SRX6455422 GSM3945688 SRP215460 SRS5112811 GSM3945688 RIP-Seq TRANSCRIPTOMIC other Cells were fractionated into nuclear and cytoplasmic fractions by resuspending in 3 mL mild hypotonic lysis buffer (10 mM TRIS-HCl pH 7.5, 50 mM NaCl, 3 mM MgCl2, 0.1% NP-40 and 10% glycerol) for 2 minutes and 5 minutes centrifugation at 400 g. The nuclear pellet was washed twice with 10 mL of the same buffer and lyzed with 1 mL of a RIPA buffer (150mM NaCl, 1% NP-40, 0.15 %DOX , 0.1 % SDS, 25 mM TRIS-HCl pH 7.5, Protease inhibitors, 1 U/μL RNAse T1 and 50 U/mL DNASE ) followed by sonication (3 X 10 sec; 60 % Amplitude on a VCX130 Vibra-Cell Ultrasonic Liquid Processor) and 30 minutes rotation at 4 oC. The lysate was cleared by centrifugation 10 minutes at 16000 G and diluted by addition of 2 volumes of 20mM TRIS-HCl pH 7.5. The FH-U2AF1/U2AF2 complex was Immunoprecipitated using the Anti-FLAG M2 Magnetic Beads (Sigma), treated with 1 U/mL RNase T1 (1/10000 Thermo Scientific RNase T1, EN0541) and washed 3 times with high salt wash buffer. To obtain the footprints of the U2AF complex 3' pre-adenylated adapter (5'-rAppNNTCTGTGTGGAATTCTCGGGTGCCAAGG-L for the nuclear and rAppNNTGACTGTGGAATTCTCGGGTGCCAAGG-L for the Total cell ectract PAR-CLIP ) ligation was performed on beads using truncated T4 RNA Ligase 2 (NEB, M0242). The U2AF1/U2AF2-Crosslinked and 3'-adapter ligated footprints were obtained with proteinase K digestion on beads. The recovered footprints were further size selected (19-35nt insert) by 15% PAGE -8M UREA using ligated 19-35 RNA oligos as markers. The size selected 3'ligeated footprint were ligated with a chimeric DNA -RNA 5' adapter (GTTCAGAGTTCTACAGTCCGrArCrGrArUrCrNrNrNrN) and reverse transcribed using GCCTTGGCACCCGAGAATTCCA and Superscript IV reverse transcriptase following manufactures instructions (Invitrogen 18090010). Illumina HiSeq 2500 gds 303945688 GSM3945688 GEO Accession GSM3945688 SRX6455423 GSM3945689 SRP215460 SRS5112812 GSM3945689 RIP-Seq TRANSCRIPTOMIC other Cells were fractionated into nuclear and cytoplasmic fractions by resuspending in 3 mL mild hypotonic lysis buffer (10 mM TRIS-HCl pH 7.5, 50 mM NaCl, 3 mM MgCl2, 0.1% NP-40 and 10% glycerol) for 2 minutes and 5 minutes centrifugation at 400 g. The nuclear pellet was washed twice with 10 mL of the same buffer and lyzed with 1 mL of a RIPA buffer (150mM NaCl, 1% NP-40, 0.15 %DOX , 0.1 % SDS, 25 mM TRIS-HCl pH 7.5, Protease inhibitors, 1 U/μL RNAse T1 and 50 U/mL DNASE ) followed by sonication (3 X 10 sec; 60 % Amplitude on a VCX130 Vibra-Cell Ultrasonic Liquid Processor) and 30 minutes rotation at 4 oC. The lysate was cleared by centrifugation 10 minutes at 16000 G and diluted by addition of 2 volumes of 20mM TRIS-HCl pH 7.5. The FH-U2AF1/U2AF2 complex was Immunoprecipitated using the Anti-FLAG M2 Magnetic Beads (Sigma), treated with 1 U/mL RNase T1 (1/10000 Thermo Scientific RNase T1, EN0541) and washed 3 times with high salt wash buffer. To obtain the footprints of the U2AF complex 3' pre-adenylated adapter (5'-rAppNNTCTGTGTGGAATTCTCGGGTGCCAAGG-L for the nuclear and rAppNNTGACTGTGGAATTCTCGGGTGCCAAGG-L for the Total cell ectract PAR-CLIP ) ligation was performed on beads using truncated T4 RNA Ligase 2 (NEB, M0242). The U2AF1/U2AF2-Crosslinked and 3'-adapter ligated footprints were obtained with proteinase K digestion on beads. The recovered footprints were further size selected (19-35nt insert) by 15% PAGE -8M UREA using ligated 19-35 RNA oligos as markers. The size selected 3'ligeated footprint were ligated with a chimeric DNA -RNA 5' adapter (GTTCAGAGTTCTACAGTCCGrArCrGrArUrCrNrNrNrN) and reverse transcribed using GCCTTGGCACCCGAGAATTCCA and Superscript IV reverse transcriptase following manufactures instructions (Invitrogen 18090010). Illumina HiSeq 2500 gds 303945689 GSM3945689 GEO Accession GSM3945689