H2O, 25 uL 10% Triton X-100, and incubation at 37oC for 15 min. Subsequently, chromatin was digested overnight at 37oC with the addition of 25 uL 10X NEBuffer2 and 100U (5 uL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62oC to inactivate the HindIII. Chromatin was re-ligated via the addition of 100 uL 10% Triton X-100, 120 uL NEB T4 DNA Ligation buffer (NEB B0202S), 12 uL 10 mg/mL BSA, 718 uL H2O, and 2000 U (5 uL) of T4 DNA Ligase (NEB M0202S) and incubation at 16oC for 2 hours (NOTE: This is a deviation from in situ HiC (Rao et al. 2010) in order to promote sticky-end ligation over blunt-end). Following ligation nuclei were pelleted, resuspended in 300 uL of 10 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 1% SDS, plus 25 uL of 20 mg/mL proteinase K (NEB P8107), and incubated at 65oC for 4 hours at which point an additional 25 uL of proteinase K was added and incubated overnight. 3C templates were isolated next day via RNaseA treatment, phenol-chloroform extraction, ethanol precipitation, and Amicon filtration (Millipore MFC5030BKS) (for more details see Beagan et al. 2016). Template size distribution and quantity were assessed with a 0.8% agarose gel. 5C primers were designed according to the double-alternating design scheme using the My5C primer design software (http://my5c.umassmed.edu/my5Cprimers/5C.php)10 with universal “Emulsion” primer tails. Regions were designed to capture TAD structures immediately surrounding the genes of interest (Bdnf, Fos, Arc, Neurexin-1, Neuroligin-3, Synaptotagmin-1) in published mouse cortex HiC data. 5C reactions were carried out as previously described. 600 ng (~200,000 genome copies) of 3C template for each replicate was mixed with 1 fmole of each</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>303759967</ID>
          <LABEL>GSM3759967</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM3759968" accession="SRX5818738">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX5818738</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM3759968</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM3759968: TTX RNA Rep2; Mus musculus; RNA-Seq</TITLE>
    <STUDY_REF accession="SRP197612" refname="GSE131025">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS4747490">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS4747490</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM3759968</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>RNA-Seq</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>cDNA</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>RNA-seq: At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. RNA-seq:We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library. ChIP-seq: At DIV16, neuronal cultures were fixed in 1% formaldehyde for 10 minutes (room temp) via the addition (1:10 vol/vol) of the following fixation solution: 50 mM Hepes-KOH (pH 7.5), 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 11% Formaldehyde. Fixation was quenched via the addition of 2.5 M glycine (1:20 vol/vol) and scraped into pellets of 8 million cells. Each pellet was washed once with cold PBS, flash frozen, and stored at -80oC. Immunoprecipitation was performed as described previously (Beagan et al., 2016) with slight modifications. Briefly, IP reactions were prepared a day prior to cell lysis by combining 20 uL of protein A and protein G conjugated agarose beads (Invitrogen# 15918-014 and 15920-010, respectively) with 10 uL of anti-H3K27ac antibody (Abcam# ab4729) in 1 mL of cold PBS and rotated overnight. The next day cell pellets were resuspended in 1 mL lysis buffer (10 mM Tris pH 8.0, 10 mM NaCl, 0.2% NP-40/Igepal, Protease Inhibitor, PMSF) and incubated on ice for 10 min. Cells were further lysed with 30 strokes of a dounce homogenizer (pestle A) and then nuclei were pelleted. Nuclei were lysed on ice in 50 mM Tris pH 8.0, 10 mM EDTA, 1% SDS, Protease Inhibitor, PMSF for 20 min. SDS concentration was reduced before sonication by the addition of 300 uL IP Dilution Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 150 mM NaCl, 1% Triston X-100, 0.01% SDS, Protease Inhibitor, PMSF), after which samples were sonicated for 60 minutes (30 seconds on, 30 seconds off cycle, 100% amplitude) using a Qsonica Q800R2 Sonicator. Insoluble fractions were removed via spin, and the supernatant was removed of non-specific binding chromatin via rotation with preclearing solution (3.7 mL IP Dilution Buffer, 0.5 mL Nuclear Lysis Buffer, 175 uL of Agarose Protein A/G beads, and 50 ug Rabbit IgG) for 2 hours at 4°C. Beads were pelleted and 4.7 mL of supernatant was removed. 200 uL of supernatant was retained as input control (stored at -20°C) while the remaining 4.5 mL was transferred to the beads that had been pre-bound with the H3K27ac antibody overnight; the IP reaction then rotated overnight again at 4°C. Bound bead complexes were washed once with 1 mL IP Wash Buffer 1 (20 mM Tris pH 8.0, 2 mM EDTA, 50 mM NaCl, 1% Triton X-100, 0.1% SDS), twice with 1 mL High-Salt Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 500 mM NaCl, 1% Triton X-100, 0.01% SDS), once with IP Wash Buffer 2 (10 mM Tris pH 8.0, 1 mM EDTA, 0.25 M LiCl, 1% NP-40/Igepal, 1% Na-deoxycholate), and finally twice with 1x TE. Complexes were eluted by twice resuspending bound beads in 110 uL Elution Buffer (100 mM NaHCO3, 1% SDS), pelleting the beads after each elution and transferring 100 uL supernatant to a new tube. Finally, 12 uL of 5M NaCl and 20 ug RNase A were added to both 200 uL IP and input samples and incubated at 65 degrees for 1 hour, followed by the addition of 60 ug of Proteinase K and overnight incubation at 65 degrees. DNA was isolated via phenol-chloroform extraction and ethanol precipitation and concentration was quantified using Qubit fluorometer. ChIP-seq libraries were prepared for sequencing using the NEBNext Ultra II DNA Library Prep Kit (NEB# E7645S), following manufacturer's protocol with the following user-chosen specifications. 3 ng DNA from all IP and input samples was used as starting material. NEBNext Adaptors were diluted 15x in 10 mM Tris-HCL, pH 8.0 with 10 mM NaCl prior to adaptor ligation. Large DNA fragments were removed via a size selection by adding 15 uL of AMPure XP beads at the first bead addition step and 87 uL of beads at the second bead addition step. Size-selected DNA was amplified using 9 cycles of PCR enrichment. The size-range of the final libraries was confirmed to be between 200-1000 bp using an Agilent Bioanalyzer High Sensitivity DNA test. H3K27ac enrichment was confirmed prior to sequencing by querying the IP/input qPCR enrichment of primer pairs designed to the Arc, Synaptotagmin-1, and Tcf25 promoter regions. Library concentrations were calculated and normalized using the KAPA Illumina Library Quantification Kit (#KK4835) so that libraries could be equally pooled before sequencing 75 bp single-end reads on the NextSeq500. All IP libraries were sequenced to a depth greater than 48 million reads and all input libraries were sequenced to greater than 67 million reads. 5C-seq: Neuronal cultures were formaldehyde fixed as described for ChIP-seq and stored at -80oC. For each condition (Bic, Untreat, TTX), in situ 3C was performed on 4 replicates (divided evenly across two animal/culture batches) of 4-5 million cells. Briefly, cells were thawed on ice and resuspended (gently) in 250 uL of lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630) with 50 uL protease inhibitors (Sigma P8340). Cell suspension was incubated on ice for 15 minutes and pelleted. Pelleted nuclei were washed once in lysis buffer (resuspension and spin), then resuspended and incubated in 50 uL of 0.5% SDS at 62oC for 10 min. SDS was inactivated via the addition of 145 uL H2O, 25 uL 10% Triton X-100, and incubation at 37oC for 15 min. Subsequently, chromatin was digested overnight at 37oC with the addition of 25 uL 10X NEBuffer2 and 100U (5 uL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62oC to inactivate the HindIII. Chromatin was re-ligated via the addition of 100 uL 10% Triton X-100, 120 uL NEB T4 DNA Ligation buffer (NEB B0202S), 12 uL 10 mg/mL BSA, 718 uL H2O, and 2000 U (5 uL) of T4 DNA Ligase (NEB M0202S) and incubation at 16oC for 2 hours (NOTE: This is a deviation from in situ HiC (Rao et al. 2010) in order to promote sticky-end ligation over blunt-end). Following ligation nuclei were pelleted, resuspended in 300 uL of 10 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 1% SDS, plus 25 uL of 20 mg/mL proteinase K (NEB P8107), and incubated at 65oC for 4 hours at which point an additional 25 uL of proteinase K was added and incubated overnight. 3C templates were isolated next day via RNaseA treatment, phenol-chloroform extraction, ethanol precipitation, and Amicon filtration (Millipore MFC5030BKS) (for more details see Beagan et al. 2016). Template size distribution and quantity were assessed with a 0.8% agarose gel. 5C primers were designed according to the double-alternating design scheme using the My5C primer design software (http://my5c.umassmed.edu/my5Cprimers/5C.php)10 with universal “Emulsion” primer tails. Regions were designed to capture TAD structures immediately surrounding the genes of interest (Bdnf, Fos, Arc, Neurexin-1, Neuroligin-3, Synaptotagmin-1) in published mouse cortex HiC data. 5C reactions were carried out as previously described. 600 ng (~200,000 genome copies) of 3C template for each replicate was mixed with 1 fmole of each</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>303759968</ID>
          <LABEL>GSM3759968</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM3759969" accession="SRX5818739">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX5818739</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM3759969</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM3759969: TTX RNA Rep 3; Mus musculus; RNA-Seq</TITLE>
    <STUDY_REF accession="SRP197612" refname="GSE131025">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS4747491">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS4747491</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM3759969</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>RNA-Seq</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>cDNA</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>RNA-seq: At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. RNA-seq:We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library. ChIP-seq: At DIV16, neuronal cultures were fixed in 1% formaldehyde for 10 minutes (room temp) via the addition (1:10 vol/vol) of the following fixation solution: 50 mM Hepes-KOH (pH 7.5), 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 11% Formaldehyde. Fixation was quenched via the addition of 2.5 M glycine (1:20 vol/vol) and scraped into pellets of 8 million cells. Each pellet was washed once with cold PBS, flash frozen, and stored at -80oC. Immunoprecipitation was performed as described previously (Beagan et al., 2016) with slight modifications. Briefly, IP reactions were prepared a day prior to cell lysis by combining 20 uL of protein A and protein G conjugated agarose beads (Invitrogen# 15918-014 and 15920-010, respectively) with 10 uL of anti-H3K27ac antibody (Abcam# ab4729) in 1 mL of cold PBS and rotated overnight. The next day cell pellets were resuspended in 1 mL lysis buffer (10 mM Tris pH 8.0, 10 mM NaCl, 0.2% NP-40/Igepal, Protease Inhibitor, PMSF) and incubated on ice for 10 min. Cells were further lysed with 30 strokes of a dounce homogenizer (pestle A) and then nuclei were pelleted. Nuclei were lysed on ice in 50 mM Tris pH 8.0, 10 mM EDTA, 1% SDS, Protease Inhibitor, PMSF for 20 min. SDS concentration was reduced before sonication by the addition of 300 uL IP Dilution Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 150 mM NaCl, 1% Triston X-100, 0.01% SDS, Protease Inhibitor, PMSF), after which samples were sonicated for 60 minutes (30 seconds on, 30 seconds off cycle, 100% amplitude) using a Qsonica Q800R2 Sonicator. Insoluble fractions were removed via spin, and the supernatant was removed of non-specific binding chromatin via rotation with preclearing solution (3.7 mL IP Dilution Buffer, 0.5 mL Nuclear Lysis Buffer, 175 uL of Agarose Protein A/G beads, and 50 ug Rabbit IgG) for 2 hours at 4°C. Beads were pelleted and 4.7 mL of supernatant was removed. 200 uL of supernatant was retained as input control (stored at -20°C) while the remaining 4.5 mL was transferred to the beads that had been pre-bound with the H3K27ac antibody overnight; the IP reaction then rotated overnight again at 4°C. Bound bead complexes were washed once with 1 mL IP Wash Buffer 1 (20 mM Tris pH 8.0, 2 mM EDTA, 50 mM NaCl, 1% Triton X-100, 0.1% SDS), twice with 1 mL High-Salt Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 500 mM NaCl, 1% Triton X-100, 0.01% SDS), once with IP Wash Buffer 2 (10 mM Tris pH 8.0, 1 mM EDTA, 0.25 M LiCl, 1% NP-40/Igepal, 1% Na-deoxycholate), and finally twice with 1x TE. Complexes were eluted by twice resuspending bound beads in 110 uL Elution Buffer (100 mM NaHCO3, 1% SDS), pelleting the beads after each elution and transferring 100 uL supernatant to a new tube. Finally, 12 uL of 5M NaCl and 20 ug RNase A were added to both 200 uL IP and input samples and incubated at 65 degrees for 1 hour, followed by the addition of 60 ug of Proteinase K and overnight incubation at 65 degrees. DNA was isolated via phenol-chloroform extraction and ethanol precipitation and concentration was quantified using Qubit fluorometer. ChIP-seq libraries were prepared for sequencing using the NEBNext Ultra II DNA Library Prep Kit (NEB# E7645S), following manufacturer's protocol with the following user-chosen specifications. 3 ng DNA from all IP and input samples was used as starting material. NEBNext Adaptors were diluted 15x in 10 mM Tris-HCL, pH 8.0 with 10 mM NaCl prior to adaptor ligation. Large DNA fragments were removed via a size selection by adding 15 uL of AMPure XP beads at the first bead addition step and 87 uL of beads at the second bead addition step. Size-selected DNA was amplified using 9 cycles of PCR enrichment. The size-range of the final libraries was confirmed to be between 200-1000 bp using an Agilent Bioanalyzer High Sensitivity DNA test. H3K27ac enrichment was confirmed prior to sequencing by querying the IP/input qPCR enrichment of primer pairs designed to the Arc, Synaptotagmin-1, and Tcf25 promoter regions. Library concentrations were calculated and normalized using the KAPA Illumina Library Quantification Kit (#KK4835) so that libraries could be equally pooled before sequencing 75 bp single-end reads on the NextSeq500. All IP libraries were sequenced to a depth greater than 48 million reads and all input libraries were sequenced to greater than 67 million reads. 5C-seq: Neuronal cultures were formaldehyde fixed as described for ChIP-seq and stored at -80oC. For each condition (Bic, Untreat, TTX), in situ 3C was performed on 4 replicates (divided evenly across two animal/culture batches) of 4-5 million cells. Briefly, cells were thawed on ice and resuspended (gently) in 250 uL of lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630) with 50 uL protease inhibitors (Sigma P8340). Cell suspension was incubated on ice for 15 minutes and pelleted. Pelleted nuclei were washed once in lysis buffer (resuspension and spin), then resuspended and incubated in 50 uL of 0.5% SDS at 62oC for 10 min. SDS was inactivated via the addition of 145 uL H2O, 25 uL 10% Triton X-100, and incubation at 37oC for 15 min. Subsequently, chromatin was digested overnight at 37oC with the addition of 25 uL 10X NEBuffer2 and 100U (5 uL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62oC to inactivate the HindIII. Chromatin was re-ligated via the addition of 100 uL 10% Triton X-100, 120 uL NEB T4 DNA Ligation buffer (NEB B0202S), 12 uL 10 mg/mL BSA, 718 uL H2O, and 2000 U (5 uL) of T4 DNA Ligase (NEB M0202S) and incubation at 16oC for 2 hours (NOTE: This is a deviation from in situ HiC (Rao et al. 2010) in order to promote sticky-end ligation over blunt-end). Following ligation nuclei were pelleted, resuspended in 300 uL of 10 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 1% SDS, plus 25 uL of 20 mg/mL proteinase K (NEB P8107), and incubated at 65oC for 4 hours at which point an additional 25 uL of proteinase K was added and incubated overnight. 3C templates were isolated next day via RNaseA treatment, phenol-chloroform extraction, ethanol precipitation, and Amicon filtration (Millipore MFC5030BKS) (for more details see Beagan et al. 2016). Template size distribution and quantity were assessed with a 0.8% agarose gel. 5C primers were designed according to the double-alternating design scheme using the My5C primer design software (http://my5c.umassmed.edu/my5Cprimers/5C.php)10 with universal “Emulsion” primer tails. Regions were designed to capture TAD structures immediately surrounding the genes of interest (Bdnf, Fos, Arc, Neurexin-1, Neuroligin-3, Synaptotagmin-1) in published mouse cortex HiC data. 5C reactions were carried out as previously described. 600 ng (~200,000 genome copies) of 3C template for each replicate was mixed with 1 fmole of each</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>303759969</ID>
          <LABEL>GSM3759969</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM3759970" accession="SRX5818740">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX5818740</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM3759970</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM3759970: Untreat RNA Rep1; Mus musculus; RNA-Seq</TITLE>
    <STUDY_REF accession="SRP197612" refname="GSE131025">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS4747492">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS4747492</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM3759970</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>RNA-Seq</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>cDNA</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>RNA-seq: At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. RNA-seq:We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library. ChIP-seq: At DIV16, neuronal cultures were fixed in 1% formaldehyde for 10 minutes (room temp) via the addition (1:10 vol/vol) of the following fixation solution: 50 mM Hepes-KOH (pH 7.5), 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 11% Formaldehyde. Fixation was quenched via the addition of 2.5 M glycine (1:20 vol/vol) and scraped into pellets of 8 million cells. Each pellet was washed once with cold PBS, flash frozen, and stored at -80oC. Immunoprecipitation was performed as described previously (Beagan et al., 2016) with slight modifications. Briefly, IP reactions were prepared a day prior to cell lysis by combining 20 uL of protein A and protein G conjugated agarose beads (Invitrogen# 15918-014 and 15920-010, respectively) with 10 uL of anti-H3K27ac antibody (Abcam# ab4729) in 1 mL of cold PBS and rotated overnight. The next day cell pellets were resuspended in 1 mL lysis buffer (10 mM Tris pH 8.0, 10 mM NaCl, 0.2% NP-40/Igepal, Protease Inhibitor, PMSF) and incubated on ice for 10 min. Cells were further lysed with 30 strokes of a dounce homogenizer (pestle A) and then nuclei were pelleted. Nuclei were lysed on ice in 50 mM Tris pH 8.0, 10 mM EDTA, 1% SDS, Protease Inhibitor, PMSF for 20 min. SDS concentration was reduced before sonication by the addition of 300 uL IP Dilution Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 150 mM NaCl, 1% Triston X-100, 0.01% SDS, Protease Inhibitor, PMSF), after which samples were sonicated for 60 minutes (30 seconds on, 30 seconds off cycle, 100% amplitude) using a Qsonica Q800R2 Sonicator. Insoluble fractions were removed via spin, and the supernatant was removed of non-specific binding chromatin via rotation with preclearing solution (3.7 mL IP Dilution Buffer, 0.5 mL Nuclear Lysis Buffer, 175 uL of Agarose Protein A/G beads, and 50 ug Rabbit IgG) for 2 hours at 4°C. Beads were pelleted and 4.7 mL of supernatant was removed. 200 uL of supernatant was retained as input control (stored at -20°C) while the remaining 4.5 mL was transferred to the beads that had been pre-bound with the H3K27ac antibody overnight; the IP reaction then rotated overnight again at 4°C. Bound bead complexes were washed once with 1 mL IP Wash Buffer 1 (20 mM Tris pH 8.0, 2 mM EDTA, 50 mM NaCl, 1% Triton X-100, 0.1% SDS), twice with 1 mL High-Salt Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 500 mM NaCl, 1% Triton X-100, 0.01% SDS), once with IP Wash Buffer 2 (10 mM Tris pH 8.0, 1 mM EDTA, 0.25 M LiCl, 1% NP-40/Igepal, 1% Na-deoxycholate), and finally twice with 1x TE. Complexes were eluted by twice resuspending bound beads in 110 uL Elution Buffer (100 mM NaHCO3, 1% SDS), pelleting the beads after each elution and transferring 100 uL supernatant to a new tube. Finally, 12 uL of 5M NaCl and 20 ug RNase A were added to both 200 uL IP and input samples and incubated at 65 degrees for 1 hour, followed by the addition of 60 ug of Proteinase K and overnight incubation at 65 degrees. DNA was isolated via phenol-chloroform extraction and ethanol precipitation and concentration was quantified using Qubit fluorometer. ChIP-seq libraries were prepared for sequencing using the NEBNext Ultra II DNA Library Prep Kit (NEB# E7645S), following manufacturer's protocol with the following user-chosen specifications. 3 ng DNA from all IP and input samples was used as starting material. NEBNext Adaptors were diluted 15x in 10 mM Tris-HCL, pH 8.0 with 10 mM NaCl prior to adaptor ligation. Large DNA fragments were removed via a size selection by adding 15 uL of AMPure XP beads at the first bead addition step and 87 uL of beads at the second bead addition step. Size-selected DNA was amplified using 9 cycles of PCR enrichment. The size-range of the final libraries was confirmed to be between 200-1000 bp using an Agilent Bioanalyzer High Sensitivity DNA test. H3K27ac enrichment was confirmed prior to sequencing by querying the IP/input qPCR enrichment of primer pairs designed to the Arc, Synaptotagmin-1, and Tcf25 promoter regions. Library concentrations were calculated and normalized using the KAPA Illumina Library Quantification Kit (#KK4835) so that libraries could be equally pooled before sequencing 75 bp single-end reads on the NextSeq500. All IP libraries were sequenced to a depth greater than 48 million reads and all input libraries were sequenced to greater than 67 million reads. 5C-seq: Neuronal cultures were formaldehyde fixed as described for ChIP-seq and stored at -80oC. For each condition (Bic, Untreat, TTX), in situ 3C was performed on 4 replicates (divided evenly across two animal/culture batches) of 4-5 million cells. Briefly, cells were thawed on ice and resuspended (gently) in 250 uL of lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630) with 50 uL protease inhibitors (Sigma P8340). Cell suspension was incubated on ice for 15 minutes and pelleted. Pelleted nuclei were washed once in lysis buffer (resuspension and spin), then resuspended and incubated in 50 uL of 0.5% SDS at 62oC for 10 min. SDS was inactivated via the addition of 145 uL H2O, 25 uL 10% Triton X-100, and incubation at 37oC for 15 min. Subsequently, chromatin was digested overnight at 37oC with the addition of 25 uL 10X NEBuffer2 and 100U (5 uL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62oC to inactivate the HindIII. Chromatin was re-ligated via the addition of 100 uL 10% Triton X-100, 120 uL NEB T4 DNA Ligation buffer (NEB B0202S), 12 uL 10 mg/mL BSA, 718 uL H2O, and 2000 U (5 uL) of T4 DNA Ligase (NEB M0202S) and incubation at 16oC for 2 hours (NOTE: This is a deviation from in situ HiC (Rao et al. 2010) in order to promote sticky-end ligation over blunt-end). Following ligation nuclei were pelleted, resuspended in 300 uL of 10 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 1% SDS, plus 25 uL of 20 mg/mL proteinase K (NEB P8107), and incubated at 65oC for 4 hours at which point an additional 25 uL of proteinase K was added and incubated overnight. 3C templates were isolated next day via RNaseA treatment, phenol-chloroform extraction, ethanol precipitation, and Amicon filtration (Millipore MFC5030BKS) (for more details see Beagan et al. 2016). Template size distribution and quantity were assessed with a 0.8% agarose gel. 5C primers were designed according to the double-alternating design scheme using the My5C primer design software (http://my5c.umassmed.edu/my5Cprimers/5C.php)10 with universal “Emulsion” primer tails. Regions were designed to capture TAD structures immediately surrounding the genes of interest (Bdnf, Fos, Arc, Neurexin-1, Neuroligin-3, Synaptotagmin-1) in published mouse cortex HiC data. 5C reactions were carried out as previously described. 600 ng (~200,000 genome copies) of 3C template for each replicate was mixed with 1 fmole of each</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>303759970</ID>
          <LABEL>GSM3759970</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM3759971" accession="SRX5818741">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX5818741</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM3759971</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM3759971: Untreat RNA Rep2; Mus musculus; RNA-Seq</TITLE>
    <STUDY_REF accession="SRP197612" refname="GSE131025">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS4747493">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS4747493</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM3759971</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>RNA-Seq</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>cDNA</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>RNA-seq: At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. RNA-seq:We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library. ChIP-seq: At DIV16, neuronal cultures were fixed in 1% formaldehyde for 10 minutes (room temp) via the addition (1:10 vol/vol) of the following fixation solution: 50 mM Hepes-KOH (pH 7.5), 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 11% Formaldehyde. Fixation was quenched via the addition of 2.5 M glycine (1:20 vol/vol) and scraped into pellets of 8 million cells. Each pellet was washed once with cold PBS, flash frozen, and stored at -80oC. Immunoprecipitation was performed as described previously (Beagan et al., 2016) with slight modifications. Briefly, IP reactions were prepared a day prior to cell lysis by combining 20 uL of protein A and protein G conjugated agarose beads (Invitrogen# 15918-014 and 15920-010, respectively) with 10 uL of anti-H3K27ac antibody (Abcam# ab4729) in 1 mL of cold PBS and rotated overnight. The next day cell pellets were resuspended in 1 mL lysis buffer (10 mM Tris pH 8.0, 10 mM NaCl, 0.2% NP-40/Igepal, Protease Inhibitor, PMSF) and incubated on ice for 10 min. Cells were further lysed with 30 strokes of a dounce homogenizer (pestle A) and then nuclei were pelleted. Nuclei were lysed on ice in 50 mM Tris pH 8.0, 10 mM EDTA, 1% SDS, Protease Inhibitor, PMSF for 20 min. SDS concentration was reduced before sonication by the addition of 300 uL IP Dilution Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 150 mM NaCl, 1% Triston X-100, 0.01% SDS, Protease Inhibitor, PMSF), after which samples were sonicated for 60 minutes (30 seconds on, 30 seconds off cycle, 100% amplitude) using a Qsonica Q800R2 Sonicator. Insoluble fractions were removed via spin, and the supernatant was removed of non-specific binding chromatin via rotation with preclearing solution (3.7 mL IP Dilution Buffer, 0.5 mL Nuclear Lysis Buffer, 175 uL of Agarose Protein A/G beads, and 50 ug Rabbit IgG) for 2 hours at 4°C. Beads were pelleted and 4.7 mL of supernatant was removed. 200 uL of supernatant was retained as input control (stored at -20°C) while the remaining 4.5 mL was transferred to the beads that had been pre-bound with the H3K27ac antibody overnight; the IP reaction then rotated overnight again at 4°C. Bound bead complexes were washed once with 1 mL IP Wash Buffer 1 (20 mM Tris pH 8.0, 2 mM EDTA, 50 mM NaCl, 1% Triton X-100, 0.1% SDS), twice with 1 mL High-Salt Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 500 mM NaCl, 1% Triton X-100, 0.01% SDS), once with IP Wash Buffer 2 (10 mM Tris pH 8.0, 1 mM EDTA, 0.25 M LiCl, 1% NP-40/Igepal, 1% Na-deoxycholate), and finally twice with 1x TE. Complexes were eluted by twice resuspending bound beads in 110 uL Elution Buffer (100 mM NaHCO3, 1% SDS), pelleting the beads after each elution and transferring 100 uL supernatant to a new tube. Finally, 12 uL of 5M NaCl and 20 ug RNase A were added to both 200 uL IP and input samples and incubated at 65 degrees for 1 hour, followed by the addition of 60 ug of Proteinase K and overnight incubation at 65 degrees. DNA was isolated via phenol-chloroform extraction and ethanol precipitation and concentration was quantified using Qubit fluorometer. ChIP-seq libraries were prepared for sequencing using the NEBNext Ultra II DNA Library Prep Kit (NEB# E7645S), following manufacturer's protocol with the following user-chosen specifications. 3 ng DNA from all IP and input samples was used as starting material. NEBNext Adaptors were diluted 15x in 10 mM Tris-HCL, pH 8.0 with 10 mM NaCl prior to adaptor ligation. Large DNA fragments were removed via a size selection by adding 15 uL of AMPure XP beads at the first bead addition step and 87 uL of beads at the second bead addition step. Size-selected DNA was amplified using 9 cycles of PCR enrichment. The size-range of the final libraries was confirmed to be between 200-1000 bp using an Agilent Bioanalyzer High Sensitivity DNA test. H3K27ac enrichment was confirmed prior to sequencing by querying the IP/input qPCR enrichment of primer pairs designed to the Arc, Synaptotagmin-1, and Tcf25 promoter regions. Library concentrations were calculated and normalized using the KAPA Illumina Library Quantification Kit (#KK4835) so that libraries could be equally pooled before sequencing 75 bp single-end reads on the NextSeq500. All IP libraries were sequenced to a depth greater than 48 million reads and all input libraries were sequenced to greater than 67 million reads. 5C-seq: Neuronal cultures were formaldehyde fixed as described for ChIP-seq and stored at -80oC. For each condition (Bic, Untreat, TTX), in situ 3C was performed on 4 replicates (divided evenly across two animal/culture batches) of 4-5 million cells. Briefly, cells were thawed on ice and resuspended (gently) in 250 uL of lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630) with 50 uL protease inhibitors (Sigma P8340). Cell suspension was incubated on ice for 15 minutes and pelleted. Pelleted nuclei were washed once in lysis buffer (resuspension and spin), then resuspended and incubated in 50 uL of 0.5% SDS at 62oC for 10 min. SDS was inactivated via the addition of 145 uL H2O, 25 uL 10% Triton X-100, and incubation at 37oC for 15 min. Subsequently, chromatin was digested overnight at 37oC with the addition of 25 uL 10X NEBuffer2 and 100U (5 uL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62oC to inactivate the HindIII. Chromatin was re-ligated via the addition of 100 uL 10% Triton X-100, 120 uL NEB T4 DNA Ligation buffer (NEB B0202S), 12 uL 10 mg/mL BSA, 718 uL H2O, and 2000 U (5 uL) of T4 DNA Ligase (NEB M0202S) and incubation at 16oC for 2 hours (NOTE: This is a deviation from in situ HiC (Rao et al. 2010) in order to promote sticky-end ligation over blunt-end). Following ligation nuclei were pelleted, resuspended in 300 uL of 10 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 1% SDS, plus 25 uL of 20 mg/mL proteinase K (NEB P8107), and incubated at 65oC for 4 hours at which point an additional 25 uL of proteinase K was added and incubated overnight. 3C templates were isolated next day via RNaseA treatment, phenol-chloroform extraction, ethanol precipitation, and Amicon filtration (Millipore MFC5030BKS) (for more details see Beagan et al. 2016). Template size distribution and quantity were assessed with a 0.8% agarose gel. 5C primers were designed according to the double-alternating design scheme using the My5C primer design software (http://my5c.umassmed.edu/my5Cprimers/5C.php)10 with universal “Emulsion” primer tails. Regions were designed to capture TAD structures immediately surrounding the genes of interest (Bdnf, Fos, Arc, Neurexin-1, Neuroligin-3, Synaptotagmin-1) in published mouse cortex HiC data. 5C reactions were carried out as previously described. 600 ng (~200,000 genome copies) of 3C template for each replicate was mixed with 1 fmole of each</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>303759971</ID>
          <LABEL>GSM3759971</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM3759972" accession="SRX5818742">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX5818742</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM3759972</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM3759972: Untreat RNA Rep3; Mus musculus; RNA-Seq</TITLE>
    <STUDY_REF accession="SRP197612" refname="GSE131025">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS4747494">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS4747494</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM3759972</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>RNA-Seq</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>cDNA</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>RNA-seq: At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. RNA-seq:We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library. ChIP-seq: At DIV16, neuronal cultures were fixed in 1% formaldehyde for 10 minutes (room temp) via the addition (1:10 vol/vol) of the following fixation solution: 50 mM Hepes-KOH (pH 7.5), 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 11% Formaldehyde. Fixation was quenched via the addition of 2.5 M glycine (1:20 vol/vol) and scraped into pellets of 8 million cells. Each pellet was washed once with cold PBS, flash frozen, and stored at -80oC. Immunoprecipitation was performed as described previously (Beagan et al., 2016) with slight modifications. Briefly, IP reactions were prepared a day prior to cell lysis by combining 20 uL of protein A and protein G conjugated agarose beads (Invitrogen# 15918-014 and 15920-010, respectively) with 10 uL of anti-H3K27ac antibody (Abcam# ab4729) in 1 mL of cold PBS and rotated overnight. The next day cell pellets were resuspended in 1 mL lysis buffer (10 mM Tris pH 8.0, 10 mM NaCl, 0.2% NP-40/Igepal, Protease Inhibitor, PMSF) and incubated on ice for 10 min. Cells were further lysed with 30 strokes of a dounce homogenizer (pestle A) and then nuclei were pelleted. Nuclei were lysed on ice in 50 mM Tris pH 8.0, 10 mM EDTA, 1% SDS, Protease Inhibitor, PMSF for 20 min. SDS concentration was reduced before sonication by the addition of 300 uL IP Dilution Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 150 mM NaCl, 1% Triston X-100, 0.01% SDS, Protease Inhibitor, PMSF), after which samples were sonicated for 60 minutes (30 seconds on, 30 seconds off cycle, 100% amplitude) using a Qsonica Q800R2 Sonicator. Insoluble fractions were removed via spin, and the supernatant was removed of non-specific binding chromatin via rotation with preclearing solution (3.7 mL IP Dilution Buffer, 0.5 mL Nuclear Lysis Buffer, 175 uL of Agarose Protein A/G beads, and 50 ug Rabbit IgG) for 2 hours at 4°C. Beads were pelleted and 4.7 mL of supernatant was removed. 200 uL of supernatant was retained as input control (stored at -20°C) while the remaining 4.5 mL was transferred to the beads that had been pre-bound with the H3K27ac antibody overnight; the IP reaction then rotated overnight again at 4°C. Bound bead complexes were washed once with 1 mL IP Wash Buffer 1 (20 mM Tris pH 8.0, 2 mM EDTA, 50 mM NaCl, 1% Triton X-100, 0.1% SDS), twice with 1 mL High-Salt Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 500 mM NaCl, 1% Triton X-100, 0.01% SDS), once with IP Wash Buffer 2 (10 mM Tris pH 8.0, 1 mM EDTA, 0.25 M LiCl, 1% NP-40/Igepal, 1% Na-deoxycholate), and finally twice with 1x TE. Complexes were eluted by twice resuspending bound beads in 110 uL Elution Buffer (100 mM NaHCO3, 1% SDS), pelleting the beads after each elution and transferring 100 uL supernatant to a new tube. Finally, 12 uL of 5M NaCl and 20 ug RNase A were added to both 200 uL IP and input samples and incubated at 65 degrees for 1 hour, followed by the addition of 60 ug of Proteinase K and overnight incubation at 65 degrees. DNA was isolated via phenol-chloroform extraction and ethanol precipitation and concentration was quantified using Qubit fluorometer. ChIP-seq libraries were prepared for sequencing using the NEBNext Ultra II DNA Library Prep Kit (NEB# E7645S), following manufacturer's protocol with the following user-chosen specifications. 3 ng DNA from all IP and input samples was used as starting material. NEBNext Adaptors were diluted 15x in 10 mM Tris-HCL, pH 8.0 with 10 mM NaCl prior to adaptor ligation. Large DNA fragments were removed via a size selection by adding 15 uL of AMPure XP beads at the first bead addition step and 87 uL of beads at the second bead addition step. Size-selected DNA was amplified using 9 cycles of PCR enrichment. The size-range of the final libraries was confirmed to be between 200-1000 bp using an Agilent Bioanalyzer High Sensitivity DNA test. H3K27ac enrichment was confirmed prior to sequencing by querying the IP/input qPCR enrichment of primer pairs designed to the Arc, Synaptotagmin-1, and Tcf25 promoter regions. Library concentrations were calculated and normalized using the KAPA Illumina Library Quantification Kit (#KK4835) so that libraries could be equally pooled before sequencing 75 bp single-end reads on the NextSeq500. All IP libraries were sequenced to a depth greater than 48 million reads and all input libraries were sequenced to greater than 67 million reads. 5C-seq: Neuronal cultures were formaldehyde fixed as described for ChIP-seq and stored at -80oC. For each condition (Bic, Untreat, TTX), in situ 3C was performed on 4 replicates (divided evenly across two animal/culture batches) of 4-5 million cells. Briefly, cells were thawed on ice and resuspended (gently) in 250 uL of lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630) with 50 uL protease inhibitors (Sigma P8340). Cell suspension was incubated on ice for 15 minutes and pelleted. Pelleted nuclei were washed once in lysis buffer (resuspension and spin), then resuspended and incubated in 50 uL of 0.5% SDS at 62oC for 10 min. SDS was inactivated via the addition of 145 uL H2O, 25 uL 10% Triton X-100, and incubation at 37oC for 15 min. Subsequently, chromatin was digested overnight at 37oC with the addition of 25 uL 10X NEBuffer2 and 100U (5 uL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62oC to inactivate the HindIII. Chromatin was re-ligated via the addition of 100 uL 10% Triton X-100, 120 uL NEB T4 DNA Ligation buffer (NEB B0202S), 12 uL 10 mg/mL BSA, 718 uL H2O, and 2000 U (5 uL) of T4 DNA Ligase (NEB M0202S) and incubation at 16oC for 2 hours (NOTE: This is a deviation from in situ HiC (Rao et al. 2010) in order to promote sticky-end ligation over blunt-end). Following ligation nuclei were pelleted, resuspended in 300 uL of 10 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 1% SDS, plus 25 uL of 20 mg/mL proteinase K (NEB P8107), and incubated at 65oC for 4 hours at which point an additional 25 uL of proteinase K was added and incubated overnight. 3C templates were isolated next day via RNaseA treatment, phenol-chloroform extraction, ethanol precipitation, and Amicon filtration (Millipore MFC5030BKS) (for more details see Beagan et al. 2016). Template size distribution and quantity were assessed with a 0.8% agarose gel. 5C primers were designed according to the double-alternating design scheme using the My5C primer design software (http://my5c.umassmed.edu/my5Cprimers/5C.php)10 with universal “Emulsion” primer tails. Regions were designed to capture TAD structures immediately surrounding the genes of interest (Bdnf, Fos, Arc, Neurexin-1, Neuroligin-3, Synaptotagmin-1) in published mouse cortex HiC data. 5C reactions were carried out as previously described. 600 ng (~200,000 genome copies) of 3C template for each replicate was mixed with 1 fmole of each</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>303759972</ID>
          <LABEL>GSM3759972</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM3759973" accession="SRX5818743">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX5818743</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM3759973</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM3759973: DIV5 RNA Rep1; Mus musculus; RNA-Seq</TITLE>
    <STUDY_REF accession="SRP197612" refname="GSE131025">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS4747495">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS4747495</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM3759973</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>RNA-Seq</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>cDNA</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>RNA-seq: At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. RNA-seq:We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library. ChIP-seq: At DIV16, neuronal cultures were fixed in 1% formaldehyde for 10 minutes (room temp) via the addition (1:10 vol/vol) of the following fixation solution: 50 mM Hepes-KOH (pH 7.5), 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 11% Formaldehyde. Fixation was quenched via the addition of 2.5 M glycine (1:20 vol/vol) and scraped into pellets of 8 million cells. Each pellet was washed once with cold PBS, flash frozen, and stored at -80oC. Immunoprecipitation was performed as described previously (Beagan et al., 2016) with slight modifications. Briefly, IP reactions were prepared a day prior to cell lysis by combining 20 uL of protein A and protein G conjugated agarose beads (Invitrogen# 15918-014 and 15920-010, respectively) with 10 uL of anti-H3K27ac antibody (Abcam# ab4729) in 1 mL of cold PBS and rotated overnight. The next day cell pellets were resuspended in 1 mL lysis buffer (10 mM Tris pH 8.0, 10 mM NaCl, 0.2% NP-40/Igepal, Protease Inhibitor, PMSF) and incubated on ice for 10 min. Cells were further lysed with 30 strokes of a dounce homogenizer (pestle A) and then nuclei were pelleted. Nuclei were lysed on ice in 50 mM Tris pH 8.0, 10 mM EDTA, 1% SDS, Protease Inhibitor, PMSF for 20 min. SDS concentration was reduced before sonication by the addition of 300 uL IP Dilution Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 150 mM NaCl, 1% Triston X-100, 0.01% SDS, Protease Inhibitor, PMSF), after which samples were sonicated for 60 minutes (30 seconds on, 30 seconds off cycle, 100% amplitude) using a Qsonica Q800R2 Sonicator. Insoluble fractions were removed via spin, and the supernatant was removed of non-specific binding chromatin via rotation with preclearing solution (3.7 mL IP Dilution Buffer, 0.5 mL Nuclear Lysis Buffer, 175 uL of Agarose Protein A/G beads, and 50 ug Rabbit IgG) for 2 hours at 4°C. Beads were pelleted and 4.7 mL of supernatant was removed. 200 uL of supernatant was retained as input control (stored at -20°C) while the remaining 4.5 mL was transferred to the beads that had been pre-bound with the H3K27ac antibody overnight; the IP reaction then rotated overnight again at 4°C. Bound bead complexes were washed once with 1 mL IP Wash Buffer 1 (20 mM Tris pH 8.0, 2 mM EDTA, 50 mM NaCl, 1% Triton X-100, 0.1% SDS), twice with 1 mL High-Salt Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 500 mM NaCl, 1% Triton X-100, 0.01% SDS), once with IP Wash Buffer 2 (10 mM Tris pH 8.0, 1 mM EDTA, 0.25 M LiCl, 1% NP-40/Igepal, 1% Na-deoxycholate), and finally twice with 1x TE. Complexes were eluted by twice resuspending bound beads in 110 uL Elution Buffer (100 mM NaHCO3, 1% SDS), pelleting the beads after each elution and transferring 100 uL supernatant to a new tube. Finally, 12 uL of 5M NaCl and 20 ug RNase A were added to both 200 uL IP and input samples and incubated at 65 degrees for 1 hour, followed by the addition of 60 ug of Proteinase K and overnight incubation at 65 degrees. DNA was isolated via phenol-chloroform extraction and ethanol precipitation and concentration was quantified using Qubit fluorometer. ChIP-seq libraries were prepared for sequencing using the NEBNext Ultra II DNA Library Prep Kit (NEB# E7645S), following manufacturer's protocol with the following user-chosen specifications. 3 ng DNA from all IP and input samples was used as starting material. NEBNext Adaptors were diluted 15x in 10 mM Tris-HCL, pH 8.0 with 10 mM NaCl prior to adaptor ligation. Large DNA fragments were removed via a size selection by adding 15 uL of AMPure XP beads at the first bead addition step and 87 uL of beads at the second bead addition step. Size-selected DNA was amplified using 9 cycles of PCR enrichment. The size-range of the final libraries was confirmed to be between 200-1000 bp using an Agilent Bioanalyzer High Sensitivity DNA test. H3K27ac enrichment was confirmed prior to sequencing by querying the IP/input qPCR enrichment of primer pairs designed to the Arc, Synaptotagmin-1, and Tcf25 promoter regions. Library concentrations were calculated and normalized using the KAPA Illumina Library Quantification Kit (#KK4835) so that libraries could be equally pooled before sequencing 75 bp single-end reads on the NextSeq500. All IP libraries were sequenced to a depth greater than 48 million reads and all input libraries were sequenced to greater than 67 million reads. 5C-seq: Neuronal cultures were formaldehyde fixed as described for ChIP-seq and stored at -80oC. For each condition (Bic, Untreat, TTX), in situ 3C was performed on 4 replicates (divided evenly across two animal/culture batches) of 4-5 million cells. Briefly, cells were thawed on ice and resuspended (gently) in 250 uL of lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630) with 50 uL protease inhibitors (Sigma P8340). Cell suspension was incubated on ice for 15 minutes and pelleted. Pelleted nuclei were washed once in lysis buffer (resuspension and spin), then resuspended and incubated in 50 uL of 0.5% SDS at 62oC for 10 min. SDS was inactivated via the addition of 145 uL H2O, 25 uL 10% Triton X-100, and incubation at 37oC for 15 min. Subsequently, chromatin was digested overnight at 37oC with the addition of 25 uL 10X NEBuffer2 and 100U (5 uL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62oC to inactivate the HindIII. Chromatin was re-ligated via the addition of 100 uL 10% Triton X-100, 120 uL NEB T4 DNA Ligation buffer (NEB B0202S), 12 uL 10 mg/mL BSA, 718 uL H2O, and 2000 U (5 uL) of T4 DNA Ligase (NEB M0202S) and incubation at 16oC for 2 hours (NOTE: This is a deviation from in situ HiC (Rao et al. 2010) in order to promote sticky-end ligation over blunt-end). Following ligation nuclei were pelleted, resuspended in 300 uL of 10 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 1% SDS, plus 25 uL of 20 mg/mL proteinase K (NEB P8107), and incubated at 65oC for 4 hours at which point an additional 25 uL of proteinase K was added and incubated overnight. 3C templates were isolated next day via RNaseA treatment, phenol-chloroform extraction, ethanol precipitation, and Amicon filtration (Millipore MFC5030BKS) (for more details see Beagan et al. 2016). Template size distribution and quantity were assessed with a 0.8% agarose gel. 5C primers were designed according to the double-alternating design scheme using the My5C primer design software (http://my5c.umassmed.edu/my5Cprimers/5C.php)10 with universal “Emulsion” primer tails. Regions were designed to capture TAD structures immediately surrounding the genes of interest (Bdnf, Fos, Arc, Neurexin-1, Neuroligin-3, Synaptotagmin-1) in published mouse cortex HiC data. 5C reactions were carried out as previously described. 600 ng (~200,000 genome copies) of 3C template for each replicate was mixed with 1 fmole of each</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>303759973</ID>
          <LABEL>GSM3759973</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM3759974" accession="SRX5818744">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX5818744</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM3759974</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM3759974: DIV5 RNA Rep2; Mus musculus; RNA-Seq</TITLE>
    <STUDY_REF accession="SRP197612" refname="GSE131025">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS4747496">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS4747496</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM3759974</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>RNA-Seq</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>cDNA</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>RNA-seq: At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. RNA-seq:We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library. ChIP-seq: At DIV16, neuronal cultures were fixed in 1% formaldehyde for 10 minutes (room temp) via the addition (1:10 vol/vol) of the following fixation solution: 50 mM Hepes-KOH (pH 7.5), 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 11% Formaldehyde. Fixation was quenched via the addition of 2.5 M glycine (1:20 vol/vol) and scraped into pellets of 8 million cells. Each pellet was washed once with cold PBS, flash frozen, and stored at -80oC. Immunoprecipitation was performed as described previously (Beagan et al., 2016) with slight modifications. Briefly, IP reactions were prepared a day prior to cell lysis by combining 20 uL of protein A and protein G conjugated agarose beads (Invitrogen# 15918-014 and 15920-010, respectively) with 10 uL of anti-H3K27ac antibody (Abcam# ab4729) in 1 mL of cold PBS and rotated overnight. The next day cell pellets were resuspended in 1 mL lysis buffer (10 mM Tris pH 8.0, 10 mM NaCl, 0.2% NP-40/Igepal, Protease Inhibitor, PMSF) and incubated on ice for 10 min. Cells were further lysed with 30 strokes of a dounce homogenizer (pestle A) and then nuclei were pelleted. Nuclei were lysed on ice in 50 mM Tris pH 8.0, 10 mM EDTA, 1% SDS, Protease Inhibitor, PMSF for 20 min. SDS concentration was reduced before sonication by the addition of 300 uL IP Dilution Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 150 mM NaCl, 1% Triston X-100, 0.01% SDS, Protease Inhibitor, PMSF), after which samples were sonicated for 60 minutes (30 seconds on, 30 seconds off cycle, 100% amplitude) using a Qsonica Q800R2 Sonicator. Insoluble fractions were removed via spin, and the supernatant was removed of non-specific binding chromatin via rotation with preclearing solution (3.7 mL IP Dilution Buffer, 0.5 mL Nuclear Lysis Buffer, 175 uL of Agarose Protein A/G beads, and 50 ug Rabbit IgG) for 2 hours at 4°C. Beads were pelleted and 4.7 mL of supernatant was removed. 200 uL of supernatant was retained as input control (stored at -20°C) while the remaining 4.5 mL was transferred to the beads that had been pre-bound with the H3K27ac antibody overnight; the IP reaction then rotated overnight again at 4°C. Bound bead complexes were washed once with 1 mL IP Wash Buffer 1 (20 mM Tris pH 8.0, 2 mM EDTA, 50 mM NaCl, 1% Triton X-100, 0.1% SDS), twice with 1 mL High-Salt Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 500 mM NaCl, 1% Triton X-100, 0.01% SDS), once with IP Wash Buffer 2 (10 mM Tris pH 8.0, 1 mM EDTA, 0.25 M LiCl, 1% NP-40/Igepal, 1% Na-deoxycholate), and finally twice with 1x TE. Complexes were eluted by twice resuspending bound beads in 110 uL Elution Buffer (100 mM NaHCO3, 1% SDS), pelleting the beads after each elution and transferring 100 uL supernatant to a new tube. Finally, 12 uL of 5M NaCl and 20 ug RNase A were added to both 200 uL IP and input samples and incubated at 65 degrees for 1 hour, followed by the addition of 60 ug of Proteinase K and overnight incubation at 65 degrees. DNA was isolated via phenol-chloroform extraction and ethanol precipitation and concentration was quantified using Qubit fluorometer. ChIP-seq libraries were prepared for sequencing using the NEBNext Ultra II DNA Library Prep Kit (NEB# E7645S), following manufacturer's protocol with the following user-chosen specifications. 3 ng DNA from all IP and input samples was used as starting material. NEBNext Adaptors were diluted 15x in 10 mM Tris-HCL, pH 8.0 with 10 mM NaCl prior to adaptor ligation. Large DNA fragments were removed via a size selection by adding 15 uL of AMPure XP beads at the first bead addition step and 87 uL of beads at the second bead addition step. Size-selected DNA was amplified using 9 cycles of PCR enrichment. The size-range of the final libraries was confirmed to be between 200-1000 bp using an Agilent Bioanalyzer High Sensitivity DNA test. H3K27ac enrichment was confirmed prior to sequencing by querying the IP/input qPCR enrichment of primer pairs designed to the Arc, Synaptotagmin-1, and Tcf25 promoter regions. Library concentrations were calculated and normalized using the KAPA Illumina Library Quantification Kit (#KK4835) so that libraries could be equally pooled before sequencing 75 bp single-end reads on the NextSeq500. All IP libraries were sequenced to a depth greater than 48 million reads and all input libraries were sequenced to greater than 67 million reads. 5C-seq: Neuronal cultures were formaldehyde fixed as described for ChIP-seq and stored at -80oC. For each condition (Bic, Untreat, TTX), in situ 3C was performed on 4 replicates (divided evenly across two animal/culture batches) of 4-5 million cells. Briefly, cells were thawed on ice and resuspended (gently) in 250 uL of lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630) with 50 uL protease inhibitors (Sigma P8340). Cell suspension was incubated on ice for 15 minutes and pelleted. Pelleted nuclei were washed once in lysis buffer (resuspension and spin), then resuspended and incubated in 50 uL of 0.5% SDS at 62oC for 10 min. SDS was inactivated via the addition of 145 uL H2O, 25 uL 10% Triton X-100, and incubation at 37oC for 15 min. Subsequently, chromatin was digested overnight at 37oC with the addition of 25 uL 10X NEBuffer2 and 100U (5 uL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62oC to inactivate the HindIII. Chromatin was re-ligated via the addition of 100 uL 10% Triton X-100, 120 uL NEB T4 DNA Ligation buffer (NEB B0202S), 12 uL 10 mg/mL BSA, 718 uL H2O, and 2000 U (5 uL) of T4 DNA Ligase (NEB M0202S) and incubation at 16oC for 2 hours (NOTE: This is a deviation from in situ HiC (Rao et al. 2010) in order to promote sticky-end ligation over blunt-end). Following ligation nuclei were pelleted, resuspended in 300 uL of 10 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 1% SDS, plus 25 uL of 20 mg/mL proteinase K (NEB P8107), and incubated at 65oC for 4 hours at which point an additional 25 uL of proteinase K was added and incubated overnight. 3C templates were isolated next day via RNaseA treatment, phenol-chloroform extraction, ethanol precipitation, and Amicon filtration (Millipore MFC5030BKS) (for more details see Beagan et al. 2016). Template size distribution and quantity were assessed with a 0.8% agarose gel. 5C primers were designed according to the double-alternating design scheme using the My5C primer design software (http://my5c.umassmed.edu/my5Cprimers/5C.php)10 with universal “Emulsion” primer tails. Regions were designed to capture TAD structures immediately surrounding the genes of interest (Bdnf, Fos, Arc, Neurexin-1, Neuroligin-3, Synaptotagmin-1) in published mouse cortex HiC data. 5C reactions were carried out as previously described. 600 ng (~200,000 genome copies) of 3C template for each replicate was mixed with 1 fmole of each</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>303759974</ID>
          <LABEL>GSM3759974</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM3759975" accession="SRX5818745">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX5818745</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM3759975</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM3759975: DIV5 RNA Rep3; Mus musculus; RNA-Seq</TITLE>
    <STUDY_REF accession="SRP197612" refname="GSE131025">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS4747497">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS4747497</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM3759975</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>RNA-Seq</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>cDNA</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>RNA-seq: At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. RNA-seq:We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library. ChIP-seq: At DIV16, neuronal cultures were fixed in 1% formaldehyde for 10 minutes (room temp) via the addition (1:10 vol/vol) of the following fixation solution: 50 mM Hepes-KOH (pH 7.5), 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 11% Formaldehyde. Fixation was quenched via the addition of 2.5 M glycine (1:20 vol/vol) and scraped into pellets of 8 million cells. Each pellet was washed once with cold PBS, flash frozen, and stored at -80oC. Immunoprecipitation was performed as described previously (Beagan et al., 2016) with slight modifications. Briefly, IP reactions were prepared a day prior to cell lysis by combining 20 uL of protein A and protein G conjugated agarose beads (Invitrogen# 15918-014 and 15920-010, respectively) with 10 uL of anti-H3K27ac antibody (Abcam# ab4729) in 1 mL of cold PBS and rotated overnight. The next day cell pellets were resuspended in 1 mL lysis buffer (10 mM Tris pH 8.0, 10 mM NaCl, 0.2% NP-40/Igepal, Protease Inhibitor, PMSF) and incubated on ice for 10 min. Cells were further lysed with 30 strokes of a dounce homogenizer (pestle A) and then nuclei were pelleted. Nuclei were lysed on ice in 50 mM Tris pH 8.0, 10 mM EDTA, 1% SDS, Protease Inhibitor, PMSF for 20 min. SDS concentration was reduced before sonication by the addition of 300 uL IP Dilution Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 150 mM NaCl, 1% Triston X-100, 0.01% SDS, Protease Inhibitor, PMSF), after which samples were sonicated for 60 minutes (30 seconds on, 30 seconds off cycle, 100% amplitude) using a Qsonica Q800R2 Sonicator. Insoluble fractions were removed via spin, and the supernatant was removed of non-specific binding chromatin via rotation with preclearing solution (3.7 mL IP Dilution Buffer, 0.5 mL Nuclear Lysis Buffer, 175 uL of Agarose Protein A/G beads, and 50 ug Rabbit IgG) for 2 hours at 4°C. Beads were pelleted and 4.7 mL of supernatant was removed. 200 uL of supernatant was retained as input control (stored at -20°C) while the remaining 4.5 mL was transferred to the beads that had been pre-bound with the H3K27ac antibody overnight; the IP reaction then rotated overnight again at 4°C. Bound bead complexes were washed once with 1 mL IP Wash Buffer 1 (20 mM Tris pH 8.0, 2 mM EDTA, 50 mM NaCl, 1% Triton X-100, 0.1% SDS), twice with 1 mL High-Salt Buffer (20 mM Tris pH 8.0, 2 mM EDTA, 500 mM NaCl, 1% Triton X-100, 0.01% SDS), once with IP Wash Buffer 2 (10 mM Tris pH 8.0, 1 mM EDTA, 0.25 M LiCl, 1% NP-40/Igepal, 1% Na-deoxycholate), and finally twice with 1x TE. Complexes were eluted by twice resuspending bound beads in 110 uL Elution Buffer (100 mM NaHCO3, 1% SDS), pelleting the beads after each elution and transferring 100 uL supernatant to a new tube. Finally, 12 uL of 5M NaCl and 20 ug RNase A were added to both 200 uL IP and input samples and incubated at 65 degrees for 1 hour, followed by the addition of 60 ug of Proteinase K and overnight incubation at 65 degrees. DNA was isolated via phenol-chloroform extraction and ethanol precipitation and concentration was quantified using Qubit fluorometer. ChIP-seq libraries were prepared for sequencing using the NEBNext Ultra II DNA Library Prep Kit (NEB# E7645S), following manufacturer's protocol with the following user-chosen specifications. 3 ng DNA from all IP and input samples was used as starting material. NEBNext Adaptors were diluted 15x in 10 mM Tris-HCL, pH 8.0 with 10 mM NaCl prior to adaptor ligation. Large DNA fragments were removed via a size selection by adding 15 uL of AMPure XP beads at the first bead addition step and 87 uL of beads at the second bead addition step. Size-selected DNA was amplified using 9 cycles of PCR enrichment. The size-range of the final libraries was confirmed to be between 200-1000 bp using an Agilent Bioanalyzer High Sensitivity DNA test. H3K27ac enrichment was confirmed prior to sequencing by querying the IP/input qPCR enrichment of primer pairs designed to the Arc, Synaptotagmin-1, and Tcf25 promoter regions. Library concentrations were calculated and normalized using the KAPA Illumina Library Quantification Kit (#KK4835) so that libraries could be equally pooled before sequencing 75 bp single-end reads on the NextSeq500. All IP libraries were sequenced to a depth greater than 48 million reads and all input libraries were sequenced to greater than 67 million reads. 5C-seq: Neuronal cultures were formaldehyde fixed as described for ChIP-seq and stored at -80oC. For each condition (Bic, Untreat, TTX), in situ 3C was performed on 4 replicates (divided evenly across two animal/culture batches) of 4-5 million cells. Briefly, cells were thawed on ice and resuspended (gently) in 250 uL of lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630) with 50 uL protease inhibitors (Sigma P8340). Cell suspension was incubated on ice for 15 minutes and pelleted. Pelleted nuclei were washed once in lysis buffer (resuspension and spin), then resuspended and incubated in 50 uL of 0.5% SDS at 62oC for 10 min. SDS was inactivated via the addition of 145 uL H2O, 25 uL 10% Triton X-100, and incubation at 37oC for 15 min. Subsequently, chromatin was digested overnight at 37oC with the addition of 25 uL 10X NEBuffer2 and 100U (5 uL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62oC to inactivate the HindIII. Chromatin was re-ligated via the addition of 100 uL 10% Triton X-100, 120 uL NEB T4 DNA Ligation buffer (NEB B0202S), 12 uL 10 mg/mL BSA, 718 uL H2O, and 2000 U (5 uL) of T4 DNA Ligase (NEB M0202S) and incubation at 16oC for 2 hours (NOTE: This is a deviation from in situ HiC (Rao et al. 2010) in order to promote sticky-end ligation over blunt-end). Following ligation nuclei were pelleted, resuspended in 300 uL of 10 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 1% SDS, plus 25 uL of 20 mg/mL proteinase K (NEB P8107), and incubated at 65oC for 4 hours at which point an additional 25 uL of proteinase K was added and incubated overnight. 3C templates were isolated next day via RNaseA treatment, phenol-chloroform extraction, ethanol precipitation, and Amicon filtration (Millipore MFC5030BKS) (for more details see Beagan et al. 2016). Template size distribution and quantity were assessed with a 0.8% agarose gel. 5C primers were designed according to the double-alternating design scheme using the My5C primer design software (http://my5c.umassmed.edu/my5Cprimers/5C.php)10 with universal “Emulsion” primer tails. Regions were designed to capture TAD structures immediately surrounding the genes of interest (Bdnf, Fos, Arc, Neurexin-1, Neuroligin-3, Synaptotagmin-1) in published mouse cortex HiC data. 5C reactions were carried out as previously described. 600 ng (~200,000 genome copies) of 3C template for each replicate was mixed with 1 fmole of each</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>303759975</ID>
          <LABEL>GSM3759975</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM4107826" accession="SRX6950345">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX6950345</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM4107826</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM4107826: 000min 5C; Mus musculus; OTHER</TITLE>
    <STUDY_REF accession="SRP197612">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
        <EXTERNAL_ID namespace="BioProject">PRJNA542363</EXTERNAL_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS5478082">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS5478082</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM4107826</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>OTHER</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>GENOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>other</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>Neuronal cultures were formaldehyde fixed as described for ChIP-seq and stored at -80oC. For each condition (Bic, Untreat, TTX), in situ 3C was performed on 4 replicates (divided evenly across two animal/culture batches) of 4-5 million cells. Briefly, cells were thawed on ice and resuspended (gently) in 250 uL of lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630) with 50 uL protease inhibitors (Sigma P8340). Cell suspension was incubated on ice for 15 minutes and pelleted. Pelleted nuclei were washed once in lysis buffer (resuspension and spin), then resuspended and incubated in 50 uL of 0.5% SDS at 62oC for 10 min. SDS was inactivated via the addition of 145 uL H2O, 25 uL 10% Triton X-100, and incubation at 37oC for 15 min. Subsequently, chromatin was digested overnight at 37oC with the addition of 25 uL 10X NEBuffer2 and 100U (5 uL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62oC to inactivate the HindIII. Chromatin was re-ligated via the addition of 100 uL 10% Triton X-100, 120 uL NEB T4 DNA Ligation buffer (NEB B0202S), 12 uL 10 mg/mL BSA, 718 uL H2O, and 2000 U (5 uL) of T4 DNA Ligase (NEB M0202S) and incubation at 16oC for 2 hours (NOTE: This is a deviation from in situ HiC (Rao et al. 2010) in order to promote sticky-end ligation over blunt-end). Following ligation nuclei were pelleted, resuspended in 300 uL of 10 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 1% SDS, plus 25 uL of 20 mg/mL proteinase K (NEB P8107), and incubated at 65oC for 4 hours at which point an additional 25 uL of proteinase K was added and incubated overnight. 3C templates were isolated next day via RNaseA treatment, phenol-chloroform extraction, ethanol precipitation, and Amicon filtration (Millipore MFC5030BKS) (for more details see Beagan et al. 2016). Template size distribution and quantity were assessed with a 0.8% agarose gel. 5C primers were designed according to the double-alternating design scheme using the My5C primer design software (http://my5c.umassmed.edu/my5Cprimers/5C.php)10 with universal “Emulsion” primer tails. Regions were designed to capture TAD structures immediately surrounding the genes of interest (Bdnf, Fos, Arc, Neurexin-1, Neuroligin-3, Synaptotagmin-1) in published mouse cortex HiC data. 5C reactions were carried out as previously described. 600 ng (~200,000 genome copies) of 3C template for each replicate was mixed with 1 fmole of each 5C primer and 0.9 ug of salmon sperm DNA in 1x NEB4 buffer, denatured at 95oC for 5 min, then incubated at 55oc for 16 hours. Primers which had then annealed in adjacent positions were ligated through the addition of 10 U (20 uL) Taq ligase (NEB M0208L) and incubation at 55oC for 1 hour then 75oC for 10 min. Successfully ligated primer-primer pairs were amplified using primers designed to the universal tails (FOR = CCTCTC TATGGGCAGTCGGTGAT, REV = CTGCCCCGGGTTCCTCATTCTCT) across 30 PCR cycles using Phusion High-Fidelity Polymerase. Presence of a single PCR product at 100 bp was confirmed via agarose gel, then residual DNA &lt;100 bp was removed through AmpureXP bead cleanup at a ratio of 2:1 beads:DNA (vol/vol). 100 ng of the resulting 5C product was prepared for sequencing on the Illumina NextSeq 500 using the NEBNext Ultra DNA Library Prep Kit (NEB E7370) following the manufacturer's instructions with the following parameter selections: during size selection, 70 uL of AMPure beads was added at the first step and 25 at the second step; linkered fragments were amplified using 8 PCR cycles. A single band at 220 bp in each final library was confirmed using an Agilent DNA 1000 Bioanalyzer chip, and library concentration was determined using the KAPA Illumina Library Quantification Kit (#KK4835). Finally, libraries were evenly pooled and sequenced on the Illumina NextSeq 500 using 37 bp paired-end reads to read depths of between 11 and 30 million reads per replicate.</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>304107826</ID>
          <LABEL>GSM4107826</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
    <EXPERIMENT_ATTRIBUTES>
      <EXPERIMENT_ATTRIBUTE>
        <TAG>GEO Accession</TAG>
        <VALUE>GSM4107826</VALUE>
      </EXPERIMENT_ATTRIBUTE>
    </EXPERIMENT_ATTRIBUTES>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM4107827" accession="SRX6950346">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX6950346</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM4107827</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM4107827: 005min 5C; Mus musculus; OTHER</TITLE>
    <STUDY_REF accession="SRP197612">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
        <EXTERNAL_ID namespace="BioProject">PRJNA542363</EXTERNAL_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS5478083">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS5478083</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM4107827</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>OTHER</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>GENOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>other</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>Neuronal cultures were formaldehyde fixed as described for ChIP-seq and stored at -80oC. For each condition (Bic, Untreat, TTX), in situ 3C was performed on 4 replicates (divided evenly across two animal/culture batches) of 4-5 million cells. Briefly, cells were thawed on ice and resuspended (gently) in 250 uL of lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630) with 50 uL protease inhibitors (Sigma P8340). Cell suspension was incubated on ice for 15 minutes and pelleted. Pelleted nuclei were washed once in lysis buffer (resuspension and spin), then resuspended and incubated in 50 uL of 0.5% SDS at 62oC for 10 min. SDS was inactivated via the addition of 145 uL H2O, 25 uL 10% Triton X-100, and incubation at 37oC for 15 min. Subsequently, chromatin was digested overnight at 37oC with the addition of 25 uL 10X NEBuffer2 and 100U (5 uL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62oC to inactivate the HindIII. Chromatin was re-ligated via the addition of 100 uL 10% Triton X-100, 120 uL NEB T4 DNA Ligation buffer (NEB B0202S), 12 uL 10 mg/mL BSA, 718 uL H2O, and 2000 U (5 uL) of T4 DNA Ligase (NEB M0202S) and incubation at 16oC for 2 hours (NOTE: This is a deviation from in situ HiC (Rao et al. 2010) in order to promote sticky-end ligation over blunt-end). Following ligation nuclei were pelleted, resuspended in 300 uL of 10 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 1% SDS, plus 25 uL of 20 mg/mL proteinase K (NEB P8107), and incubated at 65oC for 4 hours at which point an additional 25 uL of proteinase K was added and incubated overnight. 3C templates were isolated next day via RNaseA treatment, phenol-chloroform extraction, ethanol precipitation, and Amicon filtration (Millipore MFC5030BKS) (for more details see Beagan et al. 2016). Template size distribution and quantity were assessed with a 0.8% agarose gel. 5C primers were designed according to the double-alternating design scheme using the My5C primer design software (http://my5c.umassmed.edu/my5Cprimers/5C.php)10 with universal “Emulsion” primer tails. Regions were designed to capture TAD structures immediately surrounding the genes of interest (Bdnf, Fos, Arc, Neurexin-1, Neuroligin-3, Synaptotagmin-1) in published mouse cortex HiC data. 5C reactions were carried out as previously described. 600 ng (~200,000 genome copies) of 3C template for each replicate was mixed with 1 fmole of each 5C primer and 0.9 ug of salmon sperm DNA in 1x NEB4 buffer, denatured at 95oC for 5 min, then incubated at 55oc for 16 hours. Primers which had then annealed in adjacent positions were ligated through the addition of 10 U (20 uL) Taq ligase (NEB M0208L) and incubation at 55oC for 1 hour then 75oC for 10 min. Successfully ligated primer-primer pairs were amplified using primers designed to the universal tails (FOR = CCTCTC TATGGGCAGTCGGTGAT, REV = CTGCCCCGGGTTCCTCATTCTCT) across 30 PCR cycles using Phusion High-Fidelity Polymerase. Presence of a single PCR product at 100 bp was confirmed via agarose gel, then residual DNA &lt;100 bp was removed through AmpureXP bead cleanup at a ratio of 2:1 beads:DNA (vol/vol). 100 ng of the resulting 5C product was prepared for sequencing on the Illumina NextSeq 500 using the NEBNext Ultra DNA Library Prep Kit (NEB E7370) following the manufacturer's instructions with the following parameter selections: during size selection, 70 uL of AMPure beads was added at the first step and 25 at the second step; linkered fragments were amplified using 8 PCR cycles. A single band at 220 bp in each final library was confirmed using an Agilent DNA 1000 Bioanalyzer chip, and library concentration was determined using the KAPA Illumina Library Quantification Kit (#KK4835). Finally, libraries were evenly pooled and sequenced on the Illumina NextSeq 500 using 37 bp paired-end reads to read depths of between 11 and 30 million reads per replicate.</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>304107827</ID>
          <LABEL>GSM4107827</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
    <EXPERIMENT_ATTRIBUTES>
      <EXPERIMENT_ATTRIBUTE>
        <TAG>GEO Accession</TAG>
        <VALUE>GSM4107827</VALUE>
      </EXPERIMENT_ATTRIBUTE>
    </EXPERIMENT_ATTRIBUTES>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM4107828" accession="SRX6950347">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX6950347</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM4107828</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM4107828: 020min 5C; Mus musculus; OTHER</TITLE>
    <STUDY_REF accession="SRP197612">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
        <EXTERNAL_ID namespace="BioProject">PRJNA542363</EXTERNAL_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS5478084">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS5478084</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM4107828</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>OTHER</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>GENOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>other</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>Neuronal cultures were formaldehyde fixed as described for ChIP-seq and stored at -80oC. For each condition (Bic, Untreat, TTX), in situ 3C was performed on 4 replicates (divided evenly across two animal/culture batches) of 4-5 million cells. Briefly, cells were thawed on ice and resuspended (gently) in 250 uL of lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630) with 50 uL protease inhibitors (Sigma P8340). Cell suspension was incubated on ice for 15 minutes and pelleted. Pelleted nuclei were washed once in lysis buffer (resuspension and spin), then resuspended and incubated in 50 uL of 0.5% SDS at 62oC for 10 min. SDS was inactivated via the addition of 145 uL H2O, 25 uL 10% Triton X-100, and incubation at 37oC for 15 min. Subsequently, chromatin was digested overnight at 37oC with the addition of 25 uL 10X NEBuffer2 and 100U (5 uL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62oC to inactivate the HindIII. Chromatin was re-ligated via the addition of 100 uL 10% Triton X-100, 120 uL NEB T4 DNA Ligation buffer (NEB B0202S), 12 uL 10 mg/mL BSA, 718 uL H2O, and 2000 U (5 uL) of T4 DNA Ligase (NEB M0202S) and incubation at 16oC for 2 hours (NOTE: This is a deviation from in situ HiC (Rao et al. 2010) in order to promote sticky-end ligation over blunt-end). Following ligation nuclei were pelleted, resuspended in 300 uL of 10 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 1% SDS, plus 25 uL of 20 mg/mL proteinase K (NEB P8107), and incubated at 65oC for 4 hours at which point an additional 25 uL of proteinase K was added and incubated overnight. 3C templates were isolated next day via RNaseA treatment, phenol-chloroform extraction, ethanol precipitation, and Amicon filtration (Millipore MFC5030BKS) (for more details see Beagan et al. 2016). Template size distribution and quantity were assessed with a 0.8% agarose gel. 5C primers were designed according to the double-alternating design scheme using the My5C primer design software (http://my5c.umassmed.edu/my5Cprimers/5C.php)10 with universal “Emulsion” primer tails. Regions were designed to capture TAD structures immediately surrounding the genes of interest (Bdnf, Fos, Arc, Neurexin-1, Neuroligin-3, Synaptotagmin-1) in published mouse cortex HiC data. 5C reactions were carried out as previously described. 600 ng (~200,000 genome copies) of 3C template for each replicate was mixed with 1 fmole of each 5C primer and 0.9 ug of salmon sperm DNA in 1x NEB4 buffer, denatured at 95oC for 5 min, then incubated at 55oc for 16 hours. Primers which had then annealed in adjacent positions were ligated through the addition of 10 U (20 uL) Taq ligase (NEB M0208L) and incubation at 55oC for 1 hour then 75oC for 10 min. Successfully ligated primer-primer pairs were amplified using primers designed to the universal tails (FOR = CCTCTC TATGGGCAGTCGGTGAT, REV = CTGCCCCGGGTTCCTCATTCTCT) across 30 PCR cycles using Phusion High-Fidelity Polymerase. Presence of a single PCR product at 100 bp was confirmed via agarose gel, then residual DNA &lt;100 bp was removed through AmpureXP bead cleanup at a ratio of 2:1 beads:DNA (vol/vol). 100 ng of the resulting 5C product was prepared for sequencing on the Illumina NextSeq 500 using the NEBNext Ultra DNA Library Prep Kit (NEB E7370) following the manufacturer's instructions with the following parameter selections: during size selection, 70 uL of AMPure beads was added at the first step and 25 at the second step; linkered fragments were amplified using 8 PCR cycles. A single band at 220 bp in each final library was confirmed using an Agilent DNA 1000 Bioanalyzer chip, and library concentration was determined using the KAPA Illumina Library Quantification Kit (#KK4835). Finally, libraries were evenly pooled and sequenced on the Illumina NextSeq 500 using 37 bp paired-end reads to read depths of between 11 and 30 million reads per replicate.</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>304107828</ID>
          <LABEL>GSM4107828</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
    <EXPERIMENT_ATTRIBUTES>
      <EXPERIMENT_ATTRIBUTE>
        <TAG>GEO Accession</TAG>
        <VALUE>GSM4107828</VALUE>
      </EXPERIMENT_ATTRIBUTE>
    </EXPERIMENT_ATTRIBUTES>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM4107829" accession="SRX6950348">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX6950348</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM4107829</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM4107829: 060min 5C; Mus musculus; OTHER</TITLE>
    <STUDY_REF accession="SRP197612">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
        <EXTERNAL_ID namespace="BioProject">PRJNA542363</EXTERNAL_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS5478085">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS5478085</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM4107829</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>OTHER</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>GENOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>other</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>Neuronal cultures were formaldehyde fixed as described for ChIP-seq and stored at -80oC. For each condition (Bic, Untreat, TTX), in situ 3C was performed on 4 replicates (divided evenly across two animal/culture batches) of 4-5 million cells. Briefly, cells were thawed on ice and resuspended (gently) in 250 uL of lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630) with 50 uL protease inhibitors (Sigma P8340). Cell suspension was incubated on ice for 15 minutes and pelleted. Pelleted nuclei were washed once in lysis buffer (resuspension and spin), then resuspended and incubated in 50 uL of 0.5% SDS at 62oC for 10 min. SDS was inactivated via the addition of 145 uL H2O, 25 uL 10% Triton X-100, and incubation at 37oC for 15 min. Subsequently, chromatin was digested overnight at 37oC with the addition of 25 uL 10X NEBuffer2 and 100U (5 uL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62oC to inactivate the HindIII. Chromatin was re-ligated via the addition of 100 uL 10% Triton X-100, 120 uL NEB T4 DNA Ligation buffer (NEB B0202S), 12 uL 10 mg/mL BSA, 718 uL H2O, and 2000 U (5 uL) of T4 DNA Ligase (NEB M0202S) and incubation at 16oC for 2 hours (NOTE: This is a deviation from in situ HiC (Rao et al. 2010) in order to promote sticky-end ligation over blunt-end). Following ligation nuclei were pelleted, resuspended in 300 uL of 10 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 1% SDS, plus 25 uL of 20 mg/mL proteinase K (NEB P8107), and incubated at 65oC for 4 hours at which point an additional 25 uL of proteinase K was added and incubated overnight. 3C templates were isolated next day via RNaseA treatment, phenol-chloroform extraction, ethanol precipitation, and Amicon filtration (Millipore MFC5030BKS) (for more details see Beagan et al. 2016). Template size distribution and quantity were assessed with a 0.8% agarose gel. 5C primers were designed according to the double-alternating design scheme using the My5C primer design software (http://my5c.umassmed.edu/my5Cprimers/5C.php)10 with universal “Emulsion” primer tails. Regions were designed to capture TAD structures immediately surrounding the genes of interest (Bdnf, Fos, Arc, Neurexin-1, Neuroligin-3, Synaptotagmin-1) in published mouse cortex HiC data. 5C reactions were carried out as previously described. 600 ng (~200,000 genome copies) of 3C template for each replicate was mixed with 1 fmole of each 5C primer and 0.9 ug of salmon sperm DNA in 1x NEB4 buffer, denatured at 95oC for 5 min, then incubated at 55oc for 16 hours. Primers which had then annealed in adjacent positions were ligated through the addition of 10 U (20 uL) Taq ligase (NEB M0208L) and incubation at 55oC for 1 hour then 75oC for 10 min. Successfully ligated primer-primer pairs were amplified using primers designed to the universal tails (FOR = CCTCTC TATGGGCAGTCGGTGAT, REV = CTGCCCCGGGTTCCTCATTCTCT) across 30 PCR cycles using Phusion High-Fidelity Polymerase. Presence of a single PCR product at 100 bp was confirmed via agarose gel, then residual DNA &lt;100 bp was removed through AmpureXP bead cleanup at a ratio of 2:1 beads:DNA (vol/vol). 100 ng of the resulting 5C product was prepared for sequencing on the Illumina NextSeq 500 using the NEBNext Ultra DNA Library Prep Kit (NEB E7370) following the manufacturer's instructions with the following parameter selections: during size selection, 70 uL of AMPure beads was added at the first step and 25 at the second step; linkered fragments were amplified using 8 PCR cycles. A single band at 220 bp in each final library was confirmed using an Agilent DNA 1000 Bioanalyzer chip, and library concentration was determined using the KAPA Illumina Library Quantification Kit (#KK4835). Finally, libraries were evenly pooled and sequenced on the Illumina NextSeq 500 using 37 bp paired-end reads to read depths of between 11 and 30 million reads per replicate.</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>304107829</ID>
          <LABEL>GSM4107829</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
    <EXPERIMENT_ATTRIBUTES>
      <EXPERIMENT_ATTRIBUTE>
        <TAG>GEO Accession</TAG>
        <VALUE>GSM4107829</VALUE>
      </EXPERIMENT_ATTRIBUTE>
    </EXPERIMENT_ATTRIBUTES>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM4107830" accession="SRX6950349">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX6950349</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM4107830</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM4107830: 360min 5C; Mus musculus; OTHER</TITLE>
    <STUDY_REF accession="SRP197612">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
        <EXTERNAL_ID namespace="BioProject">PRJNA542363</EXTERNAL_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS5478086">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS5478086</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM4107830</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>OTHER</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>GENOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>other</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>Neuronal cultures were formaldehyde fixed as described for ChIP-seq and stored at -80oC. For each condition (Bic, Untreat, TTX), in situ 3C was performed on 4 replicates (divided evenly across two animal/culture batches) of 4-5 million cells. Briefly, cells were thawed on ice and resuspended (gently) in 250 uL of lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630) with 50 uL protease inhibitors (Sigma P8340). Cell suspension was incubated on ice for 15 minutes and pelleted. Pelleted nuclei were washed once in lysis buffer (resuspension and spin), then resuspended and incubated in 50 uL of 0.5% SDS at 62oC for 10 min. SDS was inactivated via the addition of 145 uL H2O, 25 uL 10% Triton X-100, and incubation at 37oC for 15 min. Subsequently, chromatin was digested overnight at 37oC with the addition of 25 uL 10X NEBuffer2 and 100U (5 uL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62oC to inactivate the HindIII. Chromatin was re-ligated via the addition of 100 uL 10% Triton X-100, 120 uL NEB T4 DNA Ligation buffer (NEB B0202S), 12 uL 10 mg/mL BSA, 718 uL H2O, and 2000 U (5 uL) of T4 DNA Ligase (NEB M0202S) and incubation at 16oC for 2 hours (NOTE: This is a deviation from in situ HiC (Rao et al. 2010) in order to promote sticky-end ligation over blunt-end). Following ligation nuclei were pelleted, resuspended in 300 uL of 10 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 1% SDS, plus 25 uL of 20 mg/mL proteinase K (NEB P8107), and incubated at 65oC for 4 hours at which point an additional 25 uL of proteinase K was added and incubated overnight. 3C templates were isolated next day via RNaseA treatment, phenol-chloroform extraction, ethanol precipitation, and Amicon filtration (Millipore MFC5030BKS) (for more details see Beagan et al. 2016). Template size distribution and quantity were assessed with a 0.8% agarose gel. 5C primers were designed according to the double-alternating design scheme using the My5C primer design software (http://my5c.umassmed.edu/my5Cprimers/5C.php)10 with universal “Emulsion” primer tails. Regions were designed to capture TAD structures immediately surrounding the genes of interest (Bdnf, Fos, Arc, Neurexin-1, Neuroligin-3, Synaptotagmin-1) in published mouse cortex HiC data. 5C reactions were carried out as previously described. 600 ng (~200,000 genome copies) of 3C template for each replicate was mixed with 1 fmole of each 5C primer and 0.9 ug of salmon sperm DNA in 1x NEB4 buffer, denatured at 95oC for 5 min, then incubated at 55oc for 16 hours. Primers which had then annealed in adjacent positions were ligated through the addition of 10 U (20 uL) Taq ligase (NEB M0208L) and incubation at 55oC for 1 hour then 75oC for 10 min. Successfully ligated primer-primer pairs were amplified using primers designed to the universal tails (FOR = CCTCTC TATGGGCAGTCGGTGAT, REV = CTGCCCCGGGTTCCTCATTCTCT) across 30 PCR cycles using Phusion High-Fidelity Polymerase. Presence of a single PCR product at 100 bp was confirmed via agarose gel, then residual DNA &lt;100 bp was removed through AmpureXP bead cleanup at a ratio of 2:1 beads:DNA (vol/vol). 100 ng of the resulting 5C product was prepared for sequencing on the Illumina NextSeq 500 using the NEBNext Ultra DNA Library Prep Kit (NEB E7370) following the manufacturer's instructions with the following parameter selections: during size selection, 70 uL of AMPure beads was added at the first step and 25 at the second step; linkered fragments were amplified using 8 PCR cycles. A single band at 220 bp in each final library was confirmed using an Agilent DNA 1000 Bioanalyzer chip, and library concentration was determined using the KAPA Illumina Library Quantification Kit (#KK4835). Finally, libraries were evenly pooled and sequenced on the Illumina NextSeq 500 using 37 bp paired-end reads to read depths of between 11 and 30 million reads per replicate.</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>304107830</ID>
          <LABEL>GSM4107830</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
    <EXPERIMENT_ATTRIBUTES>
      <EXPERIMENT_ATTRIBUTE>
        <TAG>GEO Accession</TAG>
        <VALUE>GSM4107830</VALUE>
      </EXPERIMENT_ATTRIBUTE>
    </EXPERIMENT_ATTRIBUTES>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM4107831" accession="SRX6950350">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX6950350</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM4107831</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM4107831: 000min RNA Rep1; Mus musculus; RNA-Seq</TITLE>
    <STUDY_REF accession="SRP197612">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
        <EXTERNAL_ID namespace="BioProject">PRJNA542363</EXTERNAL_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS5478087">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS5478087</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM4107831</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>RNA-Seq</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>cDNA</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library.</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>304107831</ID>
          <LABEL>GSM4107831</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
    <EXPERIMENT_ATTRIBUTES>
      <EXPERIMENT_ATTRIBUTE>
        <TAG>GEO Accession</TAG>
        <VALUE>GSM4107831</VALUE>
      </EXPERIMENT_ATTRIBUTE>
    </EXPERIMENT_ATTRIBUTES>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM4107832" accession="SRX6950351">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX6950351</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM4107832</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM4107832: 000min RNA Rep2; Mus musculus; RNA-Seq</TITLE>
    <STUDY_REF accession="SRP197612">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
        <EXTERNAL_ID namespace="BioProject">PRJNA542363</EXTERNAL_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS5478088">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS5478088</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM4107832</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>RNA-Seq</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>cDNA</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library.</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>304107832</ID>
          <LABEL>GSM4107832</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
    <EXPERIMENT_ATTRIBUTES>
      <EXPERIMENT_ATTRIBUTE>
        <TAG>GEO Accession</TAG>
        <VALUE>GSM4107832</VALUE>
      </EXPERIMENT_ATTRIBUTE>
    </EXPERIMENT_ATTRIBUTES>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM4107833" accession="SRX6950352">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX6950352</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM4107833</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM4107833: 005min RNA Rep1; Mus musculus; RNA-Seq</TITLE>
    <STUDY_REF accession="SRP197612">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
        <EXTERNAL_ID namespace="BioProject">PRJNA542363</EXTERNAL_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS5478089">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS5478089</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM4107833</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>RNA-Seq</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>cDNA</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library.</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>304107833</ID>
          <LABEL>GSM4107833</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
    <EXPERIMENT_ATTRIBUTES>
      <EXPERIMENT_ATTRIBUTE>
        <TAG>GEO Accession</TAG>
        <VALUE>GSM4107833</VALUE>
      </EXPERIMENT_ATTRIBUTE>
    </EXPERIMENT_ATTRIBUTES>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM4107834" accession="SRX6950353">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX6950353</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM4107834</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM4107834: 020min RNA Rep1; Mus musculus; RNA-Seq</TITLE>
    <STUDY_REF accession="SRP197612">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
        <EXTERNAL_ID namespace="BioProject">PRJNA542363</EXTERNAL_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS5478090">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS5478090</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM4107834</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>RNA-Seq</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>cDNA</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library.</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>304107834</ID>
          <LABEL>GSM4107834</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
    <EXPERIMENT_ATTRIBUTES>
      <EXPERIMENT_ATTRIBUTE>
        <TAG>GEO Accession</TAG>
        <VALUE>GSM4107834</VALUE>
      </EXPERIMENT_ATTRIBUTE>
    </EXPERIMENT_ATTRIBUTES>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM4107835" accession="SRX6950354">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX6950354</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM4107835</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM4107835: 020min RNA Rep2; Mus musculus; RNA-Seq</TITLE>
    <STUDY_REF accession="SRP197612">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
        <EXTERNAL_ID namespace="BioProject">PRJNA542363</EXTERNAL_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS5478091">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS5478091</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM4107835</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>RNA-Seq</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>cDNA</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library.</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>304107835</ID>
          <LABEL>GSM4107835</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
    <EXPERIMENT_ATTRIBUTES>
      <EXPERIMENT_ATTRIBUTE>
        <TAG>GEO Accession</TAG>
        <VALUE>GSM4107835</VALUE>
      </EXPERIMENT_ATTRIBUTE>
    </EXPERIMENT_ATTRIBUTES>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM4107836" accession="SRX6950355">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX6950355</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM4107836</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM4107836: 060min RNA Rep1; Mus musculus; RNA-Seq</TITLE>
    <STUDY_REF accession="SRP197612">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
        <EXTERNAL_ID namespace="BioProject">PRJNA542363</EXTERNAL_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS5478092">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS5478092</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM4107836</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>RNA-Seq</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>cDNA</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library.</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>304107836</ID>
          <LABEL>GSM4107836</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
    <EXPERIMENT_ATTRIBUTES>
      <EXPERIMENT_ATTRIBUTE>
        <TAG>GEO Accession</TAG>
        <VALUE>GSM4107836</VALUE>
      </EXPERIMENT_ATTRIBUTE>
    </EXPERIMENT_ATTRIBUTES>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM4107837" accession="SRX6950356">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX6950356</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM4107837</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM4107837: 060min RNA Rep2; Mus musculus; RNA-Seq</TITLE>
    <STUDY_REF accession="SRP197612">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
        <EXTERNAL_ID namespace="BioProject">PRJNA542363</EXTERNAL_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS5478093">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS5478093</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM4107837</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>RNA-Seq</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>cDNA</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library.</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>304107837</ID>
          <LABEL>GSM4107837</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
    <EXPERIMENT_ATTRIBUTES>
      <EXPERIMENT_ATTRIBUTE>
        <TAG>GEO Accession</TAG>
        <VALUE>GSM4107837</VALUE>
      </EXPERIMENT_ATTRIBUTE>
    </EXPERIMENT_ATTRIBUTES>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM4107838" accession="SRX6950357">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX6950357</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM4107838</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM4107838: 360min RNA Rep1; Mus musculus; RNA-Seq</TITLE>
    <STUDY_REF accession="SRP197612">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
        <EXTERNAL_ID namespace="BioProject">PRJNA542363</EXTERNAL_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS5478094">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS5478094</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM4107838</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>RNA-Seq</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>cDNA</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library.</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>304107838</ID>
          <LABEL>GSM4107838</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
    <EXPERIMENT_ATTRIBUTES>
      <EXPERIMENT_ATTRIBUTE>
        <TAG>GEO Accession</TAG>
        <VALUE>GSM4107838</VALUE>
      </EXPERIMENT_ATTRIBUTE>
    </EXPERIMENT_ATTRIBUTES>
  </EXPERIMENT>
  <EXPERIMENT alias="GSM4107839" accession="SRX6950358">
    <IDENTIFIERS>
      <PRIMARY_ID>SRX6950358</PRIMARY_ID>
      <SUBMITTER_ID namespace="GEO">GSM4107839</SUBMITTER_ID>
    </IDENTIFIERS>
    <TITLE>GSM4107839: 360min RNA Rep2; Mus musculus; RNA-Seq</TITLE>
    <STUDY_REF accession="SRP197612">
      <IDENTIFIERS>
        <PRIMARY_ID>SRP197612</PRIMARY_ID>
        <EXTERNAL_ID namespace="BioProject">PRJNA542363</EXTERNAL_ID>
      </IDENTIFIERS>
    </STUDY_REF>
    <DESIGN>
      <DESIGN_DESCRIPTION/>
      <SAMPLE_DESCRIPTOR accession="SRS5478095">
        <IDENTIFIERS>
          <PRIMARY_ID>SRS5478095</PRIMARY_ID>
          <EXTERNAL_ID namespace="GEO">GSM4107839</EXTERNAL_ID>
        </IDENTIFIERS>
      </SAMPLE_DESCRIPTOR>
      <LIBRARY_DESCRIPTOR>
        <LIBRARY_STRATEGY>RNA-Seq</LIBRARY_STRATEGY>
        <LIBRARY_SOURCE>TRANSCRIPTOMIC</LIBRARY_SOURCE>
        <LIBRARY_SELECTION>cDNA</LIBRARY_SELECTION>
        <LIBRARY_LAYOUT>
          <PAIRED/>
        </LIBRARY_LAYOUT>
        <LIBRARY_CONSTRUCTION_PROTOCOL>At DIV5 and DIV16, 900,000 neurons were lysed in 1 mL Trizol (Thermo Fisher Scientific 15596026). Lysates were snap frozen and stored at -80oc until use. Total RNA was then isolated using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific AM1561) according to manufacturer's protocol and eluted from the spin-column using 100 uL nuclease-free water. Samples were DNase treated (Thermo Fisher Scientific AM1906) and tested for quality using an Agilent Bioanalyzer RNA chip. All samples produced an RNA Integrity Number (RIN) greater than 9. We utilized the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold (Illumina RS-122-2301) and prepared each RNA sample for sequencing according to the manufacturer's protocol. cDNA libraries were amplified across 15 PCR cycles followed by AMPure XP Bead clean-up (1:1 bead:solution ratio). Finally, the library sizes were confirmed to be between 200-500 bp using the BioAnalyzer before sequencing 75 bp paired-end reads on the Illumina NextSeq500. In order to minimize and identify technical variation, three replicates spanning two culture batches were prepared, pooled, and sequenced on three flow cells to depths of greater than 60 million reads per library.</LIBRARY_CONSTRUCTION_PROTOCOL>
      </LIBRARY_DESCRIPTOR>
    </DESIGN>
    <PLATFORM>
      <ILLUMINA>
        <INSTRUMENT_MODEL>NextSeq 500</INSTRUMENT_MODEL>
      </ILLUMINA>
    </PLATFORM>
    <EXPERIMENT_LINKS>
      <EXPERIMENT_LINK>
        <XREF_LINK>
          <DB>gds</DB>
          <ID>304107839</ID>
          <LABEL>GSM4107839</LABEL>
        </XREF_LINK>
      </EXPERIMENT_LINK>
    </EXPERIMENT_LINKS>
    <EXPERIMENT_ATTRIBUTES>
      <EXPERIMENT_ATTRIBUTE>
        <TAG>GEO Accession</TAG>
        <VALUE>GSM4107839</VALUE>
      </EXPERIMENT_ATTRIBUTE>
    </EXPERIMENT_ATTRIBUTES>
  </EXPERIMENT>
</EXPERIMENT_SET>
