Source Name	Characteristics[sample_name]	Characteristics[organism]	Characteristics[taxonomy_id]	Characteristics[isolate]	Characteristics[biomaterial_provider]	Characteristics[collection_date]	Characteristics[geo_loc_name]	Characteristics[age]	Characteristics[cell_line]	Characteristics[cell_type]	Characteristics[culture_collection]	Characteristics[disease]	Characteristics[disease_stage]	Characteristics[phenotype]	Characteristics[sample_type]	Characteristics[sex]	Characteristics[tissue]	Characteristics[treatment]	Characteristics[race]	Comment[BioSample]	Comment[sample_title]	Comment[description]	Protocol REF	Protocol REF	Protocol REF	Protocol REF	Extract Name	Material Type	Comment[LIBRARY_LAYOUT]	Comment[LIBRARY_SELECTION]	Comment[LIBRARY_SOURCE]	Comment[LIBRARY_STRATEGY]	Comment[INSTRUMENT_MODEL]	Protocol REF	Assay Name	Comment[SRA_EXPERIMENT]	Comment[SRA_RUN]	Technology Type	Array Data File	Protocol REF	Protocol REF	Derived Array Data File	Factor Value[genetic_modification]	Factor Value[antibody]
K562_NT1	K562_NT1	Homo sapiens	9606	not applicable	JCRB Cell Bank	missing: lab stock	missing: lab stock	53	K562	myeloid leukemia cell	JCRB:0019	chronic myelogenous leukemia	blast crisis	GFP positive, fluorescence intensity decreases after EVI1 knockdown	cell culture	female	pleural effusion	genetic modification: Cas9-mediated P2A-EGFP insertion at the EVI1 stop codon, lentiviral transduction of Cas9 and non-targeting sgRNA #1 (CTGAAAAAGGAAGGAGTTGA)	Caucasian	SAMD00858625	K562-EVI1-GFP cells transduced with Cas9 and non-targeting sgRNA #1	K562 cells with a P2A-EGFP sequence inserted at the EVI1 stop codon, transduced with Cas9 and non-targeting sgRNA #1 (CTGAAAAAGGAAGGAGTTGA)	P-GEAD-3513	P-GEAD-3514	P-GEAD-3515	P-GEAD-3518	K562_NT1	genomic DNA	PAIRED	ChIP	GENOMIC	CH_IP_SEQ	NextSeq 2000	P-GEAD-3516	K562_NT1_IgG-ChIP	DRX608872	DRR628544	sequencing assay	DRR628544	P-GEAD-3517	P-GEAD-3519	K562_NT1_IgG-ChIP_FE.bdg	control	IgG
K562_NT2	K562_NT2	Homo sapiens	9606	not applicable	JCRB Cell Bank	missing: lab stock	missing: lab stock	53	K562	myeloid leukemia cell	JCRB:0019	chronic myelogenous leukemia	blast crisis	GFP positive, fluorescence intensity decreases after EVI1 knockdown	cell culture	female	pleural effusion	genetic modification: Cas9-mediated P2A-EGFP insertion at the EVI1 stop codon, lentiviral transduction of Cas9 and non-targeting sgRNA #2 (AAGATGAAAGGAAAGGCGTT)	Caucasian	SAMD00858626	K562-EVI1-GFP cells transduced with Cas9 and non-targeting sgRNA #2	K562 cells with a P2A-EGFP sequence inserted at the EVI1 stop codon, transduced with Cas9 and non-targeting sgRNA #2 (AAGATGAAAGGAAAGGCGTT)	P-GEAD-3513	P-GEAD-3514	P-GEAD-3515	P-GEAD-3518	K562_NT2	genomic DNA	PAIRED	ChIP	GENOMIC	CH_IP_SEQ	NextSeq 2000	P-GEAD-3516	K562_NT2_IgG-ChIP	DRX608873	DRR628545	sequencing assay	DRR628545	P-GEAD-3517	P-GEAD-3519	K562_NT2_IgG-ChIP_FE.bdg	control	IgG
K562_ZFP91-KO1	K562_ZFP91-KO1	Homo sapiens	9606	clone 1A11	JCRB Cell Bank	missing: lab stock	missing: lab stock	53	K562	myeloid leukemia cell	JCRB:0019	chronic myelogenous leukemia	blast crisis	ZFP91 knockout, decreased cell proliferation	cell culture	female	pleural effusion	genetic modification: Cas9-mediated P2A-EGFP insertion at the EVI1 stop codon, lentiviral transduction of Cas9 and ZFP91-targeting sgRNA #1 (GGGTGTTCTCTGTATCACGA), followed by selection for single-cell clones where ZFP91 knockout was confirmed	Caucasian	SAMD00858627	K562-EVI1-GFP cells with ZFP91 knockout (single-cell clone #1)	K562 cells with a P2A-EGFP sequence inserted at the EVI1 stop codon, transduced with Cas9 and ZFP91-targeting sgRNA #1 (GGGTGTTCTCTGTATCACGA), and selected for single-cell clones where ZFP91 knockout was confirmed by Western blot analysis	P-GEAD-3513	P-GEAD-3514	P-GEAD-3515	P-GEAD-3518	K562_ZFP91-KO1	genomic DNA	PAIRED	ChIP	GENOMIC	CH_IP_SEQ	NextSeq 2000	P-GEAD-3516	K562_ZFP91-KO1_IgG-ChIP	DRX608874	DRR628546	sequencing assay	DRR628546	P-GEAD-3517	P-GEAD-3519	K562_ZFP91-KO1_IgG-ChIP_FE.bdg	ZFP91 knockout	IgG
K562_ZFP91-KO2	K562_ZFP91-KO2	Homo sapiens	9606	clone 4G1	JCRB Cell Bank	missing: lab stock	missing: lab stock	53	K562	myeloid leukemia cell	JCRB:0019	chronic myelogenous leukemia	blast crisis	ZFP91 knockout, decreased cell proliferation	cell culture	female	pleural effusion	genetic modification: Cas9-mediated P2A-EGFP insertion at the EVI1 stop codon, lentiviral transduction of Cas9 and ZFP91-targeting sgRNA #2 (TCCTACTACTACGCCAGCCC), followed by selection for single-cell clones where ZFP91 knockout was confirmed	Caucasian	SAMD00858628	K562-EVI1-GFP cells with ZFP91 knockout (single-cell clone #2)	K562 cells with a P2A-EGFP sequence inserted at the EVI1 stop codon, transduced with Cas9 and ZFP91-targeting sgRNA #2 (TCCTACTACTACGCCAGCCC), and selected for single-cell clones where ZFP91 knockout was confirmed by Western blot analysis	P-GEAD-3513	P-GEAD-3514	P-GEAD-3515	P-GEAD-3518	K562_ZFP91-KO2	genomic DNA	PAIRED	ChIP	GENOMIC	CH_IP_SEQ	NextSeq 2000	P-GEAD-3516	K562_ZFP91-KO2_IgG-ChIP	DRX608875	DRR628547	sequencing assay	DRR628547	P-GEAD-3517	P-GEAD-3519	K562_ZFP91-KO2_IgG-ChIP_FE.bdg	ZFP91 knockout	IgG
K562_ZFP91-KO3	K562_ZFP91-KO3	Homo sapiens	9606	clone 5A1	JCRB Cell Bank	missing: lab stock	missing: lab stock	53	K562	myeloid leukemia cell	JCRB:0019	chronic myelogenous leukemia	blast crisis	ZFP91 knockout, decreased cell proliferation	cell culture	female	pleural effusion	genetic modification: Cas9-mediated P2A-EGFP insertion at the EVI1 stop codon, lentiviral transduction of Cas9 and ZFP91-targeting sgRNA #3 (CTGAGACATGCCTTTCTAAG), followed by selection for single-cell clones where ZFP91 knockout was confirmed	Caucasian	SAMD00858629	K562-EVI1-GFP cells with ZFP91 knockout (single-cell clone #3)	K562 cells with a P2A-EGFP sequence inserted at the EVI1 stop codon, transduced with Cas9 and ZFP91-targeting sgRNA #3 (CTGAGACATGCCTTTCTAAG), and selected for single-cell clones where ZFP91 knockout was confirmed by Western blot analysis	P-GEAD-3513	P-GEAD-3514	P-GEAD-3515	P-GEAD-3518	K562_ZFP91-KO3	genomic DNA	PAIRED	ChIP	GENOMIC	CH_IP_SEQ	NextSeq 2000	P-GEAD-3516	K562_ZFP91-KO3_IgG-ChIP	DRX608876	DRR628548	sequencing assay	DRR628548	P-GEAD-3517	P-GEAD-3519	K562_ZFP91-KO3_IgG-ChIP_FE.bdg	ZFP91 knockout	IgG
K562_NT1	K562_NT1	Homo sapiens	9606	not applicable	JCRB Cell Bank	missing: lab stock	missing: lab stock	53	K562	myeloid leukemia cell	JCRB:0019	chronic myelogenous leukemia	blast crisis	GFP positive, fluorescence intensity decreases after EVI1 knockdown	cell culture	female	pleural effusion	genetic modification: Cas9-mediated P2A-EGFP insertion at the EVI1 stop codon, lentiviral transduction of Cas9 and non-targeting sgRNA #1 (CTGAAAAAGGAAGGAGTTGA)	Caucasian	SAMD00858625	K562-EVI1-GFP cells transduced with Cas9 and non-targeting sgRNA #1	K562 cells with a P2A-EGFP sequence inserted at the EVI1 stop codon, transduced with Cas9 and non-targeting sgRNA #1 (CTGAAAAAGGAAGGAGTTGA)	P-GEAD-3513	P-GEAD-3514	P-GEAD-3515	P-GEAD-3518	K562_NT1	genomic DNA	PAIRED	ChIP	GENOMIC	CH_IP_SEQ	NextSeq 2000	P-GEAD-3516	K562_NT1_ZFP91-ChIP	DRX608877	DRR628549	sequencing assay	DRR628549	P-GEAD-3517	P-GEAD-3519	K562_NT1_ZFP91-ChIP_FE.bdg	control	ZFP91
K562_NT2	K562_NT2	Homo sapiens	9606	not applicable	JCRB Cell Bank	missing: lab stock	missing: lab stock	53	K562	myeloid leukemia cell	JCRB:0019	chronic myelogenous leukemia	blast crisis	GFP positive, fluorescence intensity decreases after EVI1 knockdown	cell culture	female	pleural effusion	genetic modification: Cas9-mediated P2A-EGFP insertion at the EVI1 stop codon, lentiviral transduction of Cas9 and non-targeting sgRNA #2 (AAGATGAAAGGAAAGGCGTT)	Caucasian	SAMD00858626	K562-EVI1-GFP cells transduced with Cas9 and non-targeting sgRNA #2	K562 cells with a P2A-EGFP sequence inserted at the EVI1 stop codon, transduced with Cas9 and non-targeting sgRNA #2 (AAGATGAAAGGAAAGGCGTT)	P-GEAD-3513	P-GEAD-3514	P-GEAD-3515	P-GEAD-3518	K562_NT2	genomic DNA	PAIRED	ChIP	GENOMIC	CH_IP_SEQ	NextSeq 2000	P-GEAD-3516	K562_NT2_ZFP91-ChIP	DRX608878	DRR628550	sequencing assay	DRR628550	P-GEAD-3517	P-GEAD-3519	K562_NT2_ZFP91-ChIP_FE.bdg	control	ZFP91
K562_ZFP91-KO1	K562_ZFP91-KO1	Homo sapiens	9606	clone 1A11	JCRB Cell Bank	missing: lab stock	missing: lab stock	53	K562	myeloid leukemia cell	JCRB:0019	chronic myelogenous leukemia	blast crisis	ZFP91 knockout, decreased cell proliferation	cell culture	female	pleural effusion	genetic modification: Cas9-mediated P2A-EGFP insertion at the EVI1 stop codon, lentiviral transduction of Cas9 and ZFP91-targeting sgRNA #1 (GGGTGTTCTCTGTATCACGA), followed by selection for single-cell clones where ZFP91 knockout was confirmed	Caucasian	SAMD00858627	K562-EVI1-GFP cells with ZFP91 knockout (single-cell clone #1)	K562 cells with a P2A-EGFP sequence inserted at the EVI1 stop codon, transduced with Cas9 and ZFP91-targeting sgRNA #1 (GGGTGTTCTCTGTATCACGA), and selected for single-cell clones where ZFP91 knockout was confirmed by Western blot analysis	P-GEAD-3513	P-GEAD-3514	P-GEAD-3515	P-GEAD-3518	K562_ZFP91-KO1	genomic DNA	PAIRED	ChIP	GENOMIC	CH_IP_SEQ	NextSeq 2000	P-GEAD-3516	K562_ZFP91-KO1_ZFP91-ChIP	DRX608879	DRR628551	sequencing assay	DRR628551	P-GEAD-3517	P-GEAD-3519	K562_ZFP91-KO1_ZFP91-ChIP_FE.bdg	ZFP91 knockout	ZFP91
K562_ZFP91-KO2	K562_ZFP91-KO2	Homo sapiens	9606	clone 4G1	JCRB Cell Bank	missing: lab stock	missing: lab stock	53	K562	myeloid leukemia cell	JCRB:0019	chronic myelogenous leukemia	blast crisis	ZFP91 knockout, decreased cell proliferation	cell culture	female	pleural effusion	genetic modification: Cas9-mediated P2A-EGFP insertion at the EVI1 stop codon, lentiviral transduction of Cas9 and ZFP91-targeting sgRNA #2 (TCCTACTACTACGCCAGCCC), followed by selection for single-cell clones where ZFP91 knockout was confirmed	Caucasian	SAMD00858628	K562-EVI1-GFP cells with ZFP91 knockout (single-cell clone #2)	K562 cells with a P2A-EGFP sequence inserted at the EVI1 stop codon, transduced with Cas9 and ZFP91-targeting sgRNA #2 (TCCTACTACTACGCCAGCCC), and selected for single-cell clones where ZFP91 knockout was confirmed by Western blot analysis	P-GEAD-3513	P-GEAD-3514	P-GEAD-3515	P-GEAD-3518	K562_ZFP91-KO2	genomic DNA	PAIRED	ChIP	GENOMIC	CH_IP_SEQ	NextSeq 2000	P-GEAD-3516	K562_ZFP91-KO2_ZFP91-ChIP	DRX608880	DRR628552	sequencing assay	DRR628552	P-GEAD-3517	P-GEAD-3519	K562_ZFP91-KO2_ZFP91-ChIP_FE.bdg	ZFP91 knockout	ZFP91
K562_ZFP91-KO3	K562_ZFP91-KO3	Homo sapiens	9606	clone 5A1	JCRB Cell Bank	missing: lab stock	missing: lab stock	53	K562	myeloid leukemia cell	JCRB:0019	chronic myelogenous leukemia	blast crisis	ZFP91 knockout, decreased cell proliferation	cell culture	female	pleural effusion	genetic modification: Cas9-mediated P2A-EGFP insertion at the EVI1 stop codon, lentiviral transduction of Cas9 and ZFP91-targeting sgRNA #3 (CTGAGACATGCCTTTCTAAG), followed by selection for single-cell clones where ZFP91 knockout was confirmed	Caucasian	SAMD00858629	K562-EVI1-GFP cells with ZFP91 knockout (single-cell clone #3)	K562 cells with a P2A-EGFP sequence inserted at the EVI1 stop codon, transduced with Cas9 and ZFP91-targeting sgRNA #3 (CTGAGACATGCCTTTCTAAG), and selected for single-cell clones where ZFP91 knockout was confirmed by Western blot analysis	P-GEAD-3513	P-GEAD-3514	P-GEAD-3515	P-GEAD-3518	K562_ZFP91-KO3	genomic DNA	PAIRED	ChIP	GENOMIC	CH_IP_SEQ	NextSeq 2000	P-GEAD-3516	K562_ZFP91-KO3_ZFP91-ChIP	DRX608881	DRR628553	sequencing assay	DRR628553	P-GEAD-3517	P-GEAD-3519	K562_ZFP91-KO3_ZFP91-ChIP_FE.bdg	ZFP91 knockout	ZFP91
K562_NT1	K562_NT1	Homo sapiens	9606	not applicable	JCRB Cell Bank	missing: lab stock	missing: lab stock	53	K562	myeloid leukemia cell	JCRB:0019	chronic myelogenous leukemia	blast crisis	GFP positive, fluorescence intensity decreases after EVI1 knockdown	cell culture	female	pleural effusion	genetic modification: Cas9-mediated P2A-EGFP insertion at the EVI1 stop codon, lentiviral transduction of Cas9 and non-targeting sgRNA #1 (CTGAAAAAGGAAGGAGTTGA)	Caucasian	SAMD00858625	K562-EVI1-GFP cells transduced with Cas9 and non-targeting sgRNA #1	K562 cells with a P2A-EGFP sequence inserted at the EVI1 stop codon, transduced with Cas9 and non-targeting sgRNA #1 (CTGAAAAAGGAAGGAGTTGA)	P-GEAD-3513	P-GEAD-3514	P-GEAD-3515	P-GEAD-3518	K562_NT1	genomic DNA	PAIRED	ChIP	GENOMIC	CH_IP_SEQ	NextSeq 2000	P-GEAD-3516	K562_NT1_H3K4me3-ChIP	DRX608882	DRR628554	sequencing assay	DRR628554	P-GEAD-3517	P-GEAD-3519	K562_NT1_H3K4me3-ChIP_FE.bdg	control	H3K4me
K562_NT2	K562_NT2	Homo sapiens	9606	not applicable	JCRB Cell Bank	missing: lab stock	missing: lab stock	53	K562	myeloid leukemia cell	JCRB:0019	chronic myelogenous leukemia	blast crisis	GFP positive, fluorescence intensity decreases after EVI1 knockdown	cell culture	female	pleural effusion	genetic modification: Cas9-mediated P2A-EGFP insertion at the EVI1 stop codon, lentiviral transduction of Cas9 and non-targeting sgRNA #2 (AAGATGAAAGGAAAGGCGTT)	Caucasian	SAMD00858626	K562-EVI1-GFP cells transduced with Cas9 and non-targeting sgRNA #2	K562 cells with a P2A-EGFP sequence inserted at the EVI1 stop codon, transduced with Cas9 and non-targeting sgRNA #2 (AAGATGAAAGGAAAGGCGTT)	P-GEAD-3513	P-GEAD-3514	P-GEAD-3515	P-GEAD-3518	K562_NT2	genomic DNA	PAIRED	ChIP	GENOMIC	CH_IP_SEQ	NextSeq 2000	P-GEAD-3516	K562_NT2_H3K4me3-ChIP	DRX608883	DRR628555	sequencing assay	DRR628555	P-GEAD-3517	P-GEAD-3519	K562_NT2_H3K4me3-ChIP_FE.bdg	control	H3K4me
K562_ZFP91-KO1	K562_ZFP91-KO1	Homo sapiens	9606	clone 1A11	JCRB Cell Bank	missing: lab stock	missing: lab stock	53	K562	myeloid leukemia cell	JCRB:0019	chronic myelogenous leukemia	blast crisis	ZFP91 knockout, decreased cell proliferation	cell culture	female	pleural effusion	genetic modification: Cas9-mediated P2A-EGFP insertion at the EVI1 stop codon, lentiviral transduction of Cas9 and ZFP91-targeting sgRNA #1 (GGGTGTTCTCTGTATCACGA), followed by selection for single-cell clones where ZFP91 knockout was confirmed	Caucasian	SAMD00858627	K562-EVI1-GFP cells with ZFP91 knockout (single-cell clone #1)	K562 cells with a P2A-EGFP sequence inserted at the EVI1 stop codon, transduced with Cas9 and ZFP91-targeting sgRNA #1 (GGGTGTTCTCTGTATCACGA), and selected for single-cell clones where ZFP91 knockout was confirmed by Western blot analysis	P-GEAD-3513	P-GEAD-3514	P-GEAD-3515	P-GEAD-3518	K562_ZFP91-KO1	genomic DNA	PAIRED	ChIP	GENOMIC	CH_IP_SEQ	NextSeq 2000	P-GEAD-3516	K562_ZFP91-KO1_H3K4me3-ChIP	DRX608884	DRR628556	sequencing assay	DRR628556	P-GEAD-3517	P-GEAD-3519	K562_ZFP91-KO1_H3K4me3-ChIP_FE.bdg	ZFP91 knockout	H3K4me
K562_ZFP91-KO2	K562_ZFP91-KO2	Homo sapiens	9606	clone 4G1	JCRB Cell Bank	missing: lab stock	missing: lab stock	53	K562	myeloid leukemia cell	JCRB:0019	chronic myelogenous leukemia	blast crisis	ZFP91 knockout, decreased cell proliferation	cell culture	female	pleural effusion	genetic modification: Cas9-mediated P2A-EGFP insertion at the EVI1 stop codon, lentiviral transduction of Cas9 and ZFP91-targeting sgRNA #2 (TCCTACTACTACGCCAGCCC), followed by selection for single-cell clones where ZFP91 knockout was confirmed	Caucasian	SAMD00858628	K562-EVI1-GFP cells with ZFP91 knockout (single-cell clone #2)	K562 cells with a P2A-EGFP sequence inserted at the EVI1 stop codon, transduced with Cas9 and ZFP91-targeting sgRNA #2 (TCCTACTACTACGCCAGCCC), and selected for single-cell clones where ZFP91 knockout was confirmed by Western blot analysis	P-GEAD-3513	P-GEAD-3514	P-GEAD-3515	P-GEAD-3518	K562_ZFP91-KO2	genomic DNA	PAIRED	ChIP	GENOMIC	CH_IP_SEQ	NextSeq 2000	P-GEAD-3516	K562_ZFP91-KO2_H3K4me3-ChIP	DRX608885	DRR628557	sequencing assay	DRR628557	P-GEAD-3517	P-GEAD-3519	K562_ZFP91-KO2_H3K4me3-ChIP_FE.bdg	ZFP91 knockout	H3K4me
K562_ZFP91-KO3	K562_ZFP91-KO3	Homo sapiens	9606	clone 5A1	JCRB Cell Bank	missing: lab stock	missing: lab stock	53	K562	myeloid leukemia cell	JCRB:0019	chronic myelogenous leukemia	blast crisis	ZFP91 knockout, decreased cell proliferation	cell culture	female	pleural effusion	genetic modification: Cas9-mediated P2A-EGFP insertion at the EVI1 stop codon, lentiviral transduction of Cas9 and ZFP91-targeting sgRNA #3 (CTGAGACATGCCTTTCTAAG), followed by selection for single-cell clones where ZFP91 knockout was confirmed	Caucasian	SAMD00858629	K562-EVI1-GFP cells with ZFP91 knockout (single-cell clone #3)	K562 cells with a P2A-EGFP sequence inserted at the EVI1 stop codon, transduced with Cas9 and ZFP91-targeting sgRNA #3 (CTGAGACATGCCTTTCTAAG), and selected for single-cell clones where ZFP91 knockout was confirmed by Western blot analysis	P-GEAD-3513	P-GEAD-3514	P-GEAD-3515	P-GEAD-3518	K562_ZFP91-KO3	genomic DNA	PAIRED	ChIP	GENOMIC	CH_IP_SEQ	NextSeq 2000	P-GEAD-3516	K562_ZFP91-KO3_H3K4me3-ChIP	DRX608886	DRR628558	sequencing assay	DRR628558	P-GEAD-3517	P-GEAD-3519	K562_ZFP91-KO3_H3K4me3-ChIP_FE.bdg	ZFP91 knockout	H3K4me
K562_NT1	K562_NT1	Homo sapiens	9606	not applicable	JCRB Cell Bank	missing: lab stock	missing: lab stock	53	K562	myeloid leukemia cell	JCRB:0019	chronic myelogenous leukemia	blast crisis	GFP positive, fluorescence intensity decreases after EVI1 knockdown	cell culture	female	pleural effusion	genetic modification: Cas9-mediated P2A-EGFP insertion at the EVI1 stop codon, lentiviral transduction of Cas9 and non-targeting sgRNA #1 (CTGAAAAAGGAAGGAGTTGA)	Caucasian	SAMD00858625	K562-EVI1-GFP cells transduced with Cas9 and non-targeting sgRNA #1	K562 cells with a P2A-EGFP sequence inserted at the EVI1 stop codon, transduced with Cas9 and non-targeting sgRNA #1 (CTGAAAAAGGAAGGAGTTGA)	P-GEAD-3513	P-GEAD-3514	P-GEAD-3515	P-GEAD-3518	K562_NT1	genomic DNA	PAIRED	ChIP	GENOMIC	CH_IP_SEQ	NextSeq 2000	P-GEAD-3516	K562_NT1_H3K27ac-ChIP	DRX608887	DRR628559	sequencing assay	DRR628559	P-GEAD-3517	P-GEAD-3519	K562_NT1_H3K27ac-ChIP_FE.bdg	control	H3K27ac
K562_NT2	K562_NT2	Homo sapiens	9606	not applicable	JCRB Cell Bank	missing: lab stock	missing: lab stock	53	K562	myeloid leukemia cell	JCRB:0019	chronic myelogenous leukemia	blast crisis	GFP positive, fluorescence intensity decreases after EVI1 knockdown	cell culture	female	pleural effusion	genetic modification: Cas9-mediated P2A-EGFP insertion at the EVI1 stop codon, lentiviral transduction of Cas9 and non-targeting sgRNA #2 (AAGATGAAAGGAAAGGCGTT)	Caucasian	SAMD00858626	K562-EVI1-GFP cells transduced with Cas9 and non-targeting sgRNA #2	K562 cells with a P2A-EGFP sequence inserted at the EVI1 stop codon, transduced with Cas9 and non-targeting sgRNA #2 (AAGATGAAAGGAAAGGCGTT)	P-GEAD-3513	P-GEAD-3514	P-GEAD-3515	P-GEAD-3518	K562_NT2	genomic DNA	PAIRED	ChIP	GENOMIC	CH_IP_SEQ	NextSeq 2000	P-GEAD-3516	K562_NT2_H3K27ac-ChIP	DRX608888	DRR628560	sequencing assay	DRR628560	P-GEAD-3517	P-GEAD-3519	K562_NT2_H3K27ac-ChIP_FE.bdg	control	H3K27ac
K562_ZFP91-KO1	K562_ZFP91-KO1	Homo sapiens	9606	clone 1A11	JCRB Cell Bank	missing: lab stock	missing: lab stock	53	K562	myeloid leukemia cell	JCRB:0019	chronic myelogenous leukemia	blast crisis	ZFP91 knockout, decreased cell proliferation	cell culture	female	pleural effusion	genetic modification: Cas9-mediated P2A-EGFP insertion at the EVI1 stop codon, lentiviral transduction of Cas9 and ZFP91-targeting sgRNA #1 (GGGTGTTCTCTGTATCACGA), followed by selection for single-cell clones where ZFP91 knockout was confirmed	Caucasian	SAMD00858627	K562-EVI1-GFP cells with ZFP91 knockout (single-cell clone #1)	K562 cells with a P2A-EGFP sequence inserted at the EVI1 stop codon, transduced with Cas9 and ZFP91-targeting sgRNA #1 (GGGTGTTCTCTGTATCACGA), and selected for single-cell clones where ZFP91 knockout was confirmed by Western blot analysis	P-GEAD-3513	P-GEAD-3514	P-GEAD-3515	P-GEAD-3518	K562_ZFP91-KO1	genomic DNA	PAIRED	ChIP	GENOMIC	CH_IP_SEQ	NextSeq 2000	P-GEAD-3516	K562_ZFP91-KO1_H3K27ac-ChIP	DRX608889	DRR628561	sequencing assay	DRR628561	P-GEAD-3517	P-GEAD-3519	K562_ZFP91-KO1_H3K27ac-ChIP_FE.bdg	ZFP91 knockout	H3K27ac
K562_ZFP91-KO2	K562_ZFP91-KO2	Homo sapiens	9606	clone 4G1	JCRB Cell Bank	missing: lab stock	missing: lab stock	53	K562	myeloid leukemia cell	JCRB:0019	chronic myelogenous leukemia	blast crisis	ZFP91 knockout, decreased cell proliferation	cell culture	female	pleural effusion	genetic modification: Cas9-mediated P2A-EGFP insertion at the EVI1 stop codon, lentiviral transduction of Cas9 and ZFP91-targeting sgRNA #2 (TCCTACTACTACGCCAGCCC), followed by selection for single-cell clones where ZFP91 knockout was confirmed	Caucasian	SAMD00858628	K562-EVI1-GFP cells with ZFP91 knockout (single-cell clone #2)	K562 cells with a P2A-EGFP sequence inserted at the EVI1 stop codon, transduced with Cas9 and ZFP91-targeting sgRNA #2 (TCCTACTACTACGCCAGCCC), and selected for single-cell clones where ZFP91 knockout was confirmed by Western blot analysis	P-GEAD-3513	P-GEAD-3514	P-GEAD-3515	P-GEAD-3518	K562_ZFP91-KO2	genomic DNA	PAIRED	ChIP	GENOMIC	CH_IP_SEQ	NextSeq 2000	P-GEAD-3516	K562_ZFP91-KO2_H3K27ac-ChIP	DRX608890	DRR628562	sequencing assay	DRR628562	P-GEAD-3517	P-GEAD-3519	K562_ZFP91-KO2_H3K27ac-ChIP_FE.bdg	ZFP91 knockout	H3K27ac
K562_ZFP91-KO3	K562_ZFP91-KO3	Homo sapiens	9606	clone 5A1	JCRB Cell Bank	missing: lab stock	missing: lab stock	53	K562	myeloid leukemia cell	JCRB:0019	chronic myelogenous leukemia	blast crisis	ZFP91 knockout, decreased cell proliferation	cell culture	female	pleural effusion	genetic modification: Cas9-mediated P2A-EGFP insertion at the EVI1 stop codon, lentiviral transduction of Cas9 and ZFP91-targeting sgRNA #3 (CTGAGACATGCCTTTCTAAG), followed by selection for single-cell clones where ZFP91 knockout was confirmed	Caucasian	SAMD00858629	K562-EVI1-GFP cells with ZFP91 knockout (single-cell clone #3)	K562 cells with a P2A-EGFP sequence inserted at the EVI1 stop codon, transduced with Cas9 and ZFP91-targeting sgRNA #3 (CTGAGACATGCCTTTCTAAG), and selected for single-cell clones where ZFP91 knockout was confirmed by Western blot analysis	P-GEAD-3513	P-GEAD-3514	P-GEAD-3515	P-GEAD-3518	K562_ZFP91-KO3	genomic DNA	PAIRED	ChIP	GENOMIC	CH_IP_SEQ	NextSeq 2000	P-GEAD-3516	K562_ZFP91-KO3_H3K27ac-ChIP	DRX608891	DRR628563	sequencing assay	DRR628563	P-GEAD-3517	P-GEAD-3519	K562_ZFP91-KO3_H3K27ac-ChIP_FE.bdg	ZFP91 knockout	H3K27ac